| Literature DB >> 24969679 |
Guorui Hu1, Ping He1, Zhifeng Liu1, Qian Chen2, Bixia Zheng2, Qihua Zhang2.
Abstract
Intrahepatic cholestasis represents a heterogeneous group of disorders that begin during childhood, most commonly manifesting as neonatal cholestasis, and lead to ongoing liver dysfunction in children and adults. For children, inherited pathogenic factors of cholestasis have gained increasing attention owing to the rapid development of molecular biology technology. However, these methods have their advantages and disadvantages in terms of simplicity, sensitivity, specificity, time required and expense. In the present study, an effective, sensitive and economical method is recommended, termed high-resolution melting (HRM) analysis and direct sequencing, based on general polymerase chain reaction, to detect mutations in disease‑causing genes. As one type of inherited intrahepatic cholestasis, progressive familial intrahepatic cholestasis type 2 (PFIC2) is caused by pathogenic mutations in the ABCB11 gene, HRM was used to detect mutations in the ABCB11 gene in the present study, and the diagnosis for PFIC2 was made by comprehensive analysis of genetic findings and clinical features. Furthermore, the characteristics of mutations and single nucleotide polymorphisms (SNPs) in the ABCB11 gene were elucidated. A total of 14 types of mutations/polymorphisms were identified in 20 patients from mainland China, including six missense mutations (p.Y337H, p.Y472C, p.R696W, p.Q931P, p.D1131V and p.H1198R), one nonsense mutation (p.R928X) and seven SNPs (p.D36D/rs3815675, p.F90F/rs4148777, p.Y269Y/rs2287616, p.I416I/rs183390670, p.V444A/rs2287622, p.A865V/rs118109635 and p.A1028A/rs497692). Five mutations were novel. The majority of the mutations were different from those detected in other population groups. A total of 4/20 patients (1/5) were diagnosed to be PFIC2 by combining genetic findings with the clinical features. Polymorphisms V444A and A1028A, with an allele frequency of 74.5 and 67.2%, respectively, were highly prevalent in the mainland Chinese subjects. No differences were found between the patients with cholestasis and the control subjects. Efficient genetic screening facilitates the clinical diagnosis of genetic disorders. The present study demonstrated that HRM analysis was efficient and effective in detecting mutations and expanded the known spectrum of ABCB11 gene mutations.Entities:
Mesh:
Substances:
Year: 2014 PMID: 24969679 PMCID: PMC4121405 DOI: 10.3892/mmr.2014.2349
Source DB: PubMed Journal: Mol Med Rep ISSN: 1791-2997 Impact factor: 2.952
Primers for PCR amplification of ABCB11 for HRM analysis.
| Exon | Primer sequence | Amplicon length (bp) |
|---|---|---|
| 2 | F: 5′ CTTTCGTTTGGCTACTTTGATTA 3′ | 213 |
