Literature DB >> 25008314

Diversity of Anopheles mosquitoes in Binh Phuoc and Dak Nong Provinces of Vietnam and their relation to disease.

Chung Thuy Ngo, Gregor Dubois, Véronique Sinou, Daniel Parzy, Hong Quang Le, Ralph E Harbach, Sylvie Manguin1.   

Abstract

BACKGROUND: Human malaria is still a burden in Dak Nong and Binh Phuoc Provinces in south-central Vietnam that border Cambodia. Several Anopheles species that transmit human malarial Plasmodium may also transmit Wuchereria bancrofti, the nematode that causes Bancroftian lymphatic filariasis. The objective of this study was to investigate the role of Anopheles species in the transmission of these two pathogens in the two highly malaria endemic provinces of Vietnam.
METHODS: Anopheles mosquitoes were collected in Dak Nong and Binh Phuoc Provinces in November and December of 2010 and 2011. Human landing catches, paired collections on human and buffalo, and resting captures were made with mouth aspirators. Collections were also made with light traps. Morphological and PCR-based methods were used to identify the species. Real-time PCR was used to detect Plasmodium species and W. bancrofti in individual mosquitoes.
RESULTS: Twenty-four Anopheles species were identified among 797 captured mosquitoes. Anopheles dirus was found in both provinces and was the predominant species in Binh Phuoc Province; An. maculatus was the most prevalent species in Dak Nong Province. Anopheles minimus was collected only in Binh Phuoc Province. Some specimens of An. minimus and An. pampanai were misidentified based on morphology. Four specimens of An. scanloni were identified, and this is the first report of this species of the Dirus Complex in Vietnam. Two females, one An. dirus and one An. pampanai, collected in Binh Phuoc Province were infected with P. vivax, for an overall infection rate of 0.41% (2/486): 0.28% for An. dirus (1/361) and 20% for An. pampanai (1/5). No mosquitoes were found to be infected with P. falciparum, P. knowlesi or W. bancrofti in either province.
CONCLUSION: A diversity of Anopheles species occurs in Dak Nong and Binh Phuoc Provinces of Vietnam, several of which are considered to be actual and potential vectors of malarial protozoa and microfilariae. It is highly likely that two of the species, An. dirus and An. pampanai, are active in malaria transmission based on the detection of P. vivax in females of these species. This is the first report of An. scanloni in Vietnam.

Entities:  

Mesh:

Year:  2014        PMID: 25008314      PMCID: PMC4227083          DOI: 10.1186/1756-3305-7-316

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Despite a decline in human malaria cases in Vietnam, malaria transmission continues in the forested areas of the southern and central provinces [1-5] where it is a significant public health and economic problem [6]. Several factors contribute to the maintenance of malaria transmission in this region of Vietnam, including a high density of the main vector Anopheles dirus[3,7,8], migration of people from malaria endemic areas [9] and failure to use preventive measures while working in the forest [10]. Moreover, use of insecticides and prophylactic drugs has resulted in resistance in some Anopheles species [11-13] and malarial parasites [14,15]. Furthermore, the monkey malarial protozoan Plasmodium knowlesi[16-21] has been found in both humans [7,22] and Anopheles mosquitoes in Vietnam [7,23]. Marchand et al.[7] reported co-infection of P. falciparum, P. vivax and P. knowlesi in an An. dirus female, indicating that P. knowlesi is most likely transmitted by the same primary vectors of P. falciparum and P. vivax. Hence, malaria caused by P. knowlesi may represent an additional challenge for malaria control in forested areas where An. dirus and the natural hosts of P. knowlesi (macaque monkeys) co-occur, and zoonotic transmission of P. knowlesi could continue in the absence (or elimination) of P. falciparum and P. vivax. Anopheles vectors involved in the transmission of Plasmodium parasites may also transmit Wuchereria bancrofti, the nematode that causes 90% of the lymphatic filariasis cases worldwide [24]. The co-occurrence of malarial and filarial parasites has been reported in endemic areas [25-28]. Unlike malaria, filariasis, a neglected disease, is rarely fatal but severe morbidity, including disabilities and adverse economic consequences due to disfigurement of limbs and male genitals (elephantiasis and hydrocele, respectively), occurs in 40% of infected individuals [29,30]. Bancroftian lymphatic filariasis occurs in the southern and central provinces of Vietnam [31,32], but little information is available about the co-infection of the microfilariae and malarial parasites in Anopheles mosquitoes. Even though Vietnam is now in the pre-elimination phase for the control of lymphatic filariasis [33], it is important to obtain additional information on the prevalence and transmission of this disease to better define its distribution in the country. Binh Phuoc and Dak Nong Provinces are located in forested areas of south-central Vietnam. These two neighboring provinces share the border with Cambodia and are recorded as having the highest burden of malaria nationwide [14,34,35]. Although resistance of P. falciparum to the anti-malarial drugs chloroquine, sulfadoxine-pyrimethamine and mefloquine has been reported in these provinces [14,15], no information concerning the transmission of malarial and filarial parasites is available. To understand the role of Anopheles species in the transmission of Plasmodium and W. bancrofti, and document the diversity of the anopheline mosquitoes in Binh Phuoc and Dak Nong Provinces, we conducted medical entomological surveys in these provinces during 2010 and 2011.

