HSP70-binding protein HSPBP1 regulates chaperone expression at a posttranslational level and is essential for spermatogenesis.

Molecular chaperones play key roles during growth, development, and stress survival. The ability to induce chaperone expression enables cells to cope with the accumulation of nonnative proteins under stress and complete developmental processes with an increased requirement for chaperone assistance. Here we generate and analyze transgenic mice that lack the cochaperone HSPBP1, a nucleotide-exchange factor of HSP70 proteins and inhibitor of chaperone-assisted protein degradation. Male HSPBP1(-/-) mice are sterile because of impaired meiosis and massive apoptosis of spermatocytes. HSPBP1 deficiency in testes strongly reduces the expression of the inducible, antiapoptotic HSP70 family members HSPA1L and HSPA2, the latter of which is essential for synaptonemal complex disassembly during meiosis. We demonstrate that HSPBP1 affects chaperone expression at a posttranslational level by inhibiting the ubiquitylation and proteasomal degradation of inducible HSP70 proteins. We further provide evidence that the cochaperone BAG2 contributes to HSP70 stabilization in tissues other than testes. Our findings reveal that chaperone expression is determined not only by regulated transcription, but also by controlled degradation, with degradation-inhibiting cochaperones exerting essential prosurvival functions.

INTRODUCTION

The 70-kDa heat shock proteins (HSP70s) and their regulating cochaperones constitute multifunctional cellular machineries essential for protein homeostasis (proteostasis; Mayer and Bukau, 2005; Brodsky and Chiosis, 2006; Vos ; Kampinga and Craig, 2010; Kettern ; Hartl ). Owing to their ability to bind hydrophobic protein sequences, HSP70s assist folding and assembly, conformational regulation, sorting, and degradation of client proteins. In the cytoplasm of mammalian cells, housekeeping functions are exerted by constitutively expressed HSPA8 (also known as HSC70 or HSP73; Vos ; Kampinga and Craig, 2010). Proteostasis capacity is increased under stressful conditions, such as heat or oxidative stress, by the expression of inducible HSP70s, including HSPA1A, HSPA1B, and HSPA1L (Vos ; Murphy, 2013). A cytoplasmic HSP70 family member with a restricted expression pattern is HSPA2 (HSP70-2), which was initially identified as a testis-specific chaperone essential for spermatogenesis (Dix , 1997; Zhu ; Son ).

The process of spermatogenesis is a delicate and highly synchronized germ cell maturation pathway, which takes place in the seminiferous tubules of the testes (Russell ). The underlying developmental program places high demands on cellular homeostasis and is associated with a very active apoptosis machinery that serves to sort out unfit cells (Baum ; Shaha ; Okamoto ). In agreement with an important role of HSPA2 during sperm cell maturation, HSPA2 transcription is strongly induced during early meiotic stages. Expression reaches a peak at pachytene, when the chaperone increasingly engages in the conformational regulation of signaling molecules and the disassembly of synaptonemal complexes (SCs) that connect paired, homologous chromosomes (Dix ; Zhu ). Targeted disruption of HSPA2 causes sperm cell apoptosis and infertility in mice (Dix ), and decreased expression of the chaperone is also associated with male infertility in humans (Feng ). Thus spermatogenesis is critically dependent on chaperones such as HSPA2, and even mild stress conditions, such a hyperthermia, can trigger a massive demise of spermatocytes (Rockett ; Paul ).

More recent studies also identified HSPA2 in a range of cancer cells (Rohde ; Scieglinska ). This finding is remarkable because HSPA2 and also other inducible HSP70 chaperones display strong antiapoptotic activity and are required for cancer cell growth (Ravagnan ; Nylandsted ; Rohde ; Lanneau ). In general, tumorigenesis involves a series of molecular events allowing tumor cells to proliferate indefinitely and evade cellular safeguard mechanisms, such as apoptosis. This process of facilitated evolution increasingly leads to a dependence of the tumor cell on a specific set of oncogenes and nononcogenes (Luo ). The upregulated transcription of inducible HSP70 chaperones during tumorigenesis is one example of nononcogene dependence, which may in part be mediated by heat shock transcription factor 1 (HSF1; Dai , 2012). Consistent with an important buffering role of chaperones during tumorigenesis, cancer treatment frequently relies on stress sensitization therapies, such as hyperthermia, to selectively kill off cancer cells. The strong parallels between spermatogenesis and tumorigenesis suggest that similar molecular mechanisms are at play. Indeed, misregulation of HSF1-dependent chaperone expression severely impairs spermatogenesis (Nakai ; Vydra ; Widlak ; Akerfelt )

Chaperone-binding cochaperones confer functional specificity to the HSP70 chaperone system (Hartl ; Kampinga and Craig, 2010; Kettern ; Mayer and Bukau, 2005; Vos ). Engagement of HSP70s in protein degradation is triggered by cochaperones that act as chaperone-associated ubiquitin ligases and mediate the attachment of a ubiquitin-based degradation signal onto HSP70-bound client proteins (Kettern ). The founding member of these cochaperones is the carboxy-terminus of HSP70 interacting protein (CHIP), which triggers the degradation of a broad range of HSP70 clients (Arndt ). Of importance, CHIP-mediated ubiquitylation can direct clients either to the proteasome, a proteolytic complex specialized in the degradation of ubiquitylated proteins, or lysosomes, in a process called chaperone-assisted selective autophagy (Arndt ; Kettern ; Ulbricht ). Pathway selection is aided by additional cochaperones that enter the CHIP/HSP70 complex, by which members of the BCL2-associated athanogene (BAG) protein family are of particular importance (Takayama and Reed, 2001; Kettern ). BAG1 facilitates docking of the CHIP/HSP70 complex at the proteasome (Lüders ; Demand ), whereas BAG3 triggers lysosomal client degradation (Carra ; Gamerdinger , 2011; Arndt ). Of note, the ubiquitin ligase activity of CHIP targets not only the bound client protein in the assembled complex. Instead, also BAG1, BAG3, HSPA8, and HSPA1A/B were shown to be modified by CHIP-mediated ubiquitylation (Jiang ; Alberti ; Arndt ). This mainly seems to provide additional sorting information for client degradation. However, in the case of inducible HSPA1A/B, CHIP-mediated ubiquitylation provides a means to initiate the degradation of the chaperone proteins themselves (Qian ). In this way, the cellular concentration of the chaperones is reduced when cells recover from stressful conditions and have to get rid of excess chaperone molecules (Qian ). This suggests that CHIP-mediated degradation contributes to the regulation of chaperone expression at a posttranslational level.

