Mohamed Kabbout1, Duaa Dakhlallah2, Sudarshana Sharma3, Agnieszka Bronisz3, Ruchika Srinivasan1, Melissa Piper4, Clay B Marsh4, Michael C Ostrowski3. 1. Department of Molecular and Cellular Biochemistry, College of Medicine, The Ohio State University, Columbus, Ohio, United States of America; Graduate Program in Molecular Cellular and Developmental Biology, The Ohio State University, Columbus, Ohio, United States of America; Solid Tumor Program, Comprehensive Cancer Center, The Ohio State University, Columbus, Ohio, United States of America. 2. Graduate Program in Molecular Cellular and Developmental Biology, The Ohio State University, Columbus, Ohio, United States of America; Dorothy M. Davis Heart and Lung Research Institute, The Ohio State University, Columbus, Ohio, United States of America. 3. Department of Molecular and Cellular Biochemistry, College of Medicine, The Ohio State University, Columbus, Ohio, United States of America; Solid Tumor Program, Comprehensive Cancer Center, The Ohio State University, Columbus, Ohio, United States of America. 4. Dorothy M. Davis Heart and Lung Research Institute, The Ohio State University, Columbus, Ohio, United States of America; Division of Pulmonary, Allergy, Critical Care, and Sleep Medicine, Department of Internal Medicine, College of Medicine, The Ohio State University, Columbus, Ohio, United States of America.
Abstract
The ETS-family transcription factors Ets1 and Ets2 are evolutionarily conserved effectors of the RAS/ERK signaling pathway, but their function in Ras cellular transformation and biology remains unclear. Taking advantage of Ets1 and Ets2 mouse models to generate Ets1/Ets2 double knockout mouse embryonic fibroblasts, we demonstrate that deletion of both Ets1 and Ets2 was necessary to inhibit HrasG12V induced transformation both in vitro and in vivo. HrasG12V expression in mouse embryonic fibroblasts increased ETS1 and ETS2 expression and binding to cis-regulatory elements on the c-Myc proximal promoter, and consequently induced a robust increase in MYC expression. The expression of the oncogenic microRNA 17-92 cluster was increased in HrasG12V transformed cells, but was significantly reduced when ETS1 and ETS2 were absent. MYC and ETS1 or ETS2 collaborated to increase expression of the oncogenic microRNA 17-92 cluster in HrasG12V transformed cells. Enforced expression of exogenous MYC or microRNA 17-92 rescued HrasG12V transformation in Ets1/Ets2-null cells, revealing a direct function for MYC and microRNA 17-92 in ETS1/ETS2-dependent HrasG12V transformation.
The ETS-family transcription factors Ets1 and Ets2 are evolutionarily conserved effectors of the RAS/ERK signaling pathway, but their function in Ras cellular transformation and biology remains unclear. Taking advantage of Ets1 and Ets2mouse models to generate Ets1/Ets2 double knockout mouse embryonic fibroblasts, we demonstrate that deletion of both Ets1 and Ets2 was necessary to inhibit HrasG12V induced transformation both in vitro and in vivo. HrasG12V expression in mouse embryonic fibroblasts increased ETS1 and ETS2 expression and binding to cis-regulatory elements on the c-Myc proximal promoter, and consequently induced a robust increase in MYC expression. The expression of the oncogenic microRNA 17-92 cluster was increased in HrasG12V transformed cells, but was significantly reduced when ETS1 and ETS2 were absent. MYC and ETS1 or ETS2 collaborated to increase expression of the oncogenic microRNA 17-92 cluster in HrasG12V transformed cells. Enforced expression of exogenous MYC or microRNA 17-92 rescued HrasG12V transformation in Ets1/Ets2-null cells, revealing a direct function for MYC and microRNA 17-92 in ETS1/ETS2-dependent HrasG12V transformation.
Cancer cells exhibit unique transformation properties that include independence from mitogenic and growth signals, unresponsiveness to anti-growth signals, escape from apoptosis and senescence, changes in gene expression, and acquired invasion and metastastatic capabilities [1]. RAS gene family activating mutations are present in 30% of all humancancers, and cells harboring RAS mutations have self-sufficiency in growth signals [2]. RAS is a GTP-binding protein that activates cellular proliferation and survival among other biological functions in response to extracellular signals under normal conditions [3], [4]. Chemotherapeutic agents targeting mutated RAS as well as upstream and downstream regulators have thus far failed to have significant clinical benefits in the treatment of cancerpatients [5], highlighting the need to define the downstream effectors of the RAS pathway.ETS1 and ETS2 are members of the ETS family of transcription factors and are downstream effectors of the RAS/RAF/ERK pathway [6]–[9]. These factors regulate genes involved in cellular proliferation, differentiation, apoptosis and transformation [9]. Ets1 and Ets2 share two highly conserved domains: the DNA binding domain at the C-terminal end, and the RAS/ERK activated Pointed domain at the N-terminal end [6]–[9]. Overexpression of dominant-negative forms of several ETS factors, including ETS1 or ETS2 block Ras transformation [10], [11], suggesting that ETS family members play a crucial role in this process. However, specific deletions of ETS family members is a more accurate approach for understanding the function of individual family members in Ras transformation. For example specific deletion of Ets2 alone failed to inhibit Ras transformation in ES-cell derived fibroblasts [12].Given the high homology between ETS1 and ETS2 protein structures, we hypothesized that ETS1 could be compensating for a loss of ETS2 in driving Ras-mediated transformation. Thus, we generated Ets1 and Ets2 null alleles in mouse embryonic fibroblasts using the Lox/Cre technology. We show that specific deletion of Ets1 and Ets2 impaired the Hras transformation. Gene expression analysis and chromatin immunoprecipitation (ChIP) revealed that Myc and its downstream target miR-17-92 were transcriptionally activated by ETS1 and ETS2 in response to Hras expression. Overexpression of MYC or microRNA 197-93 (miR-17-92) rescued the impaired Hras transformation in Ets1/Ets2 deleted cells. These findings demonstrate that Ets1 and Ets2 are essential mediators of Hras transformation, and revealed an oncogenic function for miR-17-92 in mediating Ras/Ets1/Ets2 transformation.