Methods

Study area

Anopheles females were collected in two communes, Bu Gia Map in Binh Phuoc Province (11° 45′ N, 106° 43′ E) and Dak Ngo in Dak Nong Province (11° 59′ N, 107° 42′ E). Temperature in these provinces is around 25°C during the day and falls to 7–9°C at night; the rainy season extends from May to October and the dry season from November to April. The climate is favorable for agriculture, especially coffee, pepper and rubber. Crops of coffee, pepper or cashew nuts are usually grown around houses. The villages are surrounded by cassava, corn and rice fields, and are fringed by forest. The majority of income is from agricultural production. Every year, during harvest time, workers from neighboring regions come to work in the fields; hence, high population movement occurs in these areas. The wood houses are mostly built directly on the ground, but houses near forest or forest fringe are built on stilts. During harvest periods, people live in huts that provide little protection from mosquitoes. Dak Ngo commune covers an area of 16,624 ha and has a population of 8,478 (in 2012), with ethnic minorities accounting for 65% of the residents. Annual incomes are low, 58% of households are poor. Transportation is difficult, especially during the wet season, because most roads are unpaved. Plantations have replaced most of the forest. In 2011, 24 malaria cases were reported in Dak Ngo, including 14 caused by P. falciparum and 10 due to P. vivax (data provided by the Dak Ngo community health station). Unlike Dak Ngo, the roads in the Bu Gia Map commune are mostly paved and the area is mostly surrounded by primary forest, which includes the Bu Gia Map National Park. This commune covers an area of 2,330 ha, has 3,704 inhabitants (in 2009) and is a tourist destination. In 2011, 266 malaria cases were treated, 124 caused by P. falciparum, 138 due to P. vivax and four were mixed infections of P. falciparum and P. vivax (data provided by the Bu Gia Map community health station).

Field collections and morphological identification of mosquitoes

Four methods were used to capture mosquitoes: outdoor human landing catches, paired collections on human and buffalo and resting captures using mouth aspirators, and light trap collections. All collections were conducted from 17:00 until 07:00. The period of collections was the same during 2010 and 2011, during the change from the rainy to the dry season (November and December) when mosquito populations had peaked and a greater number of pathogen-infected females was anticipated. [It should be noted that limited and difficult access to the study sites prevented collections from being made during most of the rainy season.] Mosquitoes captured each hour by each method were retained in separate cups and labelled accordingly. Specimens were identified the following morning using the keys published by the National Institute of Malariology, Parasitology and Entomology [36,37], killed, divided into two parts, head-thorax (with legs and wings) and abdomen, and each part was stored separately at -20°C. The specimens were shipped on dry ice to the IRD laboratory in France and stored at -80°C until further use. In the Dak Ngo commune, mosquitoes were collected at six sites during nine nights in November 2010. During November and December 2011, no Anopheles mosquitoes were collected at these six sites; hence, an additional seventh collecting site was added where a few Anopheles were collected. These collections began at 17:00 and ended at midnight. The paired collections on human and buffalo were made at two sites by two collectors per site, one person performed human landing catches and another person made either resting captures or paired collections. In the Bu Gia Map commune, human landing catches and light trap collections were made at three sites during 11 nights. Collections were made from 17:00 to 20:00. Three or four collectors seated about 10 m apart worked at each site. Two light traps were placed near the collection site.

Ethical statement

The Military Preventive Medicine Centre, Ho Chi Minh City (Vietnam) organized the field study and obtained all necessary permits. Vietnam People’s Army Department of Military Medicine approved the study. Mosquito collections were done with the approval of the head of each village and the owner and occupants of the houses where mosquitoes were collected. Mosquito collectors gave their consent and were treated free of charge for malaria presumed illness throughout the study in accordance with the national drug policy of Vietnam.

DNA extraction

Genomic DNA was extracted from the head-thorax portions of mosquitoes using the Qiagen DNeasy Kit (Qiagen Ltd., Sussex, England). The manufacture’s protocol was followed to obtain a final volume of 100 μl of extracted DNA in TE buffer. Extracted DNA was divided and stored in separate tubes at -20°C for sequencing and parasite detection.

Molecular identification of Anopheles species

Following morphological identification, DNA was extracted from Anopheles specimens belonging to groups and complexes of sibling species for which specific PCR identification methods are available, including the species of the Minimus Complex and closely related species such as An. aconitus, An. pampanai, An. varuna[38], the Dirus Complex [39], and the Maculatus Group [40]. Tfi DNA polymerase (Invitrogen, France) at 5 units/μl was used in all PCR assays. The PCR assay of Walton et al. [39] for the Dirus Complex was modified as follows: the final concentration of DMSO was reduced from 4% to 3.2%, one unit of Tfi DNA Polymerase was substituted for 0.25 unit DNA Polymerase and 2 μl of DNA template was used instead of 0.5 μl. The number of amplification cycles was also increased, from 32 to 35. Positive controls for An. minimus, An. harrisoni, An. aconitus, An. pampanai, An. varuna, An. dirus, An. scanloni, An. baimaii, An. maculatus and An. sawadwongporni, available at LIPMC (IRD, Montpellier, France), were used as references.