Chaperone cofactors can stimulate as well as restrict CHIP-mediated protein degradation. Restriction is mediated by the cochaperones HSPBP1 and BAG2. Binding of one of these cochaperones to the HSP70/CHIP complex inhibits the ubiquitin ligase activity of CHIP (Alberti ; Arndt ; Dai ). As a consequence, chaperone clients such as the CFTR ion channel are stabilized (Alberti ; Arndt ). Yet the full repertoire of chaperone clients affected by the CHIP inhibitors and their effect on organism development and homeostasis has not been established.

Here we show that HSPBP1 deficiency in mice causes male sterility because of impaired spermatogenesis and massive apoptosis of spermatocytes. We demonstrate that HSPBP1 exerts prosurvival functions by inhibiting the ubiquitylation and proteasomal degradation of inducible HSP70 family members. Finally, we provide evidence that the CHIP inhibitor BAG2 contributes to chaperone stabilization in tissues other than testes. Our study thus establishes a novel regulatory mechanism that controls the abundance of antiapoptotic, inducible members of the HSP70 chaperone family at a posttranslational level and in this way ensures the survival of cells that rely on high-level chaperone expression.

RESULTS

Targeted disruption of HSPBP1 results in male sterility

In an effort to elucidate the physiological role of the HSP70 cochaperone and CHIP inhibitor HSPBP1, we investigated its expression profile in mice. Immunoblot analysis of tissue extracts with an anti-HSPBP1 antibody revealed weak to moderate expression of the cochaperone in brain, muscle, colon, and small intestine and strong expression in testis (Figure 1A). In situ hybridization was performed to identify HSPBP1-expressing cell types in testes. Antisense HSPBP1 probes hybridized specifically to cells present inside the seminiferous tubules of the adult testes, with no staining in the somatic interstitial cells and no staining using the control sense HSPBP1 probe (Figure 1B). The level of HSPBP1 expression varies among seminiferous tubule cross sections, depending on their epithelial stage, and is strongest in epithelial stages I–VI (Figure 1B; Russell ). Within the seminiferous tubules, HSPBP1 is expressed in the germ cells, with strongest expression in pachytene meiotic spermatocytes and postmeiotic round spermatids (Figure 1B). The expression pattern of HSPBP1 suggests that the cochaperone might have roles in meiosis and round spermatid differentiation during spermatogenesis.

FIGURE 1

HSPBP1 is abundantly expressed in mouse testis. (A) Soluble lysates of the indicated tissues were prepared from 8-wk-old wild-type (wt) and HSPBP1 deficient (ko) mice. HSPBP1 and HSPA8 were detected using specific antibodies. Each lane corresponds to 100 μg of lysate protein. (B) In situ hybridization for HSPBP1 in adult testis sections. Bound HSPBP1 probe was visualized with dark blue/purple precipitate and sections counterstained with nuclear fast red. Scale bars, 50 μm (low magnification), 10 μm (high magnification). Seminiferous tubule stages are indicated by roman numerals, and examples of mitotic spermatogonia (sg), meiotic spermatocytes (sc), spermatids (sp), round spermatids (rs), and elongated spermatids (es) are annotated. (C) Schematic presentation of the disruption of the mouse HSPBP1 locus by insertion of a targeting construct (tc). Blue boxes indicate exons of the HSPBP1 gene. Regions detected during genotyping are shown. HPRT, hypoxanthine guanine phosphoribosyl transferase. (D) Genotyping of transgenic mice. Top, Southern blot analysis after digestion of DNA from ES cell clones with EcoRI. Bottom, PCR analysis using wt- and ko-specific primer pairs.

To investigate the function of HSPBP1 for tissue development and homeostasis, we generated HSPBP1-deficient mice. For this purpose exons 2–4 of the HSPBP1 locus, including the START codon (exon 2), were removed by targeted deletion in embryonic stem (ES) cells (Figure 1C). Mice were derived from these ES cells and backcrossed 10 times to C57BL/6 mice. Southern blot analysis of DNA isolated from ES cell clones and from obtained mice confirmed the expected targeting of the HSPBP1 gene, and a PCR was established to genotype pups (Figure 1D). The absence of the 40-kDa HSPBP1 protein in tissues of HSPBP1− mice was verified by immunoblot analysis (Figure 1A). HSPBP1− mice were born at normal Mendelian ratios and were largely indistinguishable from wild-type and heterozygous littermates. However, male HSPBP1− mice displayed a severe reduction in the size and weight of their testes, reaching only ∼30% of the weight of HSPBP1+ and HSPBP1+ testes at an age of 8 wk (Figure 2, A and B). When mated, male but not female HSPBP1− mice were infertile, consistent with a severe impairment of testicular function (Table 1).

FIGURE 2

HSPBP1 is required for spermatogenesis. (A) Morphology of testes and epididymis (epi.) prepared from 8-wk-old wild-type (+/+) and HSPBP1-deficient mice (−/−). Scale bars, 2 mm. (B) Body weight and testis weight of wild-type (+/+) and transgenic mice heterozygous (+/−) and homozygous (−/−) for HSPBP1 were determined at the indicated time points after birth. (C) Histological sections of testes of 8-wk-old HSPBP1+ and HSPBP1− mice. Scale bars, 50 μm (low magnification), 20 μm (high magnification). (D) Epididymides of HSPBP1− mice are devoid of mature sperm and show reduced weight. Top, hematoxylin and eosin staining of epididymides sections from HSPBP1+ and HSPBP1− mice. Scale bars, 50 μm. Bottom, epididymis weight was determined at 8 wk after birth (mean ± SEM, n ≥ 3). (E) Seminiferous tubules in HSPBP1− mice show an increased number of apoptotic cells. TUNEL analysis of testes sections at 8 wk after birth. Scale bars, 50 μm. (F) Quantification of data obtained in E. (G) Transcript levels for HSPBP1 and stage-specific spermatogenesis markers determined in testis lysates by qRT-PCR at the indicated time points after birth. Maximum level detected in wild-type mice was set to 100% (mean ± SEM, n ≥ 3).

