Literature DB >> 24904228

Polymorphism of Nrf2, an antioxidative gene, is associated with blood pressure and cardiovascular mortality in hemodialysis patients.

Yasuhiko Shimoyama1, Yoko Mitsuda2, Yoshinari Tsuruta3, Nobuyuki Hamajima4, Toshimitsu Niwa5.   

Abstract

OBJECTIVE: Nrf2 is a transcription factor that regulates the expression of antioxidant genes. This study aimed to investigate the association of Nrf2 gene single nucleotide polymorphisms (SNPs), rs35652124 (-653A/G) and rs6721961 (-617C/A), with laboratory data and mortality in hemodialysis (HD) patients.
METHODS: Blood samples were obtained from 216 HD patients (119 males and 97 females; 60 diabetics and 156 non-diabetics) with mean age of 60.3±13.3 (SD) years, and mean HD duration of 9.10±8.28 years. Genotyping was performed using polymerase chain reaction with confronting two-pair primers (PCR-CTPP) assay.
RESULTS: As for rs35652124, diastolic blood pressure (BP) was significantly high in total AA carriers. β2-microglobulin was significantly low in male AA carriers. Systolic BP, diastolic BP and albumin were significantly high in female AA carriers. As for 6721961, systolic BP and diastolic BP were significantly high in female AA carriers. Cox proportional hazard analysis adjusted for age, HD duration, diabetes and Kt/V demonstrated that rs35652124 AA carriers showed higher cardiovascular mortality than (GG+GA) carriers.
CONCLUSION: Nrf2 SNPs were associated with BP in Japanese HD patients. More notably, rs35652124 was associated with cardiovascular mortality in these patients.

Entities:  

Keywords:  Nrf2; blood pressure; cardiovascular mortality.; hemodialysis; polymorphism

Mesh:

Substances:

Year:  2014        PMID: 24904228      PMCID: PMC4045792          DOI: 10.7150/ijms.8590

Source DB:  PubMed          Journal:  Int J Med Sci        ISSN: 1449-1907            Impact factor:   3.738


Introduction

Nuclear factor-erythroid 2 (NF-E2)-related factor 2 (Nrf2) is a member of the cap'n'collar family of basic leucine zipper transcription factors that regulate the expression of many anti-oxidant pathway genes 1. Nrf2 is maintained at basal levels in cells by binding to its inhibitor protein, Kelch-like erythroid-cell-derived protein with CNC homology (ECH)-associated protein 1 (Keap1) 2,3. Nrf2 protects many cell types and organ systems from a broad spectrum of toxic insults and disease pathogenesis. For example, Nrf2 protects lung from butylated hydroxytoluene-induced acute respiratory distress syndrome 4, hyperoxic injury 5, and bleomycin-mediated pulmonary fibrosis 6. Nrf2 increased sensitivity to acetaminophen-induced centrilobular hepatocellular necrosis and hepatotoxicity 7. Nrf2 also contributes to neuro-protection. Activation of the Nrf2-antioxidant response element (ARE) pathway protects neuroblastoma cells from oxidative glutamate toxicity 8 and H2O2-induced apoptosis 9. Nrf2 ameliorates oxidative stress and inflammation in chronic kidney disease 10. Nrf2 antioxidant functions may be important in vascular diseases 11-13. Indeed, expression levels of Nrf2-regulated heme oxygenase-1 and glutathione peroxidase-1 play a protective role in atherogenesis 13. Thus, Nrf2 is called the “multi-organ protector” 14. Many single nucleotide polymorphisms (SNPs) have been identified in the Nrf2 gene 15-19. Of special relevance are the rs35652124 (-653A/G) polymorphism and the rs6721961 (-617C/A) polymorphism, which are located in the promotor region of the gene 16. The rs35652124 and rs6721961 SNPs are predicted to affect Nrf2 myeloid zinc finger 1 (MZF1) and ARE-like promoter binding sites, respectively 15. These SNPs affect efficient binding of proteins such as Nrf2 to the MZF1 and ARE-like promoter binding sites. Thus, Nrf2 autoregulates its transcription, through these promoter regions. Both SNPs were found to reduce the transcription activity of Nrf2, associated with attenuated binding of Nrf2 to the ARE, resulting in decreased Nrf2-dependent gene transcription. Furthermore, a correlation between individuals carrying the rs6721961CA genotype and increased incidence of acute lung injury, has been reported 15. Nrf2 gene SNP rs35652124 was associated with nephritis in childhood-onset systemic lupus erythematosus (SLE) 19, and that it might be a risk factor for developing kidney dysfunction in SLE patients. However, there has been no report on Nrf2 SNPs in hemodialysis (HD) patients. This study aimed to investigate the association of Nrf2 gene SNPs, rs35652124 and rs6721961, with various laboratory data, and all-cause and cardiovascular mortality in Japanese HD patients.