Sequencing

Fragments of the mitochondrial genes (cytochrome oxidases 1 and 3, cox I and III) of Plasmodium, and fragments of the mitochondrial DNA (Cytochrome Oxidase subunits 1 and 2, COI and COII) and ribosomal DNA (Domain 3, D3, and Internal Transcribed Spacer 2, ITS2) of Anopheles mosquitoes were amplified and sent out for sequencing (Millegen, Labege Cedex, France). The fragments of cox III for P. falciparum and cox I for P. vivax were amplified using the PCR assay of Cunha et al. [41]. For Anopheles species, the D3 and ITS2 fragments of rDNA were amplified using the pair of primers of Sharpe et al. [42] and Beebe et al. [43], respectively. The COI and COII mitochondrial genes were amplified using the pair of primers described in Simon et al. [44] and Yang et al. [45], respectively. Standard protocols were used for all PCR amplifications. Each 50 μl PCR reaction contained 5 μl of 10X AccuPrime Pfx reaction mix, 1.5 μl of each primer (10 μM), 0.4 μl of AccuPrime Pfx DNA polymerase (2.5 units/μl) and 4 μl of template DNA. Thermal cycling conditions consisted of an initial denaturation step at 95°C for 2 min, then 40 cycles each consisting of denaturation at 95°C for 15 s, annealing for 30 s at 50°C for COI, COII and ITS2 and at 63°C for D3, and extension at 68°C for 45 s with final extension at 68°C for 10 min. The PCR products were kept at 4°C and checked by electrophoresis in 1.5% agarose gel, containing gel red 1X at final concentration. Successfully amplified products were purified using the Nucleo Spin DNA purification kit (Macherey Nalgen, Germany). Direct sequencing of the products in both directions was done with an ABI 377 automated sequencer (PE Applied Bio Systems, Warrington, England).

Detection of Plasmodium species and Wuchereria bancrofti using real-time PCR

LightCycler system 480 (Roche Applied Science, Penzberg, Germany) was used for the real-time PCR detection of sporozoites of three Plasmodium species (P. falciparum, P. vivax and P. knowlesi) and the presence of Wuchereria bancrofti in the head-thorax portions of the mosquitoes. The sequences of the primers and probes used to amplify the target sequences were described by Rao et al. [46,47] and Divis et al. [48], and are listed in Table  1. The Taqman probes were labelled with the reporter dyes FAM, HEX or Cy5 at the 5′ end, and the quencher dyes Black Hole Quencher 1 (BHQ1) and 2 (BHQ2) were added to the 3′ end (detailed in Table  1). Primers and probes were commercially synthesized by Eurogentec (Angers, France). Extracted DNA used as positive controls for P. falciparum and P. vivax was provided by DP, and that used for Wuchereria bancrofti was provided by Dr. J. Pothikasikorn (Mahidol University, Bangkok, Thailand).
Table 1

Sequences of primers and probes used for the detection of species and using multiplex real-time PCR

NameSequence (5′ - 3′)Target
Plasmo 1
GTTAAGGGAGTGAAGACGA TCAGA
Plasmodium sp. and P. knowlesi
Plasmo 2
AACCCAAAGACTTTGATTTC TCATAA
Plasprobe
FAM-ACCGTCGTAATCTTAACCATAAACTATGCCGACTAG-BHQ1
Pk probe
HEX-CTCTCCGGAGATTAGAACTCTTAGATTGCT-BHQ1
FAL_F
CTT TTG AGA GGT TTT GTT ACT TTG AGT AA
Plasmodium falciparum
FAL_R
TAT TCC ATG CTG TAG TAT TCA AAC ACA A
FAL_PB
FAM - TGT TCA TAA CAG ACG GGT AGT CAT GAT TGA GTT CA - BHQ1
VIV_F
ACG CTT CTA GCT TAA TCC ACA TAA CT
Plasmodium vivax
VIV_R
ATT TAC TCA AAG TAA CAA GGA CTT CCA AGC
VIV_PB
HEX - TTC GTA TCG ACT TTG TGC GCA TTT TGC - BHQ1
LDR1_F
ATT TTG ATC ATC TGG GAA CGT TAA TA
Wuchereria bancrofti
LDR2_R
CGA CTG TCT AAT CCA TTC AGA GTG A
WB_PBCy5 - ATC TGC CCA TAG AAA TAA CTA CGG TGG ATC TCT G - BHQ2
Sequences of primers and probes used for the detection of species and using multiplex real-time PCR The real-time PCR mix was prepared using the Platinum Taq polymerase Kit for each PCR run. Total volume (20 μl) of the mix containing (in final concentration) 1X PCR buffer, 4 mM MgCl2, 200 μM dNTP mixture, 0.225 μM of each primer, 0.1 μM of probe, 0.5 Unit Platinum Taq polymerase and 2 μl of DNA template was used to fill a 384-well microplate (Roche Applied Science, Penzberg, Germany). Singleplex real-time PCR was preceded by positive and negative samples to detect the separated target and check the repeatability of the method. Multiplex assays were designed to simultaneously detect several parasite species, e.g. Plasmodium species, P. vivax + W. bancrofti and P. falciparum + P. knowlesi. Amplification consisted of one cycle of denaturation at 95°C for 15 min followed by 45 cycles at 95°C for 20 s, 60°C for 1 min and 40°C for 30 s. Analysis of the singleplex and multiplex data was performed with the LightCycler 480 software (Roche Applied Science, Penzberg, Germany). PCR grade water was used as no-template control. DNA from W. bancrofti, P. falciparum and P. vivax served as positive controls, and DNA extracted from human blood and An. dirus free of Plasmodium and W. bancrofti served as negative controls. All real-time PCR assays were carried out in duplicate, and samples that did not produce fluorescence before the threshold of 40 cycles (Ct) were considered negative. Questionable samples with a single positive well were retested. Specimens that gave a positive signal for the presence of parasites in the real-time PCR before 40 Ct were double checked using conventional PCR developed by Cunha et al. [41] for the detection of P. falciparum and P. vivax.