Results
Ets1 and Ets2 double knockout ablates Hras transformation of MEFs
ETS1 and ETS2 share high homology in their DNA binding and Pointed domains, and several studies have revealed that dominant-negative forms of these factors ablate Ras dependent transformation [7], [10], [11], [13]. We therefore hypothesized that both Ets1 and Ets2 might be required for efficient Ras transformation of MEFs. To test this hypothesis, we established spontaneously immortalized Ets1MEFs from double transgenic mice, and stably expressed the Cre recombinase protein using a retroviral vector to generate double knockout Ets1 cells (E1−E2−). We observed efficient Ets2 deletion in Cre-transduced cells as determined by detection of the Ets2 null allele and absence of the Ets2 allele (Figure S1A). To determine the effect of Ras transformation in the double-knockout MEFs, we infected both E1+E2+ and E1−E2− cells with a Hras retroviral vector containing a hygromycin marker and used drug selection to produce a stable mixed population of cells expressing Hras and control cells tranduced with the hygromycin gene. Western blot analysis demonstrated that ETS1 and ETS2 expression is very low in the immortalized MEFs, but expression of both ETS1 and ETS2 increased dramatically in response to Hras introduction (Figure 1A). In contrast, neither ETS1 nor ETS2 could be detected in double knockout E1−E2− MEFs in Hras expressing cells (Figure 1A).
Figure 1
Deletion of both Ets1 and Ets2 ablates Hras transformation of MEFs.
E1+E2+ and E1−E2− MEFs were infected with HRasv or empty vector control retrovirus, then selected with Hygromycin for at least 5 days before functional examination of the four generated cellular genotypes, as shown. A) Western blotting analysis of 20 µg protein lysates probed with antibodies against proteins shown, with α-tubulin as loading control. B) Representative images and C) Quantification of the cellular colonies that grew in soft agar from the four different genetic groups Asterisk indicates P<0.05 as determined by the Student t test. D) Cells were injected subcutaneously into nude mice (106 cells per injection site) and after 3 weeks the tumors were harvested. The ratios represent the percentage of tumors that grew from the total number of injections for each of the different genotypes.
Deletion of both Ets1 and Ets2 ablates Hras transformation of MEFs.
E1+E2+ and E1−E2− MEFs were infected with HRasv or empty vector control retrovirus, then selected with Hygromycin for at least 5 days before functional examination of the four generated cellular genotypes, as shown. A) Western blotting analysis of 20 µg protein lysates probed with antibodies against proteins shown, with α-tubulin as loading control. B) Representative images and C) Quantification of the cellular colonies that grew in soft agar from the four different genetic groups Asterisk indicates P<0.05 as determined by the Student t test. D) Cells were injected subcutaneously into nude mice (106 cells per injection site) and after 3 weeks the tumors were harvested. The ratios represent the percentage of tumors that grew from the total number of injections for each of the different genotypes.E1−E2− and E1+E2+ cells had indistinguishable growth in monolayer cultures indicating that loss of the ETS-factors did not affect normal cell growth (Figure S1B). When grown in monolayer for 6 days, both E1+E2+ and E1−E2− MEFs became contact inhibited, as demonstrated by flow cytometry analysis of propidium iodide labeled cells. Flow cytometry of these cell populations also revealed no significant differences in the sub-G0 peak, indicating no major differences in cell apoptosis between the double knockout and control cells (Figure S1C). As expected, E1+E2+/Hras cells continued to grow after confluency, demonstrated by 3–4 fold higher number of cells in S-phase as determined by either BrdU labeling or flow cytometry (Figure S1D and S1E, respectively). In contrast E1−E2−/Hras cells were contact-inhibited similar to the non-transformed MEFs (Figure S1D and S1E). Further, anchorage independent growth assays demonstrated that E1− E2−/Hras MEFs formed only a few, small colonies in soft agar unlike E1+ E2+/Hras MEFs, which formed numerous large colonies (Figure 1B, quantified in Figure 1C). MEFs that lacked either Ets1or Ets2 alone formed approximately 2-fold fewer colonies in soft agar assays compared to cells with both genes intact, but formed 100-fold more colonies in the soft agar assay compared to the double-knockout cells (Figure S2A).Consistent with the in vitro analysis, a xenograft mouse model showed that subcutaneous injection of E1− E2−/Hras cells developed one single tumor out of 28 injected sites, in contrast to E1+ E2+/Hras cells, which formed 8 tumors out of 8 injected sites (Figure 1D and Figure S2B). Notably, genotyping of the single tumor that grew from E1− E2−/Hras cells demonstrated that it contained the Ets2 allele, and therefore still expressed ETS2. This finding further confirmed the requirement for both Ets1 and Ets2 for Hras transformation (Figure S2C).