TABLE 1:

Male HSPBP1-deficient mice are sterile.

♂	+/+	+/+	+/−	−/−	−/−
♀	+/+	−/−	−/−	−/−	+/+
Litter size (n = 5)	7.0	7.8	7.3	0	0

Values represent mean of five independent matings.

Seminiferous tubules of 8-wk-old wild-type and heterozygous mice were indistinguishable and contained spermatogenic cells in mitotic (spermatogonia), meiotic (spermatocytes) and postmeiotic (spermatids) phases of development (Figure 2C). In contrast, tubules of HSPBP1− mice displayed significant morphological alterations. Most tubules were highly vacuolized, whereas some appeared relatively intact but still lacked appreciable levels of round and elongated postmeiotic spermatids (Figure 2C). However, a number of cells remained at the basal region of the tubules, where mitotic spermatogonia and early meiotic spermatocytes are normally located (Figure 2C). The testis histology suggested that the infertility and reduced testis weight in HSPBP1− male mice are caused by a severe block in spermatogenesis. In agreement with this conclusion, epididymides of HSPBP1 deficient mice were devoid of mature spermatozoa (Figure 2D).

The histology of HSPBP1− testes revealed a severe reduction in the number of germ cells present within the seminiferous tubules. Cells in the adluminal region of vacuolized seminiferous tubules showed intense DNA staining and condensed nuclei, possibly reflecting apoptotic cell death (Figure 2C). A terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay that detects DNA strand breaks confirmed this notion. Whereas apoptotic cells were rare in seminiferous tubules of adult HSPBP1+/+ mice, ∼20% of the tubules in HSPBP1− mice contained multiple apoptotic cells (Figure 2E and F). Thus reduction in germ cell number in HSPBP1− testes is at least partly caused by increased cell death in these mutants.

To identify the stages of spermatogenesis that are defective in HSPBP1− testes, we investigated the expression of stage-specific differentiation markers. Expression of the spermatogonia/early spermatocyte marker DAZL (Ruggiu ) was largely unaffected in HSPBP1− testes (Figure 2G), suggesting that HSPBP1 deficiency does not impair the number of mitotic spermatogonia. In contrast, expression of phosphoglycerate kinase-2 (PGK2), a marker for meiotic spermatocytes/round spermatids (McCarrey ), and the postmeiotic spermatid marker PRM1 (Hecht ) were not detectable in testes of HSPBP1− mice (Figure 2G), revealing an inability of spermatocytes to progress through meiosis if HSPBP1 is missing. This is also consistent with timing of the appearance of the testicular weight phenotype during the first wave of spermatogenesis in prepubertal pups. HSPBP1− testes are similar in weight to control testes at 14 d postpartum (Figure 2B), a stage when mitotic spermatogonia and leptotene- and zygotene-stage meiotic spermatocytes are present (Bellve ). By 3 wk postpartum, as the first germ cells exit meiosis and become round spermatids, HSPBP1− testis weight is significantly lower than that of controls (Figure 2B).

To investigate the cause of germ cell apoptosis in HSPBP1− spermatocytes, we analyzed meiotic progression in chromosome spreads from adult testes (Figure 3). Chromosome spreads from HSPBP1− and HSPBP1 were immunostained for SYCP3, a component of the axial/lateral elements of the SC that labels this structure throughout meiotic prophase, and for SYCP1, a component of the transverse filaments of the SC that labels fully synapsed regions (Meuwissen ; Lammers ). Assembly of the axial element of the SC in leptotene and homologous chromosome synapsis and synaptonemal complex assembly in zygotene all appear to occur normally in HSPBP1− testes to generate fully synapsed pachytene nuclei (Figure 3A). However, no diplotene or later stages of meiosis were observed among a total of 300 SYCP3-positive meiotic spermatocytes derived from three HSPBP1− animals (Figure 3, A and B). In contrast, in control animals, 25% of SYCP3-positive spermatocytes were in the diplotene stage of meiosis, undergoing synaptonemal complex disassembly (Figure 3, A and B; p < 0.01, Fisher's exact test). Thus the spermatogenesis arrest in HSPBP1− testes appears to arise from a failure to progress beyond the pachytene stage of meiosis.

FIGURE 3

Ablation of HSPBP1 expression results in a late pachytene arrest of meiotic spermatocytes. (A) Immunostaining of chromosome spreads from adult testes for synaptonemal complex proteins SYCP3 (axial/lateral elements) and SYCP1 (transverse filament). (B) Graph showing the distribution of SYCP3-positive nuclei across meiotic prophase substages as determined by SYCP3/SYCP1 immunostaining (n = 300, three mice of each genotype, 100 nuclei/mouse). (C) Immunostaining of adult testis chromosome spreads for SYCP3 and γH2AX (double-stranded DNA-break marker). The sex body is indicated with an arrow. (D) Immunostaining of adult testis chromosome spreads for SYCP3 and MLH1 (late recombination marker). (E) Immunostaining of adult testis chromosome spreads for SYCP3 and RBMY (marker for meiotic sex chromosome inactivation). Scale bars, 20 μm.