Materials and Methods

Study Subjects

This study included 216 subjects (119 men and 97 women) taking HD at Meiyo Clinic, Aichi, Japan. The patients included 60 diabetics and 156 non-diabetics, with mean age of 60.3±13.3 (SD) years, and mean HD duration of 9.10±8.28 years. The allele frequencies of rs35652124 and rs6721961 were compared with 464 subjects taking medical checkup at Nagoya University Hospital. This study was approved by the Ethics Committee of Nagoya University Graduate School of Medicine in 2004.

Laboratory and CACS Measurement

Blood samples were obtained after 12 hours of fasting. The following biochemical parameters were determined by standard laboratory methods based on Japan Society of Clinical Chemistry (JSCC): total cholesterol, triglyceride, high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol. Coronary artery calcification score (CACS) was measured by using multi-16-detector row computed tomography (Aquilion 16, Toshiba Medical Systems Corporation, Tokyo, Japan) as described previously 20.

Genotyping of Nrf2 Gene SNPs

Nrf2 SNPs, rs35652124 and rs6721961, were selected from the HapMap database. The genotyping of these SNPs was performed using polymerase chain reaction with confronting two-pair primers (PCR-CTPP) assay 21. Confronting pairs of primers are as follows: rs35652124 Forward primer 1: CTTTTATCTCACTTTACCGCCCGAG Forward primer 2: GCAGTCACCCTGAACGCCCT Reverse primer 1: GACACGTGGGAGTTCAGAGGG Reverse primer 2: GGGGTTCCCGTTTTTCTCCC The region containing this polymorphism was amplified by PCR with these primers with the initial denaturation at 95°C for 10 min followed by 30 cycles at 95°C for 1 min, at 66°C for 1 min, at 72°C for 1 min and additionally at 72°C for 5 min. PCR products were visualized on a 2% agarose gel with ethidium bromide staining. Genotyping was performed as follows; 317, 145 bp for AA genotype, 317, 212, 145 bp for AG genotype, and 317, 212 bp for GG genotype. rs6721961 Forward primer 1: CCCTGATTTGGAGGTGCAGAACC Forward primer 2: GGGGAGATGTGGACAGCG Reverse primer 1: GCGAACACGAGCTGCCGGA Reverse primer 2: CTCCGTTTGCCTTTGACGAC The region containing this polymorphism was amplified by PCR with these primers with the initial denaturation at 95°C for 10 min followed by 30 cycles at 95°C for 1 min, at 58°C for 1 min, at 72°C for 1 min and additionally at 72°C for 5 min. PCR products were visualized on a 2% agarose gel with ethidium bromide staining. Genotyping was performed as follows; 282, 113 bp for CC genotype, 282, 205, 113 bp for CA genotype, and 282, 205 bp for AA genotype.

Statistical Analysis

Results are expressed as mean±SD. Hardy-Weinberg equilibrium testing was performed by using the X2 test. Student's t test and multivariate analysis adjusted for age and duration on HD were performed in comparison of the mean values between the different genotype groups. The associations of the SNPs with all-cause mortality and cardiovascular mortality were evaluated. In this study, cardiovascular disease was defined as apparent heart disease, cerebrovascular disease and peripheral artery disease as a primary cause of death. Kaplan-Meier method and Cox proportional hazard analysis were used to examine the impact of these SNPs on survival after adjusting for age and HD duration. Significance was defined as a p value of <0.05. All analysis was done by using SPSS statistics 20 (SPSS Japan Inc., Tokyo, Japan).