c-Myc is required for Ets1 and Ets2-mediated Hras transformation
The c-Myc proto-oncogene was previously identified as a mediator of Ras/Ets transformation, but whether c-Myc is a direct target of ETS factors has not been conclusively established [11]. Consistent with previous results, analysis of c-Myc RNA expression in control and experimental genotypes revealed 2.5-fold increase in E1+E2+/Hras cells compared to non-transformed controls and E1−E2−/Hras cells (Figure 2A). Similarly, MYC protein was elevated in E1+E2+/Hras cells compared to the other genotypes (Figure 2B). In silico analysis of the c-Myc proximal P2-promoter revealed a GGAA ETS-binding motif that is conserved in mammals (Figure 2C). Chromatin immunoprecipitation (ChIP) in E1+E2+/Hras cells showed 2-fold enrichment of ETS1 and 4-fold enrichment of ETS2 on the c-Myc promoter relative to E1+E2+ control cells, while ETS1 and ETS2 binding on the c-Myc promoter in E1−E2−/Hras MEFs was no different than the IgG control (Figure 2D).
Figure 2
Ets1 and Ets2 activate c-Myc expression in Hras transformed MEFs.
A) Fold change of c-Myc gene expression by real time rt-PCR in the 4 different genetic groups examined. B) Western blotting analysis of 20 µg protein lysates probed with antibodies against MYC and α-tubulin. C) Schematic illustration of the c-Myc promoter showing conserved Ets binding sites (box) and the ChIP primers used (arrows) relative to the P2 promoter. D) ChIP performed on MEFs with indicated genotypes using anti-ETS1 and ETS2 antibodies with IgG as control. The threshold value for the promoter being studied was normalized to that of input values and represented as relative enrichment. Asterisk indicates P<0.05.
Ets1 and Ets2 activate c-Myc expression in Hras transformed MEFs.
A) Fold change of c-Myc gene expression by real time rt-PCR in the 4 different genetic groups examined. B) Western blotting analysis of 20 µg protein lysates probed with antibodies against MYC and α-tubulin. C) Schematic illustration of the c-Myc promoter showing conserved Ets binding sites (box) and the ChIP primers used (arrows) relative to the P2 promoter. D) ChIP performed on MEFs with indicated genotypes using anti-ETS1 and ETS2 antibodies with IgG as control. The threshold value for the promoter being studied was normalized to that of input values and represented as relative enrichment. Asterisk indicates P<0.05.In order to understand the biological significance of Ets1 and Ets2 transcriptional activation of Myc in Hras transformation, we exogenously expressed Myc in E1− E2− and E1−E2−/Hras MEFs using a MSCV-GFP-Myc retroviral vector, and sorted cells by FACS to produce a stable mixed population of GFP-MYC expressing cells (Figure 3A). When injected into nude mice, all 8 sites injected with E1−E2−/Hras/MSCV-GFP-c-MycMEFs developed tumors, while expression of MYC alone was not sufficient to transform E1−E2− MEFs (Figure 3B). The average tumor volume of Myc-rescued E1−E2−/Hras was significantly larger than tumors from E1+E2+/Hras cells (Figure 3C–D), likely because MYC was overexpressed in the rescued cells.
Figure 3
Overexpression of c-Myc in Ets1/Ets2-null MEFs rescued Hras transformation.
E1−E2− control and E1−E2−/H-Rasv cells were infected with either MSCV-GFP empty control or MSCV-GFP-c-Myc vector, and cells were sorted for GFP expression by FACS. A) 20 µg of protein lysates from E1−E2−/H-Rasv12/MSCV-GFP control and E1−E2−/H-Rasv12/MSCV-GFP-c-Myc cells analyzed by western blot against MYC and β-Actin (protein loading control) antibodies. B) Graph representing the percentage of tumors formed over the total number of injections for the indicated cellular genotypes. N/A indicates that there were no tumors observed for the specified group. C) Representative pictures of all tumors derived from E1+E2+/H-Rasv12 and E1−E2−/H-Rasv12/MSCV-GFP-c-Myc cells. D) Graph showing individual and average volumes of E1+E2+/H-Rasv12 and E1−E2−/H-Rasv12/MSCV-GFP-c-Myc tumors. Asterisk indicates P<0.05.
Overexpression of c-Myc in Ets1/Ets2-null MEFs rescued Hras transformation.
