Characterization of microsatellite markers developed from Prosopis rubriflora and Prosopis ruscifolia (Leguminosae - Mimosoideae), legume species that are used as models for genetic diversity studies in Chaquenian areas under anthropization in South America.

BACKGROUND: Prosopis rubriflora and Prosopis ruscifolia are important species in the Chaquenian regions of Brazil. Because of the restriction and frequency of their physiognomy, they are excellent models for conservation genetics studies. The use of microsatellite markers (Simple Sequence Repeats, SSRs) has become increasingly important in recent years and has proven to be a powerful tool for both ecological and molecular studies.
FINDINGS: In this study, we present the development and characterization of 10 new markers for P. rubriflora and 13 new markers for P. ruscifolia. The genotyping was performed using 40 P. rubriflora samples and 48 P. ruscifolia samples from the Chaquenian remnants in Brazil. The polymorphism information content (PIC) of the P. rubriflora markers ranged from 0.073 to 0.791, and no null alleles or deviation from Hardy-Weinberg equilibrium (HW) were detected. The PIC values for the P. ruscifolia markers ranged from 0.289 to 0.883, but a departure from HW and null alleles were detected for certain loci; however, this departure may have resulted from anthropic activities, such as the presence of livestock, which is very common in the remnant areas.
CONCLUSIONS: In this study, we describe novel SSR polymorphic markers that may be helpful in future genetic studies of P. rubriflora and P. ruscifolia.

Findings

Background

The genus Prosopis L. belongs to the Leguminosae botanical family, which contains 44 species. Prosopis L. is predominantly restricted to the neotropics [1]. Prosopis rubriflora[2] and Prosopis ruscifolia[3] are tree species known locally as “espinheiro” and “algarroba,” respectively. These species are important both economically and ecologically. For example, the fruits and seeds of P. ruscifolia are reported to be good sources of nutrition for humans and animals [4], and the flowers of P. rubriflora, which are present throughout the year, provide important food resources, such as pollen and nectar, for the local fauna [5]. P. rubriflora has a narrow distribution range and is limited to Paraguay and Brazil, but P. ruscifolia is also found in Argentina and Bolivia [6,7].

In Brazil, P. rubriflora and P. ruscifolia are associated with Chaquenian areas [8] and are limited to the southern portion of the Pantanal [9,10]. Both species are excellent indicators of Chaquenian areas in Brazil; P. rubriflora is usually associated with arboreal physiognomy, and P. ruscifolia is frequently associated with forest physiognomy. Both species can be used as models for genetic studies of diversity in these areas.

While estimating genetic diversity, the use of molecular markers has been helpful in defining alleles and studying genetic flow, population structure, paternity, inheritability, genetic maps and conservation genetics [11]. Simple sequence repeat markers (SSRs), commonly referred to as microsatellite markers, are desirable tools because they are co-dominant in nature, multi-allelic and widely distributed in the genome; they are also currently cheap, reproducible and relatively easy to analyze [12]. This work reports the development, characterization and transferability of microsatellite markers for P. rubriflora and P. ruscifolia.

Construction of a microsatellite-enriched library

DNA was extracted from P. rubriflora and P. ruscifolia using the DNeasy® Plant Mini Kit (Qiagen, Hilden, DE) according to the manufacturer’s instructions. Microsatellite-enriched libraries for P. rubriflora and P. ruscifolia were constructed as described by Billote et al.[13]. The genomic DNA was digested with AfaI after enrichment with streptavidin-coated magnetic beads (Streptavidin MagneSphere Paramagnetic Particles, Promega, Madison, WI); biotinylated (CT)8 and (GT)8 microsatellite probes were added for the dinucleotide-enriched library. The fragments were amplified by PCR and cloned into the pGEM-T vector (Promega, Madison, WI). XL1-Blue (Escherichia coli) competent cells were transformed with the recombinant plasmids and then cultivated on agar medium containing ampicillin (100 mg/ml), X-galactosidase 2% (100 μg/ml) and IPTG (100 mM). The selected clones were added to a Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) and sequenced using an ABI 377 sequencer (Applied Biosystems, Foster City, CA). The sequences were aligned and edited using SeqMan Software (DNAStar, Madison, WI), and the adapters and restriction sites were removed using Microsat Software (A. M. Risterucci, CIRAD, personal communication). To identify microsatellite-enriched regions, we used the Simple Sequence Repeat Identification Tool (SSRIT) [14] and defined the following numbers of repeats/motifs: five/dinucleotides, four/trinucleotides and three/tetra- or pentanucleotides. After these steps, primers were designed using the PrimerSelect software (DNAStar, Madison, WI).