| 3 | F: 5′ CGTTGCATTTTGTCATTATTATTAACT 3′ | 113 |
| 4 | F: 5′ ATTGTATTGGAAAGGGTGGTC 3′ | 144 |
| 5 | F: 5′ AGATGATCTCTGAACCCTT 3′ | 329 |
| 6 | F: 5′ CAAGTCTGAACATTCTTTTCCC 3′ | 191 |
| 7 | F: 5′ TGCAATGCTAAACATTCCTT3′ | 223 |
| 8 | F: 5′ ACTGAGACTTTCAGCAAGATA 3′ | 274 |
| 9 | F: 5′ CTTACCTAATTTCTTGGACTTCACA 3′ | 228 |
| 10 | F: 5′ TAACTTGAGCTGTTTCTGCC 3′ | 252 |
| 11 | F: 5′ CATGGAAGACCCAAATGATAGT 3′ | 233 |
| 12 | F: 5′ TAGTTTGAGTTTACACTGTGTCC 3′ | 204 |
| 13 | F: 5′ GTGACAATCTGAACTTTGCT 3′ | 231 |
| 14 | F: 5′ GTTGTGATGTTGTGCCC 3′ | 282 |
| 15 | F: 5′ CAGAAGCCATCAAATTCTTT 3′ | 268 |
| 16 | F: 5′ TTTGTTTAATGGTGCACTGT 3′ | 301 |
| 17 | F: 5′ CTTGGATATGGTTCTGTTTATTGTA 3′ | 157 |
| 18 | F: 5′ GTCTACACTGTTTCATCTTTCTG 3′ | 184 |
| 19 | F: 5′ ATGTCTTGAGTACATTTAGATGAT 3′ | 249 |
| 20 | F: 5′ TTGGACAGATATATAATGACATGGT 3′ | 258 |
| 21 | F: 5′ AATTTCTCTAACATCTCCCTCT 3′ | 244 |
| 22 | F: 5′ GTGTCTGAGACGGGTTGATT 3′ | 331 |
| 23 | F: 5′ TGCCCTTGTATTCCTAAGACTC 3′ | 330 |
| 24 | F: 5′ GTCTGGTTACAGGGTGATCT 3′ | 193 |
| 25 | F: 5′ GCTTCAGTAAGAGCATCTCTAAT 3′ | 300 |
| 26 | F: 5′ AAACCTAATGACCTGTCATCTC 3′ | 270 |
| 27 | F: 5′ AGGAGCAATAACTGTTTCTATTT 3′ | 241 |
| 28 | F: 5′ GCATCTTTGCATCAACTTTC 3′ | 277 |
All the primer sequences were from 5′-3′. PCR, polymerase chain reaction; HRM, high-resolution melting; F, forward primer; R, reverse primer.
Primers for PCR amplification of ABCB11 for direct sequencing.
| Exon | Primer sequence | Amplicon length (bp) |
|---|---|---|
| 2 | F: 5′ GACTGTGGCTTATCTTTCCTG 3′ | 461 |
| 3 | F: 5′ GAGTAAAGGTAGCAGCACTC 3′ | 500 |
| 4 | F: 5′ CGCTAGTGAACCTGAGATTG 3′ | 519 |
| 5 | F: 5′ CTCTGCCACTCAATTAAGGTG 3′ | 550 |
| 6 | F: 5′ GGTACCATGAGGTCTGTTTAG 3′ | 431 |
| 7 | F: 5′ CCTGCTGAAGGTTCTGTTTA 3′ | 543 |
| 8 | F: 5′ GATCTGAGAGGCTGTTAATGC 3′ | 414 |
| 9 | F: 5′ CCCTGGATGAAGCTTACCAT 3′ | 504 |
| 10 | F: 5′ AGTATCGCCCTTTCAACATG 3′ | 494 |
| 11 | F: 5′ CCAAACAGCCAAAGAGCTAG 3′ | 392 |
| 12 | F: 5′ CAGAGCAACAACCAGATAAAAC 3′ | 387 |
| 13 | F: 5′ TACTTCTTGGTCATGGCTCT 3′ | 532 |
| 14 | F: 5′ GCCTCTATTTTTTCTGCCCAT 3′ | 467 |
| 15 | F: 5′ GTCTGGGGAAGGGATATTTC 3′ | 491 |
| 16 | F: 5′ TGTGCTGGCCTTTTCTAATG 3′ | 461 |
| 17 | F: 5′ TAGAATCTGCAGGACAAGTC 3′ | 451 |
| 18 | F: 5′ CACTCTGAATCTGGGTCCAA 3′ | 463 |
| 19 | F: 5′ ATTCAAGCCACAGCAATAGT 3′ | 522 |
| 20–21 | F: 5′ CACAGATCCACAGCTTACAT 3′ | 624 |
| 22 | F: 5′ ACATTGTGAAATGCCACTGA 3′ | 465 |
| 23 | F: 5′ CTTTGTATTCCCAGATGATGC 3′ | 537 |
| 24 | F: 5′ CTCTCCATTTCCAGACAAGT 3′ | 483 |
| 25 | F: 5′ CAGAACACAAAATGGAATGTCC 3′ | 539 |
| 26 | F: 5′ GCCTTGGGATTGTTAGTCTG 3′ | 486 |
| 27 | F: 5′ TGCTTCCCACATCAAATGTC 3′ | 490 |
| 28 | F: 5′ CAGGTCGTGTTAACTGAACT 3′ | 448 |
All the primer sequences were from 5′-3′. PCR, polymerase chain reaction; F, forward primer; R, reverse primer.