E1−E2− control and E1−E2−/H-Rasv cells were infected with either MSCV-GFP empty control or MSCV-GFP-c-Myc vector, and cells were sorted for GFP expression by FACS. A) 20 µg of protein lysates from E1−E2−/H-Rasv12/MSCV-GFP control and E1−E2−/H-Rasv12/MSCV-GFP-c-Myc cells analyzed by western blot against MYC and β-Actin (protein loading control) antibodies. B) Graph representing the percentage of tumors formed over the total number of injections for the indicated cellular genotypes. N/A indicates that there were no tumors observed for the specified group. C) Representative pictures of all tumors derived from E1+E2+/H-Rasv12 and E1−E2−/H-Rasv12/MSCV-GFP-c-Myc cells. D) Graph showing individual and average volumes of E1+E2+/H-Rasv12 and E1−E2−/H-Rasv12/MSCV-GFP-c-Myctumors. Asterisk indicates P<0.05.
The miR-17-92 cluster is required for Ets1/Ets2-dependent Hras transformation
MYC regulates different biological processes including microRNA expression. The miR-17-92 cluster belongs to a network of MYC activated microRNAs [14], and its increased expression is associated with a variety of hematopoietic and solid tumor malignancies [15], [16]. Recent results showing that miR-17-92 collaborates with activated Hras and the adenovirus-encoded E1A oncogene to induce transformation in primary human fibroblasts further suggest this cluster as a potential candidate downstream of c-Myc and Ets1/Ets2
[17].Consistent with this hypothesis, precursor-miR-17-92 (pre-mir-17-92) expression was increased approximately 5-fold in E1+E2+ Hras transformed MEFs compared to control, while expression was decreased 3-fold in E1−E2− Hras cells (Figure 4A). Exogenous expression of c-Myc in E1−E2− Hras induced expression of pre-mir-17-92 4.5-fold compared to the double-knockout cells (Figure 4A). The mir-17-92 cluster encodes six mature miRNAs, and expression analysis of all six mature miRNAs demonstrated that 5/6 were significantly upregulated in E1+E2+/Hras MEFs compared to the wild-type control, while expression of all 6 was decreased in E1−E2−/Hras compared either control or E1+E2+/Hras MEFs (Figure 4B). Overexpression of c-Myc in E1−E2− Hras cells resulted in rescue of expression for all 6 miRNAs (Figure 4B). However, the relative levels of the mature miRNAs differed in E1+E2+ Hras cells compared to the c-Myc-rescued double-knockout cells, perhaps reflecting that high levels of MYC expression may alter miRNA processing [18].
Figure 4
mir17-92 expression depends on Ets1 and Ets2 in Hras transformed MEFs.
A) Fold change of pre-mir17-92 and B) individual microRNAs of the mir17-92 cluster: in the indicated genetic groups relative to control cells. Asterisk indicates P<0.05. C) Schematic illustration of the mir17-92 promoter showing conserved ETS(box) and MYC (triangle) binding sites, as well as the ChIP primers used (arrows) relative to the start RNA start site. D) ChIP performed on the indicated MEFs genotypes using IgG control and specific antibodies as indicated. Asterisk indicates P<0.05.
mir17-92 expression depends on Ets1 and Ets2 in Hras transformed MEFs.
A) Fold change of pre-mir17-92 and B) individual microRNAs of the mir17-92 cluster: in the indicated genetic groups relative to control cells. Asterisk indicates P<0.05. C) Schematic illustration of the mir17-92 promoter showing conserved ETS(box) and MYC (triangle) binding sites, as well as the ChIP primers used (arrows) relative to the start RNA start site. D) ChIP performed on the indicated MEFs genotypes using IgG control and specific antibodies as indicated. Asterisk indicates P<0.05.The lower expression of both pre-mir-17-92 and the mature miRNAs in E1−E2− cells suggested that Ets1/Ets2 could regulate the miR-17-92 cluster independent of c-Myc. Analysis of the region 2 kilobase pairs upstream of miR-17-92 cluster identified an ETS-binding motif conserved in mammals that is approximately 50 base pairs from a previously identified MYC binding site [14] (Figure 4C). Quantitative ChIP analysis revealed that ETS1, ETS2 and MYC binding is enriched in this proximal region in E1+ E2+ Hras transformed MEFs compared to non-transformed wild-type and E1− E2− Hras MEFs (Figure 4D). In order to test whether the binding of these factors was functional, we studied overexpression of the ETS factors in immortalized MEFs that lacked c-Myc (Figure 5A). Transient overexpression of Ets1, Ets2 and c-Myc in c-Myc cells was verified by qRT-PCR analysis (Figure 5B). Transient overexpression of Ets1 or Ets2 alone increased expression of pre-mir-17-92 approximately 3-fold, while c-Myc alone increased the expression 11-fold compared to control (Figure 5C). Co-transient overexpression of Myc with either Ets1 or Ets2 resulted in a robust 30-fold superactivation of miR-17-92 expression relative to control (Figure 5C). Similarly, the expression of all 6 mature miRNAs increased in response to overexpression of the three transcription factors (Figure 5D).
Figure 5
Ets1, Ets2 and c-Myc activate miR17-92 transcription.