Results

Incidence of Nrf2 Gene SNPs

Table 1 shows general characteristics of HD patients. Table 2 shows genotype frequencies of Nrf2 gene. A strong linkage was observed between these two SNPs (D´=0.983, r2=0.507). The incidences of genotypes in Nrf2 gene in healthy subjects and HD patients are shown in Table 3. As for HD patients, the allele frequencies of the rs35652124 polymorphism of the Nrf2 gene were 0.574 for the G allele and 0.426 for the A allele, which was not significantly different from healthy subjects. The allele frequencies of the rs6721961 polymorphism of the Nrf2 gene were 0.720 for the C allele and 0.280 for the A allele, which was not significantly different from healthy subjects. The genotype distributions for the rs35652124 and rs6721961 were in Hardy-Weinberg equilibrium (p=0.61 and 0.46, respectively).
Table 1

General characteristics of subjects.

TotalMaleFemale
n21611997
Age(year)60.3±13.358.7±13.362.4±13.1
HD-duration(year)9.10±8.288.75±8.539.54±7.99
Diabetes(yes / no)60 / 15643 / 7617 / 80
Systolic BP(mmHg)143.2±23.9148.2±21.5136.3±25.5
Diastolic BP(mmHg)75.3±13.576.8±13.373.3±13.5
Red blood cell(×106/μl)3.28±0.373.34±0.393.21±0.34
Hematocrit(%)31.7±3.132.2±3.231.0±2.8
White blood cell(×103/μl)5.87±1.716.12±1.795.55±1.56
Platelet(×103/μl)183±55183±56182±55
LDH(IU/l)349±70344±65355±76
ALP(IU/l)166±76149±57187±90
Total protein(g/l)70.0±4.670.4±4.769.4±4.4
Albumin(g/l)41.3±3.641.9±3.540.5±3.5
Total cholesterol(mmol/l)4.40±0.9342.1±0.914.63±0.90
Triglyceride(mmol/l)1.55±1.201.67±1.491.41±0.66
HDL cholesterol(mmol/l)1.14±0.331.05±0.281.24±0.35
LDL cholesterol(mmol/l)2.58±0.762.44±0.682.74±0.81
Uric acid(μmol/l)490±79499±86479±68
HbA1c(%)7.36±1.407.40±1.517.29±1.14
Calcium (Ca)(mmol/l)2.14±0.232.14±0.242.14±0.22
Phosphorus (P)(mmol/l)1.91±0.371.94±0.431.88±0.29
Ca×P(mmol/l)24.09±0.974.16±1.084.02±0.82
Homocysteine(μmol/l)37.0±22.738.9±22.834.6±22.5
Malondialdehyde(mg/l)1.68±0.291.68±0.311.69±0.26
Lipid peroxides(μmol/l)1.23±0.861.17±0.691.30±1.03
Carboxymethyl lysine(mg/l)9.85±2.059.74±2.139.99±1.94
C-reactive protein (CRP)(nmol/l)21.9±54.619.8±43.124.5±66.2
β2-microglobulin(mg/l)32.8±7.332.4±7.833.3±6.8
Pentosidine(mg/l)0.446±0.1490.451±0.1640.440±0.129
Indoxyl sulfate(mg/l)35.4±14.736.5±14.534.0±14.9
High-sensitive PTH(ng/l)19233±1578721496±1785716510±12464
Troponin T(μg/l)0.031±0.0560.038±0.0660.023±0.038
CACS(mm3)1283±19141432±20611099±1710
Kt/V1.34±0.241.23±0.201.49±0.19

Data are expressed as mean±SD.