A number of mouse meiotic mutants have been described that exhibit apoptosis during pachytene as a response to defects in homologous chromosome synapsis (Burgoyne ). It has been proposed that the apoptotic response of these mutants is mediated by unrepaired autosomal DNA double-strand breaks sequestering the meiotic sex chromosome inactivation (MSCI) machinery away from the X and Y sex chromosomes (Burgoyne ). A second apoptosis-inducing checkpoint mechanism operating in pachytene spermatocytes appears to respond to stalled recombination intermediates (Li and Schimenti, 2007; Burgoyne ). Because SYCP3/SYCP1 immunostaining suggests that chromosome synapsis is not defective in HSPBP1− spermatocytes (Figure 3A), we tested whether the apoptosis in HSPBP1− spermatocytes might be a response to defects in meiotic recombination or MSCI. Immunostaining chromosome spreads for the dsDNA break marker γH2AX (Mahadevaiah ) revealed that meiotic recombination is being initiated normally in leptotene in HSPBP1− testes and that these breaks are being processed and repaired on autosomes in zygotene and pachytene (Figure 3C). In addition, HSPBP1− spermatocytes acquire the late recombination marker MLH1 (Baker ), suggesting that recombination nodules are maturing correctly in pachytene (Figure 3D). Thus meiotic recombination appears to be progressing normally in HSPBP1− spermatocytes. Furthermore, the persistence of γH2AX staining on the X and Y chromosomes in pachytene (Figure 3C, arrow), suggests that the sex body is forming normally in HSPBP1− testes. We confirmed that MSCI is occurring in HSPBP1− testes by immunostaining chromosome spreads with antibodies to the Y-encoded RBMY protein (Turner ). Like HSPBP1 control spermatocytes, HSPBP1− spermatocytes are able to down-regulate expression of RBMY during pachytene (Figure 3E), suggesting that MSCI is occurring in these cells. Thus the meiotic prophase I arrest and apoptosis seen in HSPBP1− testes does not appear to be caused by overt defects in chromosome synapsis, the progression of meiotic recombination, or meiotic sex chromosome inactivation.

The presence of MLH1 foci in HSPBP1− spermatocytes indicates that these cells are progressing into mid/late pachytene (Figure 3D). To test whether HSPBP1− spermatocytes are dying during pachytene or progressing through to the end of pachytene, we assessed whether the proportion of early and mid/late pachytene cells differed between HSPBP1 and HSPBP1− testes. We quantified the proportion of early and mid/late pachytene spermatocytes in HSPBP1− testes by immunostaining chromosome spreads with SYCP3 and the mid/late pachytene marker histone H1t (Inselman ). Of interest, the proportion of histone H1t-positive pachytene nuclei was similar in chromosome spreads from HSPBP1 and HSPBP1− testes (132 of 300 HSPBP1− pachytene cells were H1t positive, compared with 135 of 300 HSPBP1− pachytene cells; Fisher's exact test, p > 0.5). Thus HSPBP1− spermatocytes apparently progress late into pachytene but do not appear to be able to enter diplotene. The late pachytene arrest in HSPBP1− testes presumably represents either a failure in meiotic progression at the late pachytene stage or a more direct defect in SC disassembly during diplotene.

Ablation of HSPBP1 impairs the expression of the inducible chaperones HSPA2 and HSPA1L in testes

The phenotype of HSPBP1− mice resembles the one observed after the ablation of the chaperone HSPA2, which is an HSP70 family member abundantly expressed in testes and localized to the synaptonemal complex in pachytene and diplotene spermatocytes (Allen ; Dix ). HSPA2 deficiency also results in defective synaptonemal complex disassembly, failed meiosis, germ cell apoptosis, and male infertility (Dix ; Alekseev ). Of note, HSPA2 was detectable in HSPBP1 complexes immunoprecipitated from wild-type testes lysates, suggesting that the chaperone and cochaperone form a functional HSP70 machinery in developing spermatocytes (Figure 4A). This is further supported by the fact that transcript levels for both proteins show a strong induction between 2 and 3 wk postpartum, when the first wave of spermatocytes progresses through pachytene and exits meiosis (Figures 2G and 4B).

FIGURE 4

HSPBP1 and HSPA2 interact with each other in testes and are coinduced during spermatogenesis. (A) Testis lysates of wild-type (wt) and HSPBP1− mice (ko) were prepared in RIPA buffer, and the soluble protein fraction was subjected to immunoprecipitation (IP) with an anti-HSPBP1 antibody or the same amount of control immunoglobulin G. A 40-μg amount of lysate protein was loaded as control (lys.). (B) At the indicated time points after birth, mRNA was prepared from testis, and transcript levels were determined for HSPA2 and HSPA1L by qRT-PCR. The maximum transcript level was set to 100% (see Figure 2G for HSPBP1 expression during spermatogenesis).

In the course of these experiments we also investigated the expression of other inducible HSP70 family members in mouse testes. Whereas most cell types express HSPA1A and/or HSPA1B as main inducible forms (Vos ), we did not detect significant transcript levels for those two chaperones in testes. Instead, HSPA1L was identified as the main HSPA1 isoform expressed in this tissue, showing induced transcription between 2 and 3 wk postpartum (to ∼20% of maximum level) and a strong further increase at later stages during spermatid maturation (Figure 4B).

Next we analyzed testis lysates for alterations in the chaperone/cochaperone network in the absence of HSPBP1. Although the cellular concentration of HSP90 and constitutively expressed HSPA8 remained largely unaffected, the lack of HSPBP1 had a strong effect on the expression of inducible HSP70s (Figure 5, A and B). HSPA2 was virtually absent in HSPBP1− testis at 3 and 8 wk postpartum, and HSPA1L levels were strongly reduced at these time points. It is conceivable that the altered cellular composition in HSPBP1− testis contributes to this decline in HSPA1L and HSPA2 levels, with spermatocytes no longer reaching stages of maximal chaperone expression because of massive apoptosis at late pachytene. Nevertheless, a dosage effect was observed in testes of heterozygous animals at 3 wk of age, when the reduced expression of HSPBP1 caused ∼50% reduction in cellular concentration of HSPA2 and HSPA1L (Figure 5, A and B). Of note, levels of HSPA2 and HSPA1L transcripts did not show such a reduction and were instead increased in HSPBP1+ heterozygous testes. These findings point to a role of HSPBP1 in the posttranslational stabilization of inducible HSP70s in spermatocytes.