Fragment amplification

The fragments were amplified using polymerase chain reactions containing 8 ng of template DNA, 2 mM MgCl2, 50 mM KCl, 20 mM Tris–HCl (pH 8.4), 0.2 mM dNTPs, 0.19 mg/ml BSA (bovine serum albumin), 0.15 mM of each primer and 1 U of Taq DNA polymerase; the reactions were then brought to a final volume of 20 μl with ultrapure water. To define the temperatures for the PCR reactions, we adopted the guidelines described by Mottura et al.[15]; for the annealing temperatures, we used a gradient program with temperatures ranging from 65°C to 55°C. The samples were collected in the Chaco remnants of Corumbá and Porto Murtinho, Mato Grosso do Sul, Brazil. Twenty P. rubriflora samples were collected in each of two Chaco remnant locations: Fazenda São Manoel (FSM) (21°47′44.5″S; 57°39′34.6″W) and Fazenda Santa Vergínia (FSV) (22°06′40.5″S; 57°49′57.6″W). Twenty-three P. ruscifolia samples were collected in Estação do Carandazal (ECD) (19°48′33.2″S; 57°10′11.0″W), and 25 samples were collected in Fazenda Retiro Conceição (FRC) (21°42′23.7″S; 57°45′58.2″W). The cross-amplification of the markers was evaluated in 5 P. rubriflora samples obtained from FRC (21°41′00.7″S; 57°46′43.8″W) and 5 P. ruscifolia samples from Chácara Jacaré (21°41′20.1″S; 57°52′15.5″W) using the same conditions as for the native species. The amplified samples were genotyped by vertical electrophoresis using denaturating polyacrylamide gels (6%), and DNA bands were visualized using silver nitrate [16]; the sizes of the resulting fragments were estimated by comparison to a 10-bp DNA ladder (Invitrogen, Carlsbad, CA). Statistical analyses were performed using Microsatellite Toolkit v.3.1.1 [17] to calculate the expected heterozygosity (He), observed heterozygosity (Ho) and polymorphism information content (PIC). The Genepop software v.1.2 [18] was used to estimate adherence to Hardy-Weinberg (HW) equilibrium and possible linkage disequilibrium (LD), and the frequency of null alleles was estimated using FreeNA [19].

Results and discussion

We designed 32 primer pairs: 13 for P. rubriflora and 19 for P. ruscifolia. However, only 10 of the P. rubriflora primer pairs and 13 of the P. ruscifolia primer pairs amplified properly. The nine remaining pairs of primers were discarded because amplification errors were observed in the preliminary tests. Polymorphisms were detected in 9 of the native P. rubriflora markers and 12 of the native P. ruscifolia markers; only one marker from each species had a monomorphic pattern based on the populations analyzed. Eight markers from P. rubriflora successfully cross-amplified and were polymorphic for the tested samples, and 2 markers failed during cross-amplification. Eleven P. ruscifolia markers were successfully cross-amplified; 7 were polymorphic, and 2 failed this analysis (Table 1).