C-Myc MEFs were infected with pBabe-Cre retroviral vector or control pBabe-empty vector, selected with puromycin before functional examination. A) Protein analysis of 20 µg lysates from MEFs by western blot using antibodies as indicated B) Relative expression of Ets1, Ets2 and c-Myc mRNAs after 48 hrs of transfection of expression vector. Asterisk represents P<0.05. C and D) Fold change relative real time PCR gene expression of pre-mir17-92 (C) and individual miRs of the cluster (D) after 48 hrs transient transfection of the indicated vectors in c-Myc MEFs relative to control empty vector. Asterisk indicates P<0.05.
Ets1, Ets2 and c-Myc activate miR17-92 transcription.
C-MycMEFs were infected with pBabe-Cre retroviral vector or control pBabe-empty vector, selected with puromycin before functional examination. A) Protein analysis of 20 µg lysates from MEFs by western blot using antibodies as indicated B) Relative expression of Ets1, Ets2 and c-Myc mRNAs after 48 hrs of transfection of expression vector. Asterisk represents P<0.05. C and D) Fold change relative real time PCR gene expression of pre-mir17-92 (C) and individual miRs of the cluster (D) after 48 hrs transient transfection of the indicated vectors in c-MycMEFs relative to control empty vector. Asterisk indicates P<0.05.To assess the biological significance of miR-17-92 expression in ETS-dependent Hras transformation, we generated E1−E2−/Hras MEFs that stably express a MSCV-puro-mir-17-92 retroviral vector. Forced expression of pre-mir-17-92 in E1−E2−/Hras cells led to increased expression of the 6 mature miRNAs (Figure 6A). A xenograft model revealed that all 8 subcutaneous sites injected with E1−E2−/Hras/MSCV-puro-miR-17-92MEFs developed into tumors. None of the 8 sites injected with control E1−E2−/MSCV-puro-miR-17-92MEFs developed tumors (Figure 6B). There were no significant differences in tumor volumes between E1−E2−/Hras/MSCV-puro-mir-17-92 and E1+E2+/Hras genotypes (Figure 6C, 6D).
Figure 6
MiR-17-92 overexpression in Ets1/Ets2-null MEFs rescue Hras transformation.
E1−E2−/pBabe control and E1−E2−/H-Rasv12 were infected with either MSCV-puro empty control or MSCV-puro-miR-17- 92 vector and cells were selected by Puromycin before further functional analysis. A) pre-mir17-92 cluster expression in the indicated genotypes relative to control vector. Asterisk indicated P<0.05. B) Graph demonstrating the percentage of tumors formed over the total number of injections for the different cellular groups. N/A indicates that there were no tumors observed for the specified group. (C) Representative images showing the total E1+E2+/H-Rasv12 and E1−E2−/H-Rasv12/MSCV-puro-miR-17-92 derived tumors. D) Graph indicating individual and average volume of E1+E2+/H-Rasv12 and E1−E2−/H-Rasv12/MSCV-puro-miR-17-92 tumors.
MiR-17-92 overexpression in Ets1/Ets2-null MEFs rescue Hras transformation.
E1−E2−/pBabe control and E1−E2−/H-Rasv12 were infected with either MSCV-puro empty control or MSCV-puro-miR-17- 92 vector and cells were selected by Puromycin before further functional analysis. A) pre-mir17-92 cluster expression in the indicated genotypes relative to control vector. Asterisk indicated P<0.05. B) Graph demonstrating the percentage of tumors formed over the total number of injections for the different cellular groups. N/A indicates that there were no tumors observed for the specified group. (C) Representative images showing the total E1+E2+/H-Rasv12 and E1−E2−/H-Rasv12/MSCV-puro-miR-17-92 derived tumors. D) Graph indicating individual and average volume of E1+E2+/H-Rasv12 and E1−E2−/H-Rasv12/MSCV-puro-miR-17-92tumors.