Results

Identification of Anopheles mosquitoes

A total of 797 Anopheles females were collected in Dak Nong and Binh Phuoc Provinces during November and December of 2010 and 2011. Morphological identifications showed that the specimens represented 20 species, including major malaria vectors of the Dirus Complex and the Funestus and Maculatus Groups (Table  2).
Table 2

species collected in Dak Nong (*) and Binh Phuoc (**) Provinces

Complex/groupTaxaMorphological identificationMolecular identification
Annularis Group
An. philippinensis
5
-
Asiaticus Group
An. asiaticus*
1
-
Barbirostris Group
An. barbirostris**
1
-
An. barbumbrosus
23
-
An. campestris*
5
-
Dirus Complex
An. dirus
390
384
An. scanloni**
0
4
Unidentified
0
2
Funestus Group
An. aconitus**
1
1
An. minimus**
83
78
An. pampanai**
0
5
An. jeyporiensis**
5
-
Hyrcanus Group
An. crawfordi*
49
49
An. nitidus
2
-
Kochi Group
An. kochi
18
-
Lindesayi Group
An. gigas*
24
-
Maculatus Group
An. maculatus
175
152
An. sawadwongporni
0
16
An. rampae**
0
6
Unidentified
0
1
An. karwari**
1
-
Subpictus Group
An. indefinitus**
1
-
An. subpictus
4
-
An. vagus*
2
-
Tessellatus Group
An. tessellatus*
4
-
Umbrosus Group
An. umbrosus*
3
-
Total797

*Species collected in Dak Nong Province only; **Species collected in Binh Phuoc Province only; No asterisk indicates species present in both provinces. Groups that include major malaria vectors are in boldface type. Molecular identification to species level is based on PCR assays available (only) for the Dirus Complex and the Funestus, Hyrcanus and Maculatus Groups.

species collected in Dak Nong (*) and Binh Phuoc (**) Provinces *Species collected in Dak Nong Province only; **Species collected in Binh Phuoc Province only; No asterisk indicates species present in both provinces. Groups that include major malaria vectors are in boldface type. Molecular identification to species level is based on PCR assays available (only) for the Dirus Complex and the Funestus, Hyrcanus and Maculatus Groups. All specimens belonging to the Minimus Complex (n = 83), Dirus Complex (n = 390) and Maculatus Group (n = 175) were processed for specific molecular identification. Misidentifications and discrepancies between morphological and molecular identifications occurred for specimens of each complex and group as shown in Table  2. Of the 83 specimens identified morphologically as An. minimus, five (6%) were An. pampanai based on molecular analysis (Figure  1A). Among the 390 specimens identified initially as An. dirus, DNA analysis showed that four (1%) were actually specimens of An. scanloni (Figure  1B). Finally, of the 175 specimens identified morphologically as An. maculatus, molecular identification revealed the presence of three species: 152 An. maculatus (88%), 16 An. sawadwongporni (9%) and six An. rampae (3%) (Figure  1C).
Figure 1

Multiplex allele-specific PCR products on 2% agarose gel showing specimens of (A), (B) and (C) collected in south-central Vietnam.

Multiplex allele-specific PCR products on 2% agarose gel showing specimens of (A), (B) and (C) collected in south-central Vietnam. In addition to the 20 species originally identified based on morphological characters, molecular identification revealed the presence of four other species, namely An. scanloni, An. pampanai, An. sawadwongporni and An. rampae (Table  2). The dominant species was An. dirus (48%), followed by An. maculatus (19%) and An. minimus (10%) (Figure  2). These three species are the main malaria vectors in Southeast Asia, and represented 77% of the Anopheles females captured in the study sites in Dak Nong and Binh Phuoc Provinces. The other 21 species (180 specimens) represented 23% of the total collection (Figure  2 A, B). Two specimens of the Dirus Complex and one of the Maculatus Group could not be identified by molecular methods (Figure  2). Of these 24 species, eight were commonly found in both provinces, whereas seven and nine species were only collected in Dak Nong or Binh Phuoc Province, respectively (Table  2).
Figure 2

species composition in south-central Vietnam based on molecular identification. (A) Prevalence of the malaria vectors and other taxa; (B) percentage of the “other” 21 species displayed in (A) (arranged alphabetically from bottom to top).

species composition in south-central Vietnam based on molecular identification. (A) Prevalence of the malaria vectors and other taxa; (B) percentage of the “other” 21 species displayed in (A) (arranged alphabetically from bottom to top). Of the 311 specimens collected in Dak Nong Province, 308 were molecularly identified as members of 15 Anopheles species. Anopheles maculatus (48.7%) and An. crawfordi (15.9%) were the dominant species, followed by An. dirus (7.5%), which is considered the main vector of “forest malaria”, An. gigas (8%), An. barbumbrosus (7%), An. kochi (5%) and nine other species (8%) – An. asiaticus, An. campestris, An. nitidus, An. philippinensis, An. sawadwongporni, An. subpictus, An. tessellatus, An. umbrosus and An. vagus, each of which was represented by 1–5 specimens (Table  3).
Table 3