FIGURE 5

HSPBP1 ablation causes a reduction of HSPA2 and HSPA1L expression in mouse testis. (A) At the indicated time points after birth, testis lysates were prepared from wild-type (+/+) and HSPBP1-depleted mice. Chaperones and cochaperones were detected using specific antibodies. Each lane corresponds to 100 μg of soluble lysate protein. Tubulin served as loading control. (B) Protein levels of HSPA2 and HSPA1L, detected in testis lysates as shown in A, were quantified (black bars) and compared with transcript levels in testes for the two proteins determined by qRT-PCR (light gray) (mean ± SEM, n ≥ 3).

HSPBP1 inhibits the ubiquitylation and proteasomal degradation of inducible HSP70 chaperones

We previously showed that HSPBP1 inhibits the activity of the HSP70-associated ubiquitin ligase CHIP in chaperone/cochaperone complexes (see later discussion of Figure 7; Alberti ). In these complexes, CHIP mediates not only the ubiquitylation of bound client proteins, but also that of associated chaperones and cochaperones (Jiang ; Alberti ; Qian ; Arndt ). This was shown to trigger the proteasomal degradation of inducible HSPA1A and HSPA1B but not of constitutively expressed HSPA8 (Jiang ; Qian ). The alterations of the chaperone repertoire observed in testes after HSPBP1 ablation may therefore directly reflect the CHIP-inhibiting activity of the cochaperone. In line with this conclusion, addition of purified HSPBP1 to in vitro ubiquitylation reactions significantly inhibited CHIP-mediated ubiquitylation of HSPA2 and HSPA1L (Figure 6, A–D).

FIGURE 7

Role of HSPBP1 and BAG2 as regulators of CHIP-mediated degradation. (A) Schematic presentation of the HSP70/cochaperone network that regulates CHIP-mediated protein degradation. CHIP binds to the carboxy terminus of HSP70 and ubiquitylates the chaperone and bound client proteins in conjunction with ubiquitin-conjugating enzymes of the UBCH4/5 family. Targeting to the proteasome is assisted by the cochaperone BAG1, whereas binding of BAG3 to the chaperone/CHIP complex induces the lysosomal degradation of the client. HSPBP1 and BAG2 inhibit the ubiquitin ligase activity of CHIP in the assembled chaperone complex and thereby facilitate the folding of the client. (B) Schematic presentation of the CHIP/HSPBP1/BAG2 cochaperone network that balances the expression of inducible HSP70 chaperones at the posttranslational level. CHIP is able to mediate the ubiquitylation of inducible HSP70s and induces their proteasomal degradation. Association of HSPBP1 or BAG2 with the HSP70/CHIP complex results in an inhibition of CHIP activity, leading to stabilization of inducible HSP70s. *Present study; (1) Jiang ), (2) Qian ), (3) Sasaki ).

FIGURE 6

HSPBP1 interferes with the ubiquitylation of inducible HSP70 chaperones and cooperates with BAG2 in preventing the proteasomal degradation of HSPA2 and HSPA1L. (A) In vitro ubiquitylation of purified HSPA2 was performed in the presence of E1 and UBCH5b. Where indicated, purified CHIP and increasing concentrations of HSPBP1 (onefold and fivefold molar excess over added CHIP) were added to the reaction. Ubiquitin conjugates were detected by an anti-ubiquitin conjugate antibody (poly-Ub.) and anti-HSPA2 (HSPA2/Ubn-HSPA2), respectively. (B) Quantification of data obtained in A (mean ± SEM, n = 3; *p < 0.05, **p < 0.001, ***p < 0.0001). (C) In vitro ubiquitylation of purified HSPA1L was performed in the presence of E1 and UBCH5b. Where indicated, purified CHIP and HSPBP1 (at a fivefold molar excess over added CHIP) were added to the reaction. Ubiquitin conjugates were detected by an anti-HSP70 antibody. (D) Quantification of data obtained in C (mean ± SEM, n = 3; **p < 0.001). (E) Analysis of HSPA1L stability in HeLa cells. FLAG-HSPA1L–expressing cells were transfected with siRNA targeting HSPBP1 and BAG2 or a control siRNA (–) as indicated. MG132 (20 μM, 16 h) was added when indicated to verify proteasomal degradation of FLAG-HSPA1L. Cells were harvested and lysed after 72 h and analyzed by SDS–PAGE and immunoblotting to quantify protein levels of FLAG-HSPA1L (mean ± SEM, n = 3; *p < 0.05, **p < 0.001). (F) Analysis of HSPA2 stability in mouse embryonic fibroblasts. FLAG-HSPA2–expressing cells were transfected with siRNA targeting HSPBP1 and BAG2 or a control siRNA (–) as indicated. MG132 (20 μM, 16 h) was added when indicated to verify proteasomal degradation. Cells were harvested and lysed after 48 h and analyzed by SDS–PAGE and immunoblotting to quantify protein levels (mean ± SEM, n = 3; *p < 0.05, **p < 0.001). (G) Detection of HSPBP1 and BAG2 in lysates of brain and testis from 3-wk-old wild-type (+/+), HSPBP1 heterozygous (+/−), and homozygous (−/−) knockout mice. Each lane corresponds to 100 μg of soluble lysate protein. The cochaperones were detected with specific antibodies. Tubulin served as loading control.

The effect of HSPBP1 on proteasomal degradation of inducible HSP70s was investigated in human HeLa cells and mouse embryonic fibroblasts (MEFs). To separate regulated chaperone degradation from other stress responses, inducible chaperones were ectopically expressed under control of a cytomegalovirus promoter and specifically detected through an attached FLAG epitope. In HeLa cells, depletion of endogenous HSPBP1 by specific small interfering RNAs (siRNAs) led to ∼50% reduction of HSPA1L expression, consistent with a stabilizing activity of the cochaperone (Figure 6E).