Table 2

Genotype frequencies of Nrf2 gene.

rs6721961
CCCAAATotal
rs35652124GG730073
AG31701102
AA10131841
Total1148319216
Table 3

Comparison between HD patients and healthy controls in each genotype of Nrf2 gene.

Healthy subjectsHD patientsp value
rs35652124GG16273
GA204102
AA9841
A allele percentage43.1%42.6%0.694
rs7895833CC256114
CA16183
AA4719
A allele percentage27.5%28.0%0.608

Association of Nrf2 Gene SNPs with Various Variables

Table 4 shows association of SNP rs35652124 with variables in HD patients. In total patients, diastolic blood pressure (BP) and albumin were significantly high in AA carriers. Troponin T was significantly low in AA carriers. In male patients, β2-microglobulin, CACS and troponin T were significantly low in AA carriers. In female patients, systolic BP, diastolic BP, and albumin were significantly high in AA carriers.
Table 4

Variables according to polymorphism in Nrf2 gene.

rs35652124rs6721961
GG+GAAAp value1p value 2CC+CAAAp value1p value 2
Total
n1754119719
Diastolic BP(mmHg)74.2±13.179.9±14.20.0240.047
Albumin(g/l)41.0±3.542.4±3.90.018ns
Homocysteine(μmol/l)37.62±23.6130.03±7.140.002ns
Troponin T(μg/l)0.035±0.0600.016±0.0320.006ns0.033±0.0580.014±0.0180.001ns
Male
n992010811
HD-duration(year)9.25±8.733.83±3.560.001-
Homocysteine(μmol/l)39.89±23.6728.94±6.730.001ns
β2-microglobulin(mg/l)33.3±7.627.9±7.80.0070.034
CACS(mm3)1605±2165579±11860.003ns1533±2130444±630<0.001ns
Troponin T(μg/l)0.042±0.0700.019±0.0360.030ns0.041±0.0690.013±0.0190.002ns
Female
n7621898
Systolic BP(mmHg)132.6±26.9150.3±26.90.0120.002133.6±23.3163.1±32.60.0030.001
Diastolic BP(mmHg)70.1±11.885.1±13.4<0.001<0.00172.3±13.182.9±15.30.0480.039
Platelet(×103/μl)185±56146±14<0.001ns
Albumin(g/l)40.1±3.542.1±3.50.0200.013

1 Unadjusted analysis (Student's t-test or Welch's t-test)

2 Multivariate analysis adjusted for age, HD-duration, diabetes (yes or no) and Kt/V

ns: not significant

We performed multivariate analysis adjusted for age, duration on HD, diabetes (yes or no) and Kt/V. In total patients, diastolic BP was significantly high in AA carriers. In male patients, β2-microglobulin was significantly low in AA carriers. In female patients, systolic BP, diastolic BP, and albumin were significantly high in AA carriers. Table 4 shows association of SNP rs6721961 with variables in HD patients. In total patients, homocysteine and troponin T were significantly low in AA carriers. In male patients, HD duration, homocysteine, CACS, and troponin T were significantly low in AA carriers. In female patients, systolic BP, diastolic BP, and albumin were significantly high in AA carriers. Platelet was significantly low in AA carriers. We performed multivariate analysis adjusted for age, duration on HD, diabetes, and Kt/V. In female patients, systolic and diastolic BP levels were significantly high in AA carriers. Platelet was significantly low in AA carriers. In male patients, however, there were no significant differences in the variables between the genotypes.

Survival Analysis of Nrf2 Gene SNPs

Figure 1 shows estimates of survival by the recessive model of rs35652124 genotype (A: all-cause, B: cardiovascular). The cumulative all-cause mortality values of genotype (GG+GA) and genotype AA were 32.7% and 36.8%, respectively. The cumulative cardiovascular mortality values of genotype (GG+GA) and genotype AA were 13.5% and 28.9%, respectively. In this model, cardiovascular mortality was significantly high in AA carriers of rs35652124 compared with (GG+GA) genotype (p=0.032). Cox proportional hazard analysis adjusted for age and HD duration demonstrated that AA carriers showed significantly high cardiovascular mortality compared with (GG+GA) carriers (odds ratio=2.834, p=0.006). This trend was more prominent in female patients. The cumulative cardiovascular mortality values of genotype (GG+GA) and genotype AA in female were 13.2% and 42.1% (p=0.007), respectively. Cox proportional hazard analysis adjusted for age and HD duration demonstrated that the odds ratio of AA carriers/(GG+GA) carriers was significantly high (odds ratio=5.856, p=0.001).
Figure 1