Table 1

Primers developed for

Marker	GenBank register no.	Primer sequences (5′-3′)	Motifs	T a (°C)	Size a (bp)	Crossed amplification
Prb1	KF923365	F: AACTACCGCAGCACTTTTCAGA	(gt)7	62.7	255-267	267b
		R: ACTACTTGGAGATGCCGTGGA
Prb2	KF923366	F: GAAAGCCGCGCTCCTAAG	(gc)4(ac)7	61.0	140-146	126b
		R: ATTCTTTTGTGTCTTGTCTTCTCG
Prb3	KF923367	F: TCCAAAGACCGCAAGAAGAT	(ca)7	61.0	149-159	145b
		R: AGGCCAAAAAGGACTCAAAAT
Prb4	KF923368	F: ATCCGATAAATACACCTTCTGG	(ca)8	61.0	194-230	203b
		R: GGTGTATCGTAAAAGCCTGG
Prb5	KF923369	F: TTTAAACATTGCACGTGAACCTAT	(ac)9	56.4	149-155	-
		R: TTCACCCCTAAACCCCCTT
Prb6	KF923370	F: TCATCTCTCAAAGAAAACGCACTC	(tg)10	56.4	115-133	125b
		R: CCGCAGAGAAGCCCCTACATA
Prb7	KF923371	F: GGCTTAGCATCACCCTCCAT	(ac)8	61.0	219-225	220b
		R: CTTACCCTTTCAGTCCATTTACCA
Prb8	KF923372	F: CAACACCAAAACGGCGAGATGAT	(gt)13	61.0	144-164	154b
		R: TTCGCCAAACGCCAGCATTAG
Prb9	KF923373	F: TTCTTCTCCTTCTTCATCTTCCTCC	(ac)9	62.7	167-175	190b
		R: ACAACGTTGATCCCAAAACCTAAG
Prb10	KF923374	F: TTTTGGTGGATTTGATAGAGCC	(tca)5	56.4	223	-
		R: GAGTGGGGTCAAGAAAGAACAG
Prsc1	KC753210	F: AATGGAGTTTGTTTGTGTCTGTGG	(ac)9(ct)5	56.5	279-297	300b
		R: ATTACGGATACATCGAGCCTTCTT
Prsc2	KC753211	F: GCGGAATTCCAAACGACAA	(ac)9	64.7	224-252	250b
		R: ACAGCAACACCCTCACTCTCAA
Prsc3	KC753212	F: CCACAAGCACACGCACACTCAGAC	(ca)6	64.7	156-160	122
		R: CCAGCACTAGACTTCGCCACCAAC
Prsc4	KC753213	F: CAAAATCCAACAAATAAACACACC	(caa)2(ga)4	63.9	218-232	230b
		R: GGCGGATTCTTGGCTCTCT
Prsc5	KC753214	F: CGCGTTAAGTCTGCCTTGCTTT	(gt)8	59.0	220-240	218
		R: CTCATGGTATTTCCCTTGTCGTCC
Prsc6	KC753215	F: CGAGCGGCGAAAAATGATAAA	(gt)8	63.9	184-210	200
		R: GCTGCTTCCCATAATCCTCTCCT
Prsc7	KC753216	F: CAGGGATTTAATCTCTTTGGTGTAG	(tg)8…(gtgg)2(gt)5	59.0	122-156	122b
		R: ACAAGCTGGAAAGAGTCGCA
Prsc8	KC753217	F: AGTGACGTGAACACGCTGAGG	(tg)10	62.7	98-120	114b
		R: TGCTGATGTGTGTGGTTTTGAGAT
Prsc9	KC753218	F: TCAGACTCCCGTGAACCAG	(tg)9	59.0	112-122	-
		R: CGCACTCGAGCAGCATCT
Prsc10	KC753219	F: AACGCAACGGCCGCAACTAT	(ca)7(ct)7	56.5	260-284	-
		R: ACAAAACGCTCGAATACTGGGGG
Prsc11	KC753220	F: CCCGGCAACTCAAATCAACTTCATA	(ac)11	62.7	229-371	244b
		R: GGTCTAATTCTATTGGTGGGCTCTCTGG
Prsc12	KC753221	F: GGGGTGCATGTTGGGGATTG	(gt)10	59.0	185-223	220b
		R: TTTGGCCGGATTAAAACAGAGCA
Prsc13	KC753222	F: CTTCACCATCACCGATTTCCCTT	(ctt)5	62.7	102	116
		R: GCAACGAAGCAGCTGAAGAACAC