Specimens of the species (n = 24) collected in Dak Nong and Binh Phuoc Provinces, Vietnam

SpeciesProvinces
Dak NongBinh Phuoc
An. aconitus
 
1
An. asiaticus
1
 
An. barbirostris
 
1
An. barbumbrosus
22
1
An. campestris
5
 
An. crawfordi
49
 
An. dirus
23
361
An. gigas
24
 
An. indefinitus
 
1
An. jeyporiensis
 
5
An. karwari
 
1
An. kochi
16
2
An. maculatus
150
2
An. minimus
 
78
An. nitidus
1
1
An. pampanai
 
5
An. philippinensis
4
1
An. rampae
 
6
An. sawadwongporni
3
13
An. scanloni
 
4
An. subpictus
1
3
An. tessellatus
4
 
An. umbrosus
3
 
An. vagus
2
 
Unidentified
3
 
 
311
486
Total797

Major malaria vector species are indicated in boldface.

Specimens of the species (n = 24) collected in Dak Nong and Binh Phuoc Provinces, Vietnam Major malaria vector species are indicated in boldface. Unlike Dak Nong Province, An. dirus (74%) and An. minimus (16%) accounted for 90% of the collections made in Binh Phuoc Province. These two species are known to be the main malaria vectors. Anopheles sawadwongporni, considered to be a secondary vector, represented 3% of the collections. Of the 17 species (486 specimens) collected in the province, 14 species (An. aconitus, An. barbirostris, An. barbumbrosus, An. indefinitus, An. jeyporiensis, An. karwari, An. kochi, An. maculatus, An. nitidus, An. pampanai, An. philippinensis, An. rampae, An. scanloni and An. subpictus) comprised only 7% of the collections, each represented by six or fewer specimens (Table  3). Anopheles scanloni and An. rampae were only collected in Binh Phuoc Province. This is the first discovery of An. scanloni in Vietnam and the first time An. rampae has been found so far south in the country. Comparative analysis of DNA sequences from these two species showed a high degree of similarity with sequences of these species recorded in GenBank (http://www.ncbi.nlm.nih.gov/). The sequences for the Vietnamese species are deposited in GenBank under accession numbers KJ746968-KJ746995.

Detection of Plasmodium species and Wuchereria bancrofti

A total of 765 Anopheles females were assayed for the presence of Plasmodium and W. bancrofti using a multiplex real-time PCR method with Taqman probes. One female of An. dirus and one of An. pampanai captured in Binh Phuoc Province were found to be infected with P. vivax (Figure  3A, B). The conventional PCR method of Cunha et al. [41] for parasite detection was used to confirm the infection of P. vivax (Figure  3C). The PCR products of the two P. vivax isolates were sequenced and both sequences detailed in Additional file 1. Based on these results, the P. vivax infection rate in Anopheles specimens collected in Binh Phuoc was 0.41% (2/486): 0.28% (1/361) for An. dirus and 20% (1/5) for An. pampanai (this high rate is due to the small number of specimens assayed and probably does not reflect the actual rate of infection in this species). None of the Anopheles specimens collected in the two provinces were infected with P. falciparum, P. knowlesi or W. bancrofti, and none collected in Dak Nong Province were infected with P. vivax.
Figure 3

Amplification curves in the multiplex real-time PCR for two mosquitoes positive for . (A) An. 1, Anopheles dirus; (B) An. 2, Anopheles pampanai; and (C) amplification of cytochrome oxidase cox I fragment by conventional PCR of P. vivax detected in Anopheles females collected in Vietnam. Pf and Pv = positive controls for P. falciparum and P. vivax.

Amplification curves in the multiplex real-time PCR for two mosquitoes positive for . (A) An. 1, Anopheles dirus; (B) An. 2, Anopheles pampanai; and (C) amplification of cytochrome oxidase cox I fragment by conventional PCR of P. vivax detected in Anopheles females collected in Vietnam. Pf and Pv = positive controls for P. falciparum and P. vivax.