Mutations and SNPs of the ABCB11 gene in patients.
| Variant | Exon | Amino acid change | RefSNP | Patients and status | Carrier rate in control (%) |
|---|---|---|---|---|---|
| c.108T>C | 4 | D36D | rs3815675 | Heterozygous: P7, P11, P16 | - |
| c.270T>C | 5 | F90F | rs4148777 | Heterozygous: P6, P13 | - |
| c.807T>C | 9 | Y269Y | rs2287616 | Heterozygous: P7, P11, P16 | - |
| c.1009T>C | 10 | Y337H | - | Heterozygous: P5 | 0 |
| c.1248C>A | 12 | I416I | rs183390670 | Heterozygous: P13 | - |
| c.1331T>C | 13 | V444A | rs2287622 | Heterozygous: P1, P5, P12, P16, P17, P19 | 94.5 |
| c.1415A>G | 13 | Y472C | - | Heterozygous: P3 | 0 |
| c.2086C>T | 18 | R696W | - | Heterozygous: P11 | 0 |
| c.2594C>T | 21 | A865V | rs118109635 | Heterozygous: P7, P17 | - |
| c.2782C>T | 22 | R928X | - | Heterozygous: P1 | 0 |
| c.2792A>C | 22 | Q931P | - | Heterozygous: P4 | 0 |
| c.3084A>G | 24 | A1028A | rs497692 | Heterozygous: P1, P8, P12, P13, P15, P16, P17, P20 | 90.5 |
| c.3392A>T | 25 | D1131V | - | Heterozygous: P3 | 0 |
| c.3593A>G | 26 | H1198R | - | Heterozygous: P1 | 0 |
RefSNP refers to the reference SNP in the Single Nucleotide Polymorphism Database of NCBI. SNP, single nucleotide polymorphism.
Figure 1Schematic view of BSEP (NCBI reference sequence, NP_003733.2) with the location of the variants identified in the study using the TOPO2 program (http://www.sacs.ucsf.edu/TOPO2/). Walker A motif, ABC transporter signature motif and Walker B motif (33) are illustrated in orange, purple and brown, respectively. The genetic variants are represented as green for single nucleotide polymorphism, blue for missense mutation and red for nonsense mutation.
Figure 2Examples of high-resolution melting analysis for screening mutations/single nucleotide polymorphisms of the ABCB11 gene. In difference plots, the melting profile of a wild-type control was selected as a horizontal base line and the relative differences in the melting of all the other samples were plotted relative to this baseline. In exon 22, the melting curve of the patient with heterozygous p.R928X (c.2782C>T) shifted away from those without mutations or with homozygous mutations. The strategy of spike-in control DNA was used and the pattern of melting curves did not change. Following direct sequencing, p.R928X was identified.
Prediction of functional consequences of missense mutations and polymorphisms in ABCB11 gene found in patients.
| Variant | SIFT | PolyPhen-2 | SNPs&GO | EC/EN |
|---|---|---|---|---|
| c.1009T>C (Y337H) | 0.01 | 0.996 | Disease | EC |
| c.1331T>C (V444A) | 0.34 | 0.001 | Neutral | EC |
| c.1415A>G (Y472C) | 0 | 1.000 | Disease | EC |
| c.2086C>T (R696W) | 0.02 | 0.999 | Disease | EC |
| c.2594C>T (A865V) | 0.07 | 0.880 | Disease | EC |
| c.2792A>C (Q931P) | 0.02 | 0.178 | Disease | EN |
| c.3392A>T (D1131V) | 0 | 1.000 | Disease | EC |
| c.3593A>G (H1198R) | 0 | 1.000 | Disease | EC |
SIFT, Sorting Intolerant From Tolerant (mutation of residues with SIFT scores <0.05 are predicted to be deleterious); PolyPhen-2, Polymorphism Phenotyping version 2 (a score <0.2 denotes benign variants, between 0.2 and 0.85 is possibly damaging and >0.85 is highly likely damaging); SNPs&GO, a web tool to predict function of SNPs with a result of neutral or disease-related variants for human; EC, evolutionarily conserved; EN, evolutionarily non-conserved; SNP, single nucleotide polymorphism.