Ta - Optimal annealing temperature defined after gradient tests of the corresponding markers. aRange of the fragment sizes from the polymorphic markers and the sequenced size of the monomorphic markers; bPolymorphism observed for the transferred markers based on the 5 samples used.

The number of P. rubriflora alleles in the sampled remnants ranged from 3 to 12; the polymorphism information content (PIC) values of these markers ranged from 0.073 to 0.791, the observed heterozygosity (Ho) ranged from 0.000 to 0.850, and the expected heterozygosity (He) ranged from 0.000 to 0.835. No evidence of null alleles was observed, and no departure from Hardy-Weinberg equilibrium was observed (Table 2). No significant linkage disequilibrium (LD) was observed for any of the markers of this species after Bonferroni correction (P-value for 5% = 0.001389). The number of P. ruscifolia alleles in both of the remnants ranged from 3 to 17, the PIC values ranged from 0.289 to 0.883, the Ho values ranged from 0.040 to 0.783, and the He values ranged from 0.275 to 0.884. Possible null alleles were observed for the markers Prsc5, Prsc8 and Prsc9 from one remnant (ECD), and the markers Prsc4 and Prsc10 had possible null alleles in both remnants. A departure from HW was observed for Prsc2, Prsc5, Prsc6, Prsc8, Prsc9 and Prsc11 in one of the remnants (the majority were observed in ECD) and for Prsc4, Prsc7 and Prsc10 in both remnants (Table 3). Significant LD was observed for the loci Prsc5 and Prsc6 after Bonferroni correction (P-value for 1% = 0.00016).

Table 2

Markers developed for

Marker	N a			H o		H e		PIC	Null alleles		HW ( P -value)
	T	FSM	FSV	FSM	FSV	FSM	FSV		FSM	FSV	FSM	FSV
Prb1	7	6	7	0.526a	0.474	0.522a	0.737	0.602	0.044	0.145	0.348	0.045
Prb2	3	1	3	0.000	0.150a	0.000	0.145a	0.073	0.001	0.000	-	1.000
Prb3	3	3	2	0.316	0.150	0.428	0.296	0.313	0.103	0.134	0.101	0.069
Prb4	12	11	8	0.650	0.850a	0.799	0.803a	0.766	0.092	0.000	0.457	0.291
Prb5	4	4	4	0.500	0.600	0.583	0.683	0.576	0.039	0.007	0.689	0.254
Prb6	6	4	6	0.500a	0.400	0.458a	0.432	0.413	0.000	0.000	1.000	0.335
Prb7	4	4	4	0.684a	0.650a	0.605a	0.499a	0.473	0.000	0.000	0.355	0.121
Prb8	5	5	3	0.500	0.250	0.524	0.304	0.370	0.000	0.050	0.821	0.468
Prb9	10	10	9	0.684	0.650	0.835	0.819	0.791	0.053	0.062	0.177	0.016

FSM - Fazenda São Manoel, FSV - Fazenda Santa Vergínia, Na - Number of alleles, Ho - Observed heterozygosity, He - Expected heterozygosity, PIC - Polymorphism information content, P-values of Hardy-Weinberg (HW) equilibrium (P-value > 0.0055 after Bonferroni correction), null alleles (null frequency < 0.20). aPopulations where the values of Ho were higher than those of He.