Survival curves of all-cause mortality (A) and cardiovascular mortality (B), calculated by the Kaplan Meier method, based on the SNP rs35652124. (GG+GA) genotype: solid line, AA genotype: broken line. ns: not significant.

Figure 2 shows estimates of survival by the recessive model of rs6721961 genotype (A: all-cause, B: cardiovascular). There was no significant difference in the mortality between the genotype groups.
Figure 2

Survival curves of all-cause mortality (A) and cardiovascular mortality (B), calculated by the Kaplan Meier method, based on the SNP rs6721961. (CC+CA) genotype: solid line, AA genotype: broken line. ns: not significant.

Discussion

The novel findings of the present study are: 1) systolic and diastolic BP levels were significantly high in rs35652124 AA carriers and rs6721961 AA carriers in HD patients, especially in female patients, and 2) cardiovascular mortality was significantly high in rs35652124 AA carriers in HD patients, especially in female patients. Thus, Nrf2 gene SNPs, rs35652124 and rs6721961, were associated with BP in Japanese HD patients. More notably, SNP rs35652124 was associated with cardiovascular mortality in these patients. The present study revealed that cardiovascular mortality as well as systolic and diastolic BP was significantly high in A allele carriers of rs35652124. This tendency was more prominent in female patients. We consider that high cardiovascular mortality in the A allele carriers of rs35652124 might be due to high BP, because hypertension causes a variety of cardiovascular diseases such as atherosclerosis, myocardial infarction and cerebral infarction. A recent study demonstrated association between Nrf2 polymorphism and hemodynamic parameters. Polymorphisms (rs35652124 and rs6721961) within the Nrf2 promoter were associated with impaired forearm vasodilator responses in an endothelial-independent manner, suggesting an important role of Nrf2 in the regulation of vascular function in humans 16. These vascular responses have been shown to correlate with vasodilator responses in coronary arteries, and predict the risk of developing cardiovascular disease 22. The present study suggests that different transcription activity due to Nrf2 gene polymorphisms might affect BP by modulating protection against cellular oxidative stress. Wu et al. demonstrated that oxidative stress is associated with elevated BP 23. Imbalance between production and scavenging of superoxide anion results in hypertension by the inactivation of nitric oxide, and the increased oxidative stress from the resultant peroxynitrite promotes inflammatory processes such as atherosclerosis. Marzec et al. reported that Nrf2 activity was low in G allele carriers of rs35652124 and A allele carriers of rs6721961 15. We hypothesized that cardiovascular mortality might be higher in G allele carriers of rs35652124 and/or A allele carriers of rs6721961. However, contrary to our hypothesis, the present study revealed that cardiovascular mortality was lower in G allele carriers of rs35652124, but not in A allele carriers of rs6721961. Thus, low activity of Nrf2 as shown in G allele carriers of rs35652124 seems to be associated with low cardiovascular mortality. Sussan et al. reported that Nrf2 knockout mice surprisingly have a decreased susceptibility to ApoE-mediated atherosclerotic plaque formation, and suggested that the pro-atherogenic effect of Nrf2 may be mediated via positive regulation of the scavenger receptor (CD36) 24. Nrf2-mediated CD36 expression is a major pathway by which modified LDL becomes incorporated into atheroma. In Nrf2 deficiency, even in greater oxidative stress, atherosclerosis is reduced. Barajas et al. also found that Nrf2 knockout mice unexpectedly exhibited reduction in the degree of aortic atherosclerosis compared with wild-type controls, and therefore concluded that Nrf2 expression promotes atherosclerotic lesion formation, by a combination of systemic metabolic and local vascular effects 25. Decreased atherosclerosis in the Nrf2 knockout mice correlated with lower plasma total cholesterol levels. Thus, Nrf2 is pro-atherogenic, despite its antioxidative function. These findings might explain why low activity of Nrf2 as shown in G allele carriers of rs35652124 was associated with low cardiovascular mortality in our patients. In conclusion, Nrf2 SNPs, rs35652124 and rs6721961, were associated with BP in Japanese HD patients. More importantly, Nrf2 SNP rs35652124 was associated with cardiovascular mortality in these patients. Further study on Nrf2 SNPs with a larger group of HD patients might be necessary to confirm our findings.
  25 in total