Mammalian cells also express the cochaperone BAG2, which shares with HSPBP1 the ability to inhibit CHIP-mediated ubiquitylation (Figure 7; Arndt ). We therefore investigated whether BAG2 contributes to the stabilization of inducible HSP70 chaperones. Indeed, siRNA-mediated depletion of endogenous BAG2 from HeLa cells caused a reduction of HSPA1L expression to ∼40% (Figure 6E). Moreover, when combined with HSPBP1 depletion, a further decrease in HSPA1L concentration was observed, suggesting cooperation of HSPBP1 and BAG2 in stabilizing inducible HSP70s. Finally, we demonstrated that cochaperone depletion did not affect HSPA1L expression in HeLa cells treated with the proteasome inhibitor MG132 (Figure 6E).

HSPA2 stability was analyzed in transiently transfected MEFs. Depletion of endogenous HSPBP1 led to ∼50% reduction of HSPA2 expression, and codepletion of BAG2 further reduced chaperone levels to ∼30%, which was not observed when proteasome activity was inhibited (Figure 6F). Furthermore, the cellular concentration of constitutively expressed HSPA8 was unaffected by cochaperone depletion (Figure 6F). Taken together, the data indicate that the CHIP inhibitors HSPBP1 and BAG2 jointly control the proteasomal degradation of inducible HSP70 chaperones in diverse mammalian cells.

Intriguingly, BAG2 was not detectable in mouse testis lysates, where HSPBP1 is very abundantly expressed (Figure 6G). In contrast, significant levels of BAG2 were found in brain homogenates that contain only moderate levels of HSPBP1. Furthermore, BAG2 levels were increased in HSPBP1− brains, most likely to compensate for the lack of the other CHIP inhibitor (Figure 6G). Thus we conclude that the cochaperones BAG2 and HSPBP1 regulate the expression of inducible HSP70s in a posttranslational and tissue-specific manner.

DISCUSSION

In this study, we identify a posttranslational mechanism that controls the cellular abundance of transcriptionally induced HSP70 family members. The two cochaperones HSPBP1 and BAG2 are of central importance in this regard. Both cochaperones were previously shown to inhibit the activity of the chaperone-associated ubiquitin ligase CHIP and restrict the degradation of Hsp70-bound client proteins (Figure 7A; Alberti ; Arndt ; Dai ; Kettern ). The findings presented here significantly extend this functional concept by identifying HSPBP1 and BAG2 as key regulators of inducible HSP70 expression (Figure 7B).

HSPBP1 specifically targets the HSP70 chaperones HSPA2 and HSPA1L, the expression of which is induced in testes during sperm development. HSPBP1 interferes with the CHIP-mediated ubiquitylation of both chaperones and thereby prevents their targeting for proteasomal degradation (Figure 6). Accordingly, HSPA2 and HSPA1L protein levels are strongly reduced in testis of HSPBP1− mice, and the phenotype of these mice phenocopies those reported for HSPA2-deficient animals (Dix ). In both cases, spermatocytes fail to disassemble the synaptonemal complex during meiosis I and arrest at late pachytene, followed by apoptotic cell death (Figure 2; Dix ). As a consequence, mice are unable to form mature sperm and display male infertility. Because HSPA2 and HSPA1L expression is induced at late stages of spermatogenesis, the strongly decreased number of postpachytene cells in HSPBP1− testes apparently contributes to the observed reduction in HSPA2 and HSPA1L levels. The effect of HSPBP1 on chaperone stability is therefore most evident in testes of heterozygous animals, in which apoptotic cell death is not increased but HSPA2 and HSPA1L protein levels are strongly reduced, whereas transcript levels are not similarly affected (Figure 5).

The role of HSPA1L in testes has not been elucidated in detail so far. In contrast, recent work revealed molecular details of HSPA2 function during spermatogenesis (Dix ; Zhu ; Alekseev ). It was shown that HSPA2 associates with the cyclin-dependent kinase CDC2 in testes and is required for the formation of an active CDC2/cyclin B kinase complex in pachytene spermatocytes, which drives the G2/M transition during meiosis I (Zhu ; Alekseev ). In addition, HSPA2 binds to SCs formed between paired homologous chromosomes during meiotic prophase and exerts essential functions during SC disassembly at diplotene (Dix ). As in HSPA2− testis, synaptonemal complexes formed normally in the absence of HSPBP1 but failed to disassemble, and normal diplotene spermatocytes were not observed in corresponding transgenic mice (Figure 3). The data presented here identify HSPA2 and HSPBP1 as a specific chaperone/cochaperone machinery required for the conformational regulation of signaling pathways and protein complex assembly/disassembly during male meiosis.

The chaperone machinery that drives male meiosis also comprises HSP90 proteins. Targeted disruption of HSP90α in mice results in a failure to mediate SC disassembly, followed by a late pachytene arrest of spermatogenesis and apoptotic death of spermatocytes, similar to findings for HSPBP1- and HSPA2-deficient mice, respectively (Grad ). In this regard, it is noteworthy that HSPBP1 acts not only as a CHIP inhibitor, but also as a nucleotide exchange factor of HSP70s, which triggers the release of bound client proteins by stimulating ADP–ATP exchange during the reaction cycle of the chaperones (Raynes and Guerriero, 1998; Shomura ). HSPBP1 may therefore facilitate the transfer of client proteins from HSPA2 onto HSP90 in meiotic spermatocytes. This may promote chaperone cooperation during the processing of clients that are targeted by both chaperones, including the previously mentioned kinase CDC2 (Zhu ; Grad ).