Table 3

Markers developed for

Marker	N a			H o		H e		PIC	Null alleles		HW ( P -value)
	T	FRC	ECD	FRC	ECD	FRC	ECD		FRC	ECD	FRC	ECD
Prsc1	7	4	7	0.600a	0.783	0.566a	0.828	0.701	0.000	0.020	0.916	0.009
Prsc2	8	7	5	0.480	0.565	0.553	0.761	0.658	0.032	0.114	0.034	0.00c
Prsc3	3	3	3	0.360a	0.348	0.344a	0.456	0.348	0.000	0.048	0.674	0.073
Prsc4	5	4	3	0.040	0.043	0.321	0.275	0.289	0.247b	0.221b	0.000c	0.000c
Prsc5	6	4	5	0.440a	0.273	0.378a	0.654	0.484	0.000	0.218b	1.000	0,000c
Prsc6	8	4	8	0.320	0.696	0.653	0.801	0.703	0.196	0.068	0.001c	0.087
Prsc7	9	6	7	0.440	0.565	0.727	0.779	0.755	0.167	0.081	0.001c	0.000c
Prsc8	7	4	7	0.320	0.174	0.577	0.789	0.656	0.165	0.338b	0.008	0.000c
Prsc9	5	3	3	0.240	0.130	0.280	0.559	0.430	0.040	0.267b	0.484	0.000c
Prsc10	7	5	5	0.286	0.227	0.633	0.758	0.670	0.212b	0.294b	0.000c	0.000c
Prsc11	17	8	12	0.560	0.652	0.845	0.884	0.883	0.157	0.127	0.003	0.000c
Prsc12	5	4	5	0.600	0.591	0.569	0.707	0.589	0.000	0.075	0.592	0.013

FRC - Fazenda Retiro Conceição, ECD - Estação do Carandazal, Na - Number of alleles, Ho - Observed heterozygosity, He - Expected heterozygosity, PIC - Polymorphism information content, P-values of Hardy-Weinberg (HW) equilibrium (P-value > 0.0041 after Bonferroni correction). aPopulations where the values of Ho were higher than those of He; bPossible null alleles (null frequency < 0.20); cDeparture from HW equilibrium was observed.

Higher values of Ho were observed for the Prb1, Prb2, Prb4, Prb6, Prb7, Prsc1, Prsc3 and Prsc5 markers in this study; these higher values may indicate that an insufficient number of samples was collected or may be related to the reproductive patterns of these populations. The ECD populations are highly disturbed, and the FRC population is currently recovering from a relatively recent suppression (within the last 15 years); these factors may underlie the observed departure from HW and the presence of null alleles. A study with new and conserved populations may produce better results for these markers.

These markers are the first microsatellite markers developed for Prosopis rubriflora and Prosopis ruscifolia, and together with the set of P. ruscifolia markers amplified by Bessega et al.[20], they are expected to be useful tools for studies of the conservation genetics, reproductive biology, phylogeography and taxonomy of these species.

Availability of supporting data

The original sequences of the developed markers were submitted to the GenBank database (http://ncbi.nlm.nih.gov), and the registered codes are available in Table 1.

The testimony samples were deposited at Herbarium Universidade Estadual de Campinas (UEC – Campinas, SP, BR) and registered according to the following: P. rubriflora – 74477 (Fazenda São Manoel – Porto Murtinho, MS), 154715 (Fazenda Santa Vergínia – Porto Murtinho, MS); P. ruscifolia – 74469 (Fazenda Retiro Conceição – Porto Murtinho, MS), 37266 (Estação do Carandazal – Corumbá, MS).

Competing interests

The authors declare that no competing interests exist regarding this research.

Authors’ contributions

FMA developed and characterized the markers and drafted the manuscript; MIZ provided support during the statistical analysis; ALBS provided support for the plant collection in the field; AMGAT participated in the experimental design; APS conceived the study, participated in its design and coordination and helped draft the manuscript. All of the authors read and approved the final manuscript.