Conclusions
Transformation of immortalized mouse fibroblasts by RAS oncogenes provided a powerful assay for defining and characterizing the downstream signaling effectors of RAS, including ETS-family transcription factors [9], [19]–[22]. Previous work using dominant-negative approaches implicated ETS-family members as mediators of RAS transformation but were incapable of distinguishing which family members contributed to the transformed phenotype because multiple ETS family members with similar DNA binding properties are expressed in all cell lines and tissues [23], [24]. In the present work, we utilized null alleles of Ets1 and Ets2 to determine their function in Hras transformation of immortalized MEFs. Expression of ETS1 and ETS2 was strongly induced in Hras transformed cells compared to controls. Further, cells deficient for both factors were not transformed by Hras as measured by both in vitro and in vivo assays. The effect of Ets1 and Ets2 are transformation-specific, as deletion of both factors had little effect on the growth of wild-type cells. These results definitively reveal a redundant function for Ets1 and Ets2 in Hras transformation.c-Myc acts as a central integrator of diverse signaling pathways that impact cell proliferation and cell growth [25]. Genetic evidence presented here demonstrated the requirement of Ets1 and Ets2 for expression of MYC in Hras transformed cells. Further, ChIP experiments indicated that MYC is a direct target of the ETS-factors. ETS1 and ETS2 were recruited to a region of DNA that contains a regulatory element termed ME1a1, which is involved in chromatin organization required for the activity of the c-Myc P2 promoter [26]. Consistent with the function of this element, RAS-mediated phosphorylation of ETS1 and ETS2 promotes recruitment of CBP/p300 to target genes [27], indicating the ETS-factors may contribute to opening of chromatin and recruitment of elongation-competent RNA polymerase II complexes at the c-Myc P2 promoter [28], [29]. Importantly, expression of exogenous MYC in Ets1–Ets2 null MEFs rescues transformation by Hras, providing compelling evidence that c-Myc is a critical target for Ets1/Ets2-dependent transformation.The essential role of c-Myc in Ets1/Ets2 mediated Hras transformation prompted the question of potential MYC target genes that could contribute to the transformed phenotype. One attractive target was the oncogenic miR-17-92 cluster, a direct c-Myc target that is necessary for initiation and progression of c-Myc-induced B-cell lymphoma [14], [30]. Our results demonstrate that ETS-dependent c-Myc expression is required for efficient activation of the miR-17-92 cluster. Additionally, MYC, ETS1, and ETS2 are recruited to miR-17-92 cis-regulatory elements through conserved E-Box and ETS motifs and act together to superactivate expression of the cluster. The regulation of the hTERT gene is reported to require cooperation of c-Myc with Ets-2, indicating that collaboration between MYC and ETS1/ETS2 may be a more general mechanism for regulating genes involved in cell growth and cell survival [31]. Similar to c-Myc, miR-17-92 overexpression rescued Hras transformation in Ets1/Ets2 deficient cells. These results suggest that miR-17-92 is necessary for Ets1–Ets2/Myc-dependent transformation, but does not exclude the requirement for additional target genes that could be required for malignant transformation.In summary, we have shown that Ets1 and Ets2 act in redundant fashion to elicit Hras-mediated transformation of MEFs through the activation of c-Myc and miR-17-92. Previous work has implicated Ets1/Ets2 and c-Myc collaboration in invasive breast cancer and in thyroid cancer in humans [32], [33]. Perhaps more relevant to the MEF model used here, amplification and overexpression of c-Myc or N-myc genes and miR-17-92 have been reported in osteosarcoma and rhabmyosarcoma [34]–[37]. Whether our findings are relevant to these humancancers remains to be determined.
Materials and Methods
Animal Husbandry
Ets1 knockout mice were provided by Dr. Muthusamy (The Ohio State University, Columbus, OH) [38]. Conditional Ets2 loxP transgenic mice were generated previously described [39]. Eight to ten weeks old male nude mice were purchased from Taconic and housed and sacrificed in the BRT animal facility (Biomedical Research Tower) at the Ohio State University with accordance to the National Institute of Health regulations. The use of animals was approved by the Ohio State University Institutional Animal Care and Use Committee.
Genotyping Primers and PCR Conditions
MEFs were genotyped by PCR method. The following primers that detect both Ets2 floxed and knockout alleles were used to confirm for Ets2 deletion in MEFs: primer1 (TGAACTACTGTGTGTGACGAGGA), primer2 (GGAAGAAACGGGAAATCAAA), and primer3 (GGATTTTAGCCCAGAAACTTAGA). 2 µl of DNA was added to a total 20 µl PCR reaction and amplified employing the following PCR program: Cycle1∶95°C for 1 minute. Cycle2 was repeated 35x: 95°C (for 45 sec) followed by 58°C (for 45 sec) followed by 72°C (for 1 min). Cycle 3∶72°C (for 10 min). PCR products were run on 1.5% agarose gel.
Cell Culture
Primary MEFs were generated from 13.5 days old embryos using standard methods and were spontaneously immortalized according to Todaro and Green protocol [40]. C-Mycf/f established MEFs were a kind gift from Dr. Gustavo Leone’s laboratory at Ohio State University. Cells were grown in DMEM media supplemented with 10% FBS and Penicillin and Streptomycin antibiotics.
Retroviral Infection of MEFs
Phoenix retrovirus packaging cells were transfected by calcium phosphate method with 8 µg of DNA per 60 mm dish of the following retroviral vectors: pBabe-Hygromycin-H-Rasv12, pBabe-Hygromycin-empty-vector, pBabe-Puromycin-Cre, pBabe-Puromycin-empty-vector, MSCV-Puromycin-miR-17-92, MSCV-Puromycin-empty vector, MSCV-GFP-c-Myc (kind gift from Dr. Leone laboratory) and MSCV-GFP empty vector. High titers of retrovirus supernatant supplemented with 4 µg/µl of Sequabrene (Sigma) to increase retrovirus uptake by cells were used to infect MEFs twice at 24 and 48 hrs time points. Infected cells were treated with 4 µg/µl of Puromycin for 3 days and or 200 µg/µl of Hygromycinfor 5 days to select for stably mixed specific cellular genotypes. MEFs infected with the retroviral GFP vectors were sorted for GFP selection by the FACS/Aria machine.