HSPBP1 is not the first cochaperone shown to be required for HSPA2 stabilization in testes. BAG6 (also known as BAT3), which, like BAG2, belongs to the BAG domain protein family (Takayama and Reed, 2001), was recently identified as an HSPA2-stabilizing cochaperone in meiotic spermatocytes (Sasaki ). Similar to HSPBP1, BAG6 prevents the ubiquitylation and proteasomal targeting of HSPA2. We therefore considered the possibility that BAG6 may also act as a CHIP inhibitor in ternary BAG6/HSP70/CHIP complexes. However, we observed that BAG6 is not detectable in CHIP complexes isolated from mammalian cells, and BAG6 binding to purified HSP70s actually blocks an association with CHIP (Huth and Höhfeld, unpublished results). This is consistent with findings from other labs that identified BAG6 as a component of a chaperone machinery distinct from CHIP-containing complexes (Mariappan ; Wang ). BAG6 seems to stabilize HSPA2 in testes by preventing CHIP binding to the chaperone. In contrast, HSPBP1 inhibits the ubiquitylation activity of CHIP in assembled chaperone/cochaperone complexes, most likely by shielding lysine residues used for ubiquitin attachment (Alberti ). A hierarchy among the degradation-regulating cochaperones is indicated by the fact that BAG6 stabilizes HSPA2 but not HSPA1 forms in testes (Sasaki ), whereas HSPBP1 exerts a broader stabilizing function by preventing the degradation of HSPA2 and HSPA1L. Such differential effects could underlie a posttranslational fine tuning of the cellular chaperone repertoire.

HSPBP1-mediated stabilization of inducible HSP70s is not restricted to spermatocytes. In HeLa cells and MEFs, siRNA-triggered depletion of HSPBP1 caused the proteasomal degradation of inducible HSP70s (Figure 7). Of note, HeLa cells contain yet another degradation-regulating cochaperone, namely BAG2. It shares with HSPBP1 the ability to inhibit CHIP in assembled chaperone/cochaperone complexes (Figure 7; Arndt ; Dai ). Depletion of BAG2 also led to destabilization of HSPA1L and HSPA2, and the most pronounced effect on chaperone stability was observed when both cochaperones were simultaneously depleted (Figure 6). It seems that HSPBP1 and BAG2 jointly regulate the abundance of inducible HSP70s by inhibiting CHIP-mediated proteasomal targeting. Indeed, both cochaperones were detectable in brain homogenates from mice, and BAG2 expression was increased in HSPBP1− brains, most likely as a compensatory mechanism (Figure 6). On the other hand, BAG2 was not detectable in testes, which is consistent with the observed testes-specific phenotype of HSPBP1− mice. Although BAG2 could compensate for the loss of HSPBP1 in other tissues, it cannot do so in testes because it is not expressed there, thus making the male reproductive organ particularly prone to HSPBP1 ablation.

We previously observed that HSPBP1− mice show increased ubiquitylation and aggregation of antigens in bone marrow–derived dendritic cells, which is dependent on CHIP (Kettern ). The immune cells apparently also rely primarily on HSPBP1 for restricting CHIP-induced protein degradation. The effect on inducible chaperone expression in dendritic cells remains to be explored.

It is striking that HSPBP1 ablation affects inducible HSP70s but not constitutively expressed HSPA8 (Figure 6). However, this is consistent with previous observations that CHIP triggers the proteasomal degradation of inducible HSPA1A/B, whereas HSPA8 becomes also ubiquitylated by CHIP, but is not degraded by the proteasome (Figure 7B; Jiang ; Qian ). Accordingly, loss of HSPBP1 activity would be without consequence with regard to HSPA8 stability. The reason for this differential effect of CHIP on chaperone stability is elusive. It is conceivable that differences in the ubiquitylation pattern or the intrinsic folding propensity of the chaperone proteins affect their processing and unfolding at the proteasome, which is a prerequisite for the threading of substrates into the catalytic proteasomal core.

Is the differential treatment of constitutively and inducible HSP70 functionally important? HSPA1A, HSPA1B, and HSPA2, but not HSPA8, are overexpressed in many tumor cells and display strong antiapoptotic activity (Nylandsted , 2004; Ravagnan ; Rohde ; Daugaard ). It is striking that some tumor cells are strictly dependent on HSPA2, and selective depletion of HSPA2 in these cells induces a caspase-independent cell death pathway that involves lysosome permeabilization (Daugaard ). The same process might contribute to spermatocyte apoptosis observed here upon HSPA2 depletion in HSPBP1− testis. In any case, our findings illustrate that the transcriptional induction of HSP70 expression during meiosis needs to be accompanied by cochaperone-mediated stabilization of HSP70 proteins in order to achieve sufficient chaperone buffering to ensure the survival of spermatocytes, which are, like tumor cells, dependent on high chaperone levels. The degradation-regulating cochaperone network may thus emerge as a promising therapeutic target in male infertility and cancer.

MATERIALS AND METHODS

Animal studies

Animal husbandry and all animal experimentation were carried out in compliance with German laws. Approval was obtained from the appropriate state and federal authorities (approval number: 9.93.2.10.31.07.247).

Generation of mutant mouse lines and genotyping

For inactivation of the HSPBP1 locus, the targeting vector was constructed from a 129/ola mouse genomic library and designed to replace the first two exons of the HSPBP1 gene, including the promoter region by the mouse hypoxanthine-phosphoribosyl-transferase (HPRT) minigene. The minigene was flanked by sequences homologous to the HSPBP1 gene locus (short arm of homology, 1.4 kb; long arm of homology, 5 kb). The construct was cloned into a Bluescript II SK vector (Stratagene, Heidelberg, Germany) and electroporated into HM-1 ES cells (Magin ). Successful recombination was verified by Southern blotting, in which genomic DNA was digested with EcoRI and analyzed with Southern probes binding to a region flanking the deletion cassette insertion locus. Resulting positive ES cell clones were injected into C57/BL6/J blastocysts and transferred into C57/BL6/J mice. After successful germ line transmission, mice were maintained by breeding with C57/BL6/J. For genotyping, DNA was isolated from tail biopsies using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). Primers annealing to exons 2 and 3 of the HSPBP1 locus were designed for the detection of wild-type loci, and primers targeting exon 2 and the deletion cassette were used to identify HSPBP1− mice.