Discussion

Diversity of Anopheles mosquitoes in Dak Nong and Binh Phuoc Provinces

Vietnam, and Southeast Asia in general, is known to have the most diverse Anopheles fauna and the largest number of species complexes and groups anywhere in the world [49-51]. Anopheles dirus and An. minimus are recognized as the main vectors of malaria in Southeast Asia, but other species have been incriminated, including An. maculatus, An. sawadwongporni, An. sinensis, An. aconitus, An. pampanai, An. harrisoni, An. peditaeniatus and An. philippinensis[1,3-5,7,52]. The density of each species depends on the ecology of the area where transmission occurs [53-56]. One of the sibling species of the Dirus Complex, An. scanloni, is considered to be one of the primary vectors in southern Thailand, and it has also been reported in southern Myanmar, but until now it has not been found in other countries [8,51,57]. In Thailand, An. scanloni is considered to have a non-continuous distribution because it is closely linked to limestone karst habitat [58], which has not been found in Vietnam (CTN, personal observation). Of the 390 females of the Dirus Complex included in the present study, four were molecularly identified as An. scanloni, the first record of this species in Vietnam. Of the eight species that comprise the Dirus Complex, three are now known to occur in Vietnam, i.e. An. scanloni, An. dirus and An. aff. takasagoensis[59]. Although An. rampae of the Maculatus Group has been recorded in northern and north-central provinces of Vietnam (Lang Son, Ninh Binh, Nghe An and Quang Binh Provinces) [40,60], this is the first discovery of this species in the south-central region of the country. This species, An. maculatus and An. sawadwongporni are three species of the Maculatus Group that are known to occur in Vietnam. The Maculatus Group includes nine species in southern Asia that are difficult to distinguish morphologically due to overlapping anatomical characters [49], but despite this shortcoming they are considered to play a role in malaria transmission in several regions [51,61-63]. Anopheles maculatus and An. sawadwongporni, for example, have been implicated in malaria transmission in Vietnam [1,5]. Although four and six specimens of An. scanloni and An. rampae, respectively, were collected in the present study, this once again demonstrates the importance of accurately identifying Anopheles species, especially sibling species, and evinces the reliability of molecular assays for this purpose. This result also highlights the need for further studies to elucidate the occurrence and role of these two species in malaria transmission in Vietnam. In addition to An. scanloni and An. rampae, we collected 22 species of Anopheles that were previously known to occur in Vietnam [1,3-5,53,64-66]. The Anopheles species composition in Dak Nong and Binh Phuoc Provinces included common species, but also species specific to each province. This species specificity is most likely linked to the ecology of the study sites. These two adjoining provinces, with similar climatic conditions, favor the presence of eight common Anopheles species. However, Dak Ngo commune in Dak Nong Province is mainly covered by secondary forest and large plantations of coffee, pepper, cashew nuts or cassava, with people living nearby these plantations to manage their crops. Many insecticides (agrochemicals) were administrated to protect the farm products and dams were constructed for irrigation (CTN, personal observation). These activities are resulting in ecological changes that may affect the distribution of Anopheles species. In contrast, the study area of Bu Gia Map commune in Binh Phuoc Province is mostly covered by primary forest with natural and shaded streams, and this undisturbed tropical forest is known to favor the occurrence of primary malaria vectors, such as species of the Dirus Complex [2,4,55,67]. The distinctive environmental conditions of the two provinces influence the species composition of anophelines: An. dirus and An. minimus are the dominant species in Binh Phuoc Province whereas An. maculatus is dominant in Dak Nong Province. The presence of An. dirus s.l. and An. maculatus s.l is significantly correlated with sampling sites (X2 = 413.6, X2 lim = 3.84, P < 0.00001). However, the objective of this study was not to examine the link between ecological conditions and Anopheles species composition, therefore further study is needed to confirm these results.

Anopheles vectors and transmission of parasites

The occurrence of malaria and lymphatic filariasis, two of the most common mosquito-borne parasitic diseases, the agents of which may be transmitted by the same vectors, was reported in Vietnam in the 1950s and 1970s [68-70], but no more recent studies have been conducted. The WHO considered lymphatic filariasis to be one of six infectious diseases that could be eradicated, and the regular surveillance of the disease and its vectors is mandatory to reach this goal [33]. Of the 24 Anopheles species identified in Dak Nong and Binh Phuoc Provinces during the present study, nine species (An. aconitus, An. barbirostris, An. dirus, An. maculatus, An. minimus, An. philippinensis, An. subpictus, An. tessellatus and An. vagus) were previously considered to be potential vectors for co-transmission of Plasmodium and Wuchereria[24]. Two mosquitoes, one An. dirus and one An. pampanai, were found infected by P. vivax but none were found infected with W. bancrofti, P. falciparum or P. knowlesi. The overall infection rate in Binh Phuoc Province was 0.41% (2/486), 0.28% (1/384) for An. dirus and 20% (1/5) for An. pampanai, and nil in Dak Nong Province. These results are in agreement with those reported by Nguyen in 2006 [31], who conducted a study of lymphatic filariasis in Khanh Hoa Province (located in south-central Vietnam east of Dak Nong and Bonh Phuoc Provinces) and reported that 3.64% of the population suffered from Bancroftian lymphatic filariasis; however, none of 144 An. vagus dissected were infected with W. bancrofti. Vietnam is one of the countries that have been considered to be in the pre-elimination phase of controlling lymphatic filariasis since 2011, and this study contributes to the surveillance of mosquitoes that potentially carry the parasite. Cases of malaria reported in Vietnam are mostly due to P. falciparum (63%). Plasmodium vivax accounts for almost all other cases (37%) as P. malariae and P. ovale are seldom recorded [71] and a few cases attributable to P. knowlesi have been reported in south-central Vietnam [22]. A high proportion of asymptomatic cases, sometimes more than 80%, have been found in some areas [72]. Recently, sporozoite positive Anopheles females have been reported in various northern, central and southern areas of Vietnam [1,3-5,7,53], with An. dirus and An. minimus being the main malaria vectors. Besides these primary vectors, published reports also indicate the possible role of other Anopheles species, including An. pampanai, in malaria transmission [3,5,7,23]. The P. vivax infection rate in Binh Phuoc Province (0.41%; 2/486) is higher than the infection rate in the Anopheles population of Khe Ngang in Quang Binh Province (0.24%; 9/3,770) [1] and in seven species of Anopheles from Vietnamese and Cambodian populations (0.08%; 13/16,160) assayed by Durnez et al. [52]. However, it was lower than the infection rates previously reported by Marchand et al. [7] for An. dirus in Khanh Phu of Khanh Hoa Province infected with P. vivax (0.76%; 43/5,663), Sanh et al. [4] for An. dirus in Dong Thong of Ninh Thuan Province infected with P. falciparum (0.67%; 1/149) and Trung et al. [53] for An. minimus in Lang Nhot of Khanh Hoa Province infected with P. vivax (0.83%; 3/361). However, the infection rate of An. pampanai in the present study was quite high (20%; 1/5), due to the paucity of specimens collected. Anopheles pampanai was incriminated as a vector of P. vivax in Vietnam prior to this study [5,52]. Durnez et al. [52] reported that 1.54% (1/65) of the An. pampanai females collected in Ninh Thuan Province were infected with P. vivax. As for the transmission of P. knowlesi in Vietnam, Marchand et al. [7] reported that 0.55% (31/5,663) of the An. dirus females collected in Khanh Phu of Khanh Hoa Province were infected with P. knowlesi. No Anopheles specimens were found to be infected by either P. knowlesi or P. falciparum in the present study; however, malaria cases are still reported in Dak Nong Province, and in a similar survey conducted in that province in 2007, using the conventional PCR method of Cunha et al. [41], we found that 2.03% (5/246) of the Anopheles females collected were infected with P. vivax: An. minimus (3/76) and An. maculatus (2/22) (CTN & SM, unpublished data). Since this is the first study to examine Anopheles for co-infections of Plasmodium and W. bancrofti in south-central Vietnam, further study on a larger scale is needed to elucidate the role that different Anopheles species may play in the transmission of these parasites.