Characteristics of patients with disease-causing mutations in ABCB11.
| Patient | Age of onset/gender | Symptoms | GGT (U/l) | TBA (μmol/l) | TBIL/DBIL (μmol/l) | ALT/AST (U/l) | Mutation | Mutation origin |
|---|---|---|---|---|---|---|---|---|
| P1 | 1 m/M | Persistent jaundice, hepatosplenomegaly | 49 | 101.3 | 162.5/130.4 | 432/606 | Compound heterozygous p.R928X/p.H1198R | R928X, maternal; H1198R, paternal. |
| P3 | 2 d/F | Persistent jaundice, pruritus, hepatosplenomegaly | 32 | 256.1 | 166.7/137.4 | 158/235 | Compound heterozygous p.Y472C/p.D1131V | Y472C, paternal. D1131V, maternal. |
| P5 | 6 d/M | Progressive jaundice | 46 | NA | 99.7/72.6 | 165/211 | Heterozygous p.Y337H | NA |
| P11 | 4 d/M | Progressive jaundice | 74 | 204.6 | 75.4/54.3 | 481/600 | Heterozygous p.R696W | NA |
GGT, gamma-glutamyltransferase; TBA, total bile acid; TBIL, total bilirubin; DBIL, direct bilirubin; ALT, alanine transaminase; AST, aspartate transaminase; M, male; F, female; NA, not available.
Distribution of polymorphisms and allele frequencies in Chinese patients and control subjects.
| A, p.V444A (c.1331T>C) | ||||||
|---|---|---|---|---|---|---|
|
| ||||||
| Variable | PFIC2 (%) | Cholestasis (non-PFIC2) (%) | Control (%) | Pa | Pb | Pc |
| Polymorphism | 0.847 | 0.493 | 0.580 | |||
| TT | 0 (0.0) | 1 (6.3) | 11 (5.5) | |||
| TC | 2 (50.0) | 4 (25.0) | 80 (40.0) | |||
| CC | 2 (50.0) | 11 (68.7) | 109 (54.5) | |||
| Total no. of patients | 4 | 16 | 200 | |||
| Allele frequency | 0.974 | 0.396 | 0.693 | |||
| T (%) | 2 (25.0) | 6 (18.8) | 102 (25.5) | |||
| C (%) | 6 (75.0) | 26 (81.2) | 298 (74.5) | |||
|
| ||||||
| B, p.A1028A (c.3084A>G) | ||||||
|
| ||||||
| Variable | PFIC2 (%) | Cholestasis (non-PFIC2) (%) | Control (%) | Pa | Pb | Pc |
|
| ||||||
| Polymorphism | 0.500 | 0.361 | 0.116 | |||
| AA | 1 (25.0) | 0 (0.0) | 19 (9.5) | |||
| AG | 1 (25.0) | 7 (43.8) | 93 (46.5) | |||
| GG | 2 (50.0) | 9 (56.2) | 88 (44.0) | |||
| Total no. of patients | 4 | 16 | 200 | |||
| Allele frequency | 0.777 | 0.204 | 0.361 | |||
| A (%) | 3 (37.5) | 7 (21.9) | 131 (32.8) | |||
| G (%) | 5 (62.5) | 25 (78.1) | 269 (67.2) | |||
Pa, PFIC2 vs. control; Pb, cholestasis (non-PFIC2) vs. control; Pc, PFIC2 vs. cholestasis (non-PFIC2). P<.017 was considered significant according to Bonferroni correction for multiple testing. The genotype distribution of control subjects was in Hardy-Weinberg equilibrium (V444A, P=0.46; A1028A, P=0.43). PFIC2, progressive familial intrahepatic cholestasis type 2.