Anchorage dependent and independent cellular growth assays
For anchorage dependent cellular growth, cells of different genotypes were seeded in 4 replicate wells at a density of 1×104 cells per well in 6-well plates. At days 2,4 and 6 after seeding, cells were washed with 1x PBS, trypsinized, mixed with 0.4% Trypan blue solution (Sigma Aldrich) and then counted using the Reichert Bright-Line Hemacytometer (Hausser Scientific) by Trypan blue exclusion principle. For anchorage independent cellular growth, cells of different genotypes were grown in 4 replicate wells in two layers 6-well plates: The lower layer consisted of 0.6% (w/v) soft agar and the upper layer contained 1×104 cells per well mixed in 0.3% (w/v) soft agar. Both soft agar layers consisted of 20% FBS. After 14 to 21 days, grown cellular colonies were scored.
Tumorigenic assay
Animal studies were performed with 8–10 weeks old male athymic nude mice. Cells were harvested, counted and suspended in PBS at a concentration of 1×106 cells per injection site. 100 µl of cells were injected subcutaneously into the right and left shoulders and hips (four injections per mouse), or two injections per mouse (right and left hips). Tumors were harvested after 3 to 4 weeks before reaching 1 cm in length.
Quantitative real-time PCR
RNA was extracted from MEFs by Trizol (Invitrogen) according to the manufacturer instructions. The cDNA was prepared as described previously [41]. Most of the RNA primers used for this study were designed using Roche Universal Probe Library System. To avoid non specificity in mature RNA detection, intron-spanning primers were designed. The following RNA primers were used: mousec-Myc primers: forward primer (CCTAGTGCTGCATGAGGAGAC), reverse primer (CCTCATCTTCTTGCTCTTCTTCA). Mouse pre-miR-17-92 primers: forwards primer (TCTGACAATGTGGAGGACAGA), reverse primer (CCTTTAGAGGAAAGCCTCACATT). MouseRpL4 primers: forwards primer (AGCAGCCGGGTAGAGAGG), reverse primer (ATGACTCTCCCTTTTCGGAGT). RNA expression analysis of the different sets of genes had their threshold adjusted in accordance to ribosomal RpL4 gene expression. Relative quantification was calculated using the 2-ΔΔCT relative quantification method [41].
Western Blot Analysis
MEFs were lysed in RIPA buffer (50 mM Tris-HCl (pH7.4), 1% NP-40, 0.25% Na-Deoxycholate, 150 mM NaCl, and 1 mM EDTA) for 30 minutes. The following inhibitors were added to RIPA buffer (1 mM PMSF, 1 µg/ml Aprotinin, 1 µg/ml Leupeptin, 1 µg/ml Antipain, 1 mM Na3VO4). The lysate was centrifuged at 14,000 g at 4°C for 30 minutes. Aliquots were made from the supernatant and stored at −70°C. Protein concentration was measured by the Bradford assay. 20 µg of proteins were run on 10 to 12% SDS-Polyacrylamide gels. Nitrocellulose membranes were used for protein transfer. Membranes were blocked with (5% non-fat dry milk in 0.05%TBST) for 1 hr at room temperature, then incubated with the following primary antibodies overnight at 4°C: MYC (sc-40, Santa Cruz), α-Tubulin antibody (Sigma), β-Actin (sc-47778, Santa Cruz), Pan-Ras (OP-40, CalBiochem), ETS1 and ETS2 antibodies were prepared in our laboratory as described in the previous section of materials and methods. Nitrocellulose membranes were then incubated with a horseradish peroxidase-conjugated secondary antibody (either rabbit or mouse) for 1 hr and developed using the ECL chemiluminescence system (Thermo Scientific).
Chromatin Immunoprecipitation Assay (ChIP)
MEFs were seeded at a density of 1×106 in 100 mm dish and protein/DNA cross-linking was performed using 270 µl of formaldehyde at 1% final concentration at room temperature for 10 min. The rest of the assay was performed as described [39]. Briefly the DNA-protein complexes were immunoprecipitated with 2 µg of antibodies overnight at 4°C. After elution, the eluted solution was heated at 65°C overnight then DNA was precipitated with 70% ethanol and kept at −20°C overnight. DNA was recovered and purified using the Qiagen PCR purification kit according to the manufacturer’s instructions. SYBR Green primers were used for miR-17-92 promoter detection: forward primer (GGGCTCGGAAAGTG), reverse primer (ACTCACCCACTCAG). For c-Myc promoter detection, probe 16 from the Universal Primer library (Roche Diagnostics, Indianapolis, IN) was used with forward primer (GTCCGACTCGCCTCACTC) and reverse primer (CCTCCCCTCCCTTCTTTTT
). Rabbit IgG (Millipore) was used as control and the antibodies were the same as for Western analysis. The threshold value for the promoter being studied was normalized to that of input values and represented as relative enrichment relative to IgG values.