Conclusions

The Anopheles fauna of Dak Nong and Binh Phuoc Provinces comprises at least the 24 species that were collected and identified during the present study, including species found in both provinces and species specific to each province. The primary malaria vector, An. dirus, was found in both provinces and was the dominant species in Binh Phuoc Province. Anopheles maculatus was the dominant species in Dak Nong Province but was scarce in Binh Phuoc Province. Anopheles minimus was only encountered in Binh Phuoc Province. This is the first report of the occurrence of An. scanloni of the Dirus Complex in Vietnam, and the most southerly collection of An. rampae of the Maculatus Group made in Vietnam thus far. No infections of P. falciparum, P. knowlesi or W. bancrofti were detected in 765 Anopheles females assayed. One An. dirus and one An. pampanai collected in Binh Phuoc Province were infected with P. vivax, giving an infection rate of 0.28% (1/384) for An. dirus, 20% (1/5) for An. pampanai and an overall infection rate of 0.41% (2/486). Further study is needed to gain a better understanding of the vector status of different Anopheles species and their individual roles in malaria transmission in south-central Vietnam.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

CTN designed the study, was involved in organising the fieldwork, participated in the field collections, conducted the analyses, interpreted the results, wrote and revised the manuscript. GD was involved in interpreting the results of molecular analyses and revising the manuscript. VS and DP were involved in organising the field work and revising the manuscript. HQL organised the field work and participated in the field collections. REH assisted with the identification of Anopheles crawfordi, reviewed the results and revised the manuscript. SM participated in the design of the study, interpretation of the results and supervised all stages of the work, including revising the manuscript. All authors read and approved the final manuscript.

Additional file 1

Sequences of isolated in mosquitoes from Binh Phuoc, Vietnam. Click here for file
  58 in total

Review 1.  Bionomics, taxonomy, and distribution of the major malaria vector taxa of Anopheles subgenus Cellia in Southeast Asia: an updated review.

Authors:  S Manguin; C Garros; I Dusfour; R E Harbach; M Coosemans
Journal:  Infect Genet Evol       Date:  2007-11-29       Impact factor: 3.342

2.  Knowlesi malaria: newly emergent and of public health importance?

Authors:  Janet Cox-Singh; Balbir Singh
Journal:  Trends Parasitol       Date:  2008-08-03

3.  Environmental variables associated with immature stage habitats of culicidae collected in aboriginal villages in Pahang, Malaysia.

Authors:  Wan Najdah Wan Mohamad Ali; Rohani Ahmad; Zurainee Mohamed Nor; Zamree Ismail; Mohd Noor Ibrahim; Azahari Abdul Hadi; Rahimi Hassan; Lee Han Lim
Journal:  Southeast Asian J Trop Med Public Health       Date:  2012-11       Impact factor: 0.267

4.  Geographic distribution and biting behaviour of four species of the Anopheles dirus complex (Diptera: Culicidae) in Thailand.

Authors:  V Baimai; U Kijchalao; P Sawadwongporn; C A Green
Journal:  Southeast Asian J Trop Med Public Health       Date:  1988-03       Impact factor: 0.267

5.  Forest malaria in central Vietnam.

Authors:  Nguyen Hong Sanh; Nguyen Van Dung; Nguyen Xuan Thanh; Trieu Nguyen Trung; Truong Van Co; Robert D Cooper
Journal:  Am J Trop Med Hyg       Date:  2008-11       Impact factor: 2.345

6.  A single multiplex assay to identify major malaria vectors within the African Anopheles funestus and the Oriental An. minimus groups.