1.  Nrf2 is essential for protection against acute pulmonary injury in mice.

Authors:  K Chan; Y W Kan
Journal:  Proc Natl Acad Sci U S A       Date:  1999-10-26       Impact factor: 11.205

2.  Functional characterization and role of INrf2 in antioxidant response element-mediated expression and antioxidant induction of NAD(P)H:quinone oxidoreductase1 gene.

Authors:  S Dhakshinamoorthy; A K Jaiswal
Journal:  Oncogene       Date:  2001-06-28       Impact factor: 9.867

3.  Role of NRF2 in protection against hyperoxic lung injury in mice.

Authors:  Hye-Youn Cho; Anne E Jedlicka; Sekhar P M Reddy; Thomas W Kensler; Masayuki Yamamoto; Liu-Yi Zhang; Steven R Kleeberger
Journal:  Am J Respir Cell Mol Biol       Date:  2002-02       Impact factor: 6.914

4.  Microarray analysis reveals an antioxidant responsive element-driven gene set involved in conferring protection from an oxidative stress-induced apoptosis in IMR-32 cells.

Authors:  Jiang Li; Jong-Min Lee; Jeffrey A Johnson
Journal:  J Biol Chem       Date:  2001-10-30       Impact factor: 5.157

5.  Endothelial dysfunction, oxidative stress, and risk of cardiovascular events in patients with coronary artery disease.

Authors:  T Heitzer; T Schlinzig; K Krohn; T Meinertz; T Münzel
Journal:  Circulation       Date:  2001-11-27       Impact factor: 29.690

6.  High sensitivity of Nrf2 knockout mice to acetaminophen hepatotoxicity associated with decreased expression of ARE-regulated drug metabolizing enzymes and antioxidant genes.

Authors:  A Enomoto; K Itoh; E Nagayoshi; J Haruta; T Kimura; T O'Connor; T Harada; M Yamamoto
Journal:  Toxicol Sci       Date:  2001-01       Impact factor: 4.849

7.  Dietary approach to attenuate oxidative stress, hypertension, and inflammation in the cardiovascular system.

Authors:  Lingyun Wu; M Hossein Noyan Ashraf; Marina Facci; Rui Wang; Phyllis G Paterson; Alison Ferrie; Bernhard H J Juurlink
Journal:  Proc Natl Acad Sci U S A       Date:  2004-04-21       Impact factor: 11.205

8.  The transcription factor NRF2 protects against pulmonary fibrosis.

Authors:  Hye-Youn Cho; Sekhar P M Reddy; Masayuki Yamamoto; Steven R Kleeberger
Journal:  FASEB J       Date:  2004-06-18       Impact factor: 5.191

9.  Absence of heme oxygenase-1 exacerbates atherosclerotic lesion formation and vascular remodeling.

Authors:  Shaw-Fang Yet; Matthew D Layne; Xiaoli Liu; Yen-Hsu Chen; Bonna Ith; Nicholas E S Sibinga; Mark A Perrella
Journal:  FASEB J       Date:  2003-07-03       Impact factor: 5.191

Review 10.  Targeting the transcription factor Nrf2 to ameliorate oxidative stress and inflammation in chronic kidney disease.

Authors:  Stacey Ruiz; Pablo E Pergola; Richard A Zager; Nosratola D Vaziri
Journal:  Kidney Int       Date:  2013-01-16       Impact factor: 10.612

View more
  26 in total

Review 1.  Nrf2 at the heart of oxidative stress and cardiac protection.