MicroRNA gene expression analysis
Total RNA was extracted from cells using Trizol reagent (Invitrogen). The cDNA was subsequently synthesized from 5 ug RNA by oligo dT primers and superscript II (Invitrogen). Quantitative analysis of mature microRNA expression was performed by real-time PCR using Taqman microRNAs assays (Applied Biosystems). For normalization of expression levels U6 snRNA and sno RNA 202 (Applied Biosystems) were used. Real-time quantitative RT-PCR experiments were performed in the ABI Prism 7700 System (Applied Biosystems). Real time PCR was done on all of the following mature microRNAs of the miR-17-92 Cluster: miR-17, miR-18, miR-19a, miR-19b, miR-20 and miR-92. Relative quantification was calculated using the 2−ΔΔCT relative quantification method.
Transient transfection
The following DNA vectors were transiently transfected into c-Myc−/− MEFs using lipofectamine-2000 protocol according to Invitrogen manual instructions: FNEts1, FNEts2, FNpcDNA3, pBabe-Hygromycin-empty and pBabe-Hygromycin-c-Myc. C-MycMEFs seeded in 4 replicate 60 mm-dishes for each experimental condition at a density of 3.5×105 cells per dish, were transfected with 4 µg of DNA vector mixed with 15 µl of Lipofectamine-2000 in plain DMEM. The transfection cocktail was kept for 6 hrs then replaced with 10%FBS media for 36 hrs. Afterwards, cells were lysed with trizol and kept at −70°C until further RNA processing.
Statistics
Statistical analysis was done using the standard deviation formula and the student t-test to determine the statistical significance between the control and experimental genotypes.A) PCR genotyping results for the different MEFs after infection with Cre recombinase retroviral vector showing Ets2 flox and Ets2 knockout bands. The last two PCR bands represent two positive control samples with either Ets2 flox or Ets2 knockout band. B) Growth of E1+ E2+ and E1− E2− MEFs was assessed by trypan blue exclusion at day 2 and day 4 post-seeding. C) Pie chart representing cell cycle distribution after flow cytometry analysis of Propidium Iodide stained E1+E2+ and E1−E2− cells. D) Graph representing growth at day 6 post-cellular seeding by trypan blue exclusion of indicated cellular genotypes. E) Graph representing percentage of BrdU stained cells in the indicated MEFs genotypes. Asterisk indicates P<0.05.(PDF)Click here for additional data file.A) Bar graphs showing number of colonies growing in soft agar assays (see Materials & Methods) for MEFs of the indicated genotypes. B) Graph representing tumor volumes of the indicated genetic groups. B) PCR genotyping result for the single tumor that grew from the E1−E2−/H-Rasv12 injected cells (lane M). The other two lanes represent two positive control samples containing either Ets2 flox or Ets2 knockout band.(PDF)Click here for additional data file.
Authors: Guo Wei; Jianping Guo; Andrea I Doseff; Donna F Kusewitt; Albert K Man; Robert G Oshima; Michael C Ostrowski Journal: J Immunol Date: 2004-07-15 Impact factor: 5.422
Authors: Guo Wei; Ruchika Srinivasan; Carmen Z Cantemir-Stone; Sudarshana M Sharma; Ramasamy Santhanam; Michael Weinstein; Natarajan Muthusamy; Albert K Man; Robert G Oshima; Gustavo Leone; Michael C Ostrowski Journal: Blood Date: 2009-05-01 Impact factor: 22.113
Authors: Jennifer L Reichek; Fenghai Duan; Lynette M Smith; Donna M Gustafson; Roddy S O'Connor; Chune Zhang; Mandy J Dunlevy; Julie M Gastier-Foster; Frederic G Barr Journal: Clin Cancer Res Date: 2011-01-10 Impact factor: 12.531
Authors: Daniel Baumhoer; Stephanie Zillmer; Kristian Unger; Michael Rosemann; Michael J Atkinson; Martin Irmler; Johannes Beckers; Heide Siggelkow; Irene von Luettichau; Gernot Jundt; Jan Smida; Michaela Nathrath Journal: Cancer Genet Date: 2012-05
Authors: Lin He; J Michael Thomson; Michael T Hemann; Eva Hernando-Monge; David Mu; Summer Goodson; Scott Powers; Carlos Cordon-Cardo; Scott W Lowe; Gregory J Hannon; Scott M Hammond Journal: Nature Date: 2005-06-09 Impact factor: 49.962
Authors: Nesrin M Hamad; Joel H Elconin; Antoine E Karnoub; Wenli Bai; Jeremy N Rich; Robert T Abraham; Channing J Der; Christopher M Counter Journal: Genes Dev Date: 2002-08-15 Impact factor: 11.361
Authors: Jason R Pitarresi; Xin Liu; Sudarshana M Sharma; Maria C Cuitiño; Raleigh D Kladney; Thomas A Mace; Sydney Donohue; Sunayana G Nayak; Chunjing Qu; James Lee; Sarah A Woelke; Stefan Trela; Kyle LaPak; Lianbo Yu; Joseph McElroy; Thomas J Rosol; Reena Shakya; Thomas Ludwig; Gregory B Lesinski; Soledad A Fernandez; Stephen F Konieczny; Gustavo Leone; Jinghai Wu; Michael C Ostrowski Journal: Neoplasia Date: 2016-09 Impact factor: 5.715