Authors:  Claire Garros; Lizette L Koekemoer; Maureen Coetzee; Marc Coosemans; Sylvie Manguin
Journal:  Am J Trop Med Hyg       Date:  2004-06       Impact factor: 2.345

7.  Malaria transmission and major malaria vectors in different geographical areas of Southeast Asia.

Authors:  H D Trung; W Van Bortel; T Sochantha; K Keokenchanh; N T Quang; L D Cong; M Coosemans
Journal:  Trop Med Int Health       Date:  2004-02       Impact factor: 2.622

8.  Concomitant infections of Plasmodium falciparum and Wuchereria bancrofti on the Kenyan coast.

Authors:  Ephantus J Muturi; Charles M Mbogo; Joseph M Mwangangi; Zipporah W Ng'ang'a; Ephantus W Kabiru; Charles Mwandawiro; John C Beier
Journal:  Filaria J       Date:  2006-05-24

9.  Impact of insecticide-treated nets on wild pyrethroid resistant Anopheles epiroticus population from southern Vietnam tested in experimental huts.

Authors:  Wim Van Bortel; Vu Duc Chinh; Dirk Berkvens; Niko Speybroeck; Ho Dinh Trung; Marc Coosemans
Journal:  Malar J       Date:  2009-10-29       Impact factor: 2.979

10.  The economic burden of malaria on the household in south-central Vietnam.

Authors:  Chantal M Morel; Ngo Duc Thang; Nguyen Xuan Xa; Le Xuan Hung; Le Khan Thuan; Pham Van Ky; Annette Erhart; Anne J Mills; Umberto D'Alessandro
Journal:  Malar J       Date:  2008-08-27       Impact factor: 2.979

View more
  12 in total

1.  A sensitive, specific and reproducible real-time polymerase chain reaction method for detection of Plasmodium vivax and Plasmodium falciparum infection in field-collected anophelines.

Authors:  Sara A Bickersmith; William Lainhart; Marta Moreno; Virginia M Chu; Joseph M Vinetz; Jan E Conn
Journal:  Mem Inst Oswaldo Cruz       Date:  2015-05-29       Impact factor: 2.743

2.  Bacterial diversity associated with wild caught Anopheles mosquitoes from Dak Nong Province, Vietnam using culture and DNA fingerprint.

Authors:  Chung Thuy Ngo; Fabien Aujoulat; Francisco Veas; Estelle Jumas-Bilak; Sylvie Manguin
Journal:  PLoS One       Date:  2015-03-06       Impact factor: 3.240

Review 3.  Biology, distribution and control of Anopheles (Cellia) minimus in the context of malaria transmission in northeastern India.

Authors:  Vas Dev; Sylvie Manguin
Journal:  Parasit Vectors       Date:  2016-11-15       Impact factor: 3.876

4.  Diversity of the Bacterial Microbiota of Anopheles Mosquitoes from Binh Phuoc Province, Vietnam.

Authors:  Chung T Ngo; Sara Romano-Bertrand; Sylvie Manguin; Estelle Jumas-Bilak
Journal:  Front Microbiol       Date:  2016-12-23       Impact factor: 5.640

5.  Prevalence of human and non-human primate Plasmodium parasites in anopheline mosquitoes: a cross-sectional epidemiological study in Southern Vietnam.

Authors:  Vu Duc Chinh; Gaku Masuda; Vu Viet Hung; Hidekazu Takagi; Satoru Kawai; Takeshi Annoura; Yoshimasa Maeno
Journal:  Trop Med Health       Date:  2019-01-23

6.  Residual Malaria Transmission in Select Countries of Asia-Pacific Region: Old Wine in a New Barrel.

Authors:  Jeffrey Hii; John Hustedt; Michael J Bangs
Journal:  J Infect Dis       Date:  2021-04-27       Impact factor: 5.226

7.  MALDI-TOF mass spectrometry identification of mosquitoes collected in Vietnam.

Authors:  Ly Na Huynh; Adama Zan Diarra; Hong Sang Nguyen; Long Bien Tran; Van Nguyen Do; Tran Duc Anh Ly; Van Hoang Ho; Xuan Quang Nguyen; Philippe Parola
Journal:  Parasit Vectors       Date:  2022-01-28       Impact factor: 3.876

8.  Entomological survey in two communes with residual malaria transmission in Gia Lai Province in the central highlands of Vietnam.

Authors:  Thai Quang Nguyen; Manh Duc Nguyen; Vinh Xuan Pham; Huan Mah Ro; Michael D Edstein; Weng K Chow; Nicholas J Martin; Jeffrey C Hertz; Maysa T Motoki
Journal:  Malar J       Date:  2021-10-16       Impact factor: 2.979

9.  Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

Authors:  V Chaumeau; C Andolina; B Fustec; N Tuikue Ndam; C Brengues; S Herder; D Cerqueira; T Chareonviriyaphap; F Nosten; V Corbel
Journal:  PLoS One       Date:  2016-07-21       Impact factor: 3.240

10.  The prevalence, incidence and prevention of Plasmodium falciparum infections in forest rangers in Bu Gia Map National Park, Binh Phuoc province, Vietnam: a pilot study.

Authors:  Do Hung Son; Nguyen Thuy-Nhien; Lorenz von Seidlein; Truong Le Phuc-Nhi; Ngo Thi Phu; Nguyen Thi Kim Tuyen; Nguyen Huyen Tran; Nguyen Van Dung; Bui Van Quan; Nicholas P J Day; Arjen M Dondorp; Nicholas J White; Guy E Thwaites; Tran Tinh Hien
Journal:  Malar J       Date:  2017-11-06       Impact factor: 2.979

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.