Authors:  Qin M Chen; Anthony J Maltagliati
Journal:  Physiol Genomics       Date:  2017-11-29       Impact factor: 3.107

2.  Prognosis of hormone-dependent breast cancer seems to be influenced by KEAP1, NRF2 and GSTM1 genetic polymorphisms.

Authors:  Micaela Almeida; Mafalda Soares; Ana Cristina Ramalhinho; José Fonseca Moutinho; Luiza Breitenfeld
Journal:  Mol Biol Rep       Date:  2019-04-02       Impact factor: 2.316

3.  Mapping genetic modifiers of radiation-induced cardiotoxicity to rat chromosome 3.

Authors:  Rachel A Schlaak; Anne Frei; Aronne M Schottstaedt; Shirng-Wern Tsaih; Brian L Fish; Leanne Harmann; Qian Liu; Tracy Gasperetti; Meetha Medhora; Paula E North; Jennifer L Strande; Yunguang Sun; Hallgeir Rui; Michael J Flister; Carmen Bergom
Journal:  Am J Physiol Heart Circ Physiol       Date:  2019-03-08       Impact factor: 4.733

Review 4.  Functional polymorphisms in Nrf2: implications for human disease.

Authors:  Hye-Youn Cho; Jacqui Marzec; Steven R Kleeberger
Journal:  Free Radic Biol Med       Date:  2015-06-25       Impact factor: 7.376

Review 5.  Activation of Nrf2 signaling by natural products-can it alleviate diabetes?

Authors:  Manuel Matzinger; Katrin Fischhuber; Elke H Heiss
Journal:  Biotechnol Adv       Date:  2017-12-28       Impact factor: 14.227

6.  Nrf2 and redox status in prediabetic and diabetic patients.

Authors:  Angélica S Jiménez-Osorio; Alejandra Picazo; Susana González-Reyes; Diana Barrera-Oviedo; Martha E Rodríguez-Arellano; José Pedraza-Chaverri
Journal:  Int J Mol Sci       Date:  2014-11-06       Impact factor: 5.923

7.  Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients.

Authors:  Angélica Saraí Jiménez-Osorio; Susana González-Reyes; Wylly Ramsés García-Niño; Hortensia Moreno-Macías; Martha Eunice Rodríguez-Arellano; Gilberto Vargas-Alarcón; Joaquín Zúñiga; Rodrigo Barquera; José Pedraza-Chaverri
Journal:  Oxid Med Cell Longev       Date:  2016-05-04       Impact factor: 6.543

8.  The Role of Genetic Polymorphisms in Nrf2 and P73 in Egyptian Women with Breast Cancer

Authors:  Nevin M Al Azhary; Mahmoud M Kamel; Yahia M Ismail; Amal A Mahmoud; Enas M Radwan
Journal:  Asian Pac J Cancer Prev       Date:  2016-11-01

9.  Genetic Polymorphisms of Transcription Factor NRF2 and of its Host Gene Sulfiredoxin (SRXN1) are Associated with Cerebrovascular Disease in a Finnish Cohort, the TAMRISK Study.

Authors:  Tarja Kunnas; Kirsi Määttä; Seppo T Nikkari
Journal:  Int J Med Sci       Date:  2016-04-10       Impact factor: 3.738

10.  Differential regulation of innate immune cytokine production through pharmacological activation of Nuclear Factor-Erythroid-2-Related Factor 2 (NRF2) in burn patient immune cells and monocytes.

Authors:  Timothy K Eitas; Wesley H Stepp; Lucas Sjeklocha; Clayton V Long; Caitlin Riley; James Callahan; Yolanda Sanchez; Peter Gough; Laquanda Knowlin; David van Duin; Shiara Ortiz-Pujols; Samuel W Jones; Robert Maile; Zhi Hong; Scott Berger; Bruce A Cairns
Journal:  PLoS One       Date:  2017-09-08       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.