Primers used for genotyping were as follows:

Exon 2 forward (+/+ and −/−): ACCTGCATTTACAGGCATCTG

Exon 3 reverse (+/+ only): CTTTGTCTGCCATGGACTTTC

Deletion cassette reverse (−/− only): AGCCTACCCTCTGGTAGATTG

Preparation and analysis of mouse tissues

For analysis of protein expression in different mouse tissues, respective organs from wild-type and HSPBP1− mice were dissected and shock-frosted in liquid nitrogen. Frozen samples were homogenized using a Potter tissue grinder and subsequently resolved in preheated SDS sample buffer (60°C) to a concentration of 100 mg/ml. Samples were boiled at 92°C for 10 min and centrifuged at 30,000 × g for 15 min for the removal of insoluble components. Resulting supernatants were analyzed by SDS–PAGE and Western blotting. The following primary antibodies were used: mouse anti-HSPBP1 (H98620; BD Biosciences, San Jose, CA), rabbit anti-HSPBP1 (FL-4; Delta Biolabs, Gilroy, CA), rabbit anti-HSPA2 (HPA000798; Atlas Antibodies, Stockholm, Sweden), rabbit anti-HSC70 (kindly provided by Ulrich Hartl, MPI for Biochemistry, Martinsried, Germany), mouse anti-HSC/HSP70 (SPA822; Enzo Life Sciences, Farmingdale, NY), rabbit anti-HSP70/HSPA1L (SPA812; Enzo Life Sciences), mouse anti-HSP90 (F-8; Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti-BAG2 (ab47106; Abcam, Cambridge, MA), mouse anti-FLAG (M2; Sigma-Aldrich, St. Louis, MO), and mouse anti-tubulin (T5326; Sigma-Aldrich).

To analyze transcript levels, RNA from testes was isolated by first homogenizing shock-frosted organ samples in TRIzol (Life Technologies, Carlsbad, CA) using TissueLyser LT (Qiagen) with the addition of steel beads (4 or 7 mm). Vertical shaking was performed at 50 Hz for 7 min. DNA and RNA phases were separated by adding 200 μl of chloroform/ml of TRIzol. Subsequently isopropanol was added 1:1 to precipitate RNA from the corresponding phase. RNA was sedimented by centrifugation (30,000 × g, 20 min), washed in ethanol (70%), and dissolved in water (double distilled). An additional purification step was performed using the Qiagen RNA preparation kit for the removal of DNA contaminations. RNA concentration was measured and cDNA Synthesis was performed using the SuperScript VILO cDNA synthesis Kit (Life Technologies) according to the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) was performed with probe-based TaqMan GENE Expression Assays (Life Technologies) in real-time PCR cycler Rotor-Gene 6000 (Corbett/Qiagen). All samples were measured in triplet, and 18S RNA was used as reference gene. As negative control, cDNA was replaced by Ampuwa for each probe.

Histological examination

To analyze spermatogenesis in wild-type and HSPBP1− testes, hematoxylin/eosin (h/e) stainings were performed. Dissected testes were washed in phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde/PBS overnight at 4°C. Afterward, samples were washed in PBS and embedded in paraffin. Sections of 4 μm were cut and dehydrated for storage. For h/e staining of sections, samples were rehydrated and treated with Mayer's hematoxylin solution (Microm, Walldorf, Germany) for 1 min. Subsequently, sections were washed with water and incubated in eosin G solution (0.5% in water). After additional washing steps, sections were dehydrated again and mounted in Entellan (Merck, Whitehouse Station, NJ).

Apoptosis in testes of wild-type and HSPBP1− mice was estimated by TUNEL analysis of paraffin tissue sections (4 μm) that were obtained as described. After sample rehydration, ApopTag Red InSitu Apoptosis Detection Kit (Chemicon, Temecula, CA) was used according to manufacturer's instructions.

In situ hybridization

A plasmid containing mouse HSPBP1 (GenBank: BC014758.1) in pCMV-SPORT6 (Life Technologies) was used to generate sense and antisense digoxigenin-labeled RNA probes by in vitro transcription (Roche, Nutley, NJ). We hybridized 100 ng of probe to 7-μm wax sections of Bouin's fixed adult mouse testes at 50ºC overnight as described (Best ). Bound probe was detected using alkaline phosphatase–conjugated anti-digoxigenin antibodies (Roche) and 5-bromo-4-chloro-3′-indolyphosphate/nitro blue tetrazolium substrate (Vector Labs, Burlingame, CA). Sections were counterstained with nuclear fast red. Seminiferous tubules were staged as described (Russell ).

Meiotic chromosome spreads

Chromosome spreads from adult testes were prepared essentially as described (Ollinger ). Briefly, one adult testis was homogenized and then resuspended in 1 ml of RPMI medium. One drop of cell suspension was incubated in 5 drops of 4.5% sucrose on a microscope slide for 1 h. Cells were lysed with 1 drop of 0.05% Triton X-100 for 10 min and fixed with 8 drops of fixing solution (2% paraformaldehyde, 0.02% SDS, pH 8.0) for 20 min. The slides were washed, blocked with 5% serum, 0.15% bovine serum albumin, and 0.1% Tween in PBS, and then incubated with primary antibodies, followed by secondary antibodies each for 1–2 h at room temperature. Primary antibodies were mouse anti-SYCP3 (1 μg/ml; Santa Cruz Biotechnology), rabbit anti-SYCP3 (1 μg/ml; Lifespan Biosciences, Seattle, WA), rabbit anti-SYCP1 (5 μg/ml; Abcam), rabbit anti-γH2AX (2 μg/ml; Millipore, Billerica, MA), mouse anti-MLH1 (5 μg/ml; BD Biosciences), guinea pig anti-histone H1t (1:1000 dilution; Mary Ann Handel, Jackson Laboratory, Bar Harbor, ME), and rabbit anti-RBMY (1:500 dilution; David Elliott, Newcastle University, Newcastle upon Tyne, United Kingdom). Alexa Fluor fluorescently labeled secondary antibodies were used at 1 μg/ml (Life Technologies), and DNA was stained with 2 μg/ml 4′,6-diamidino-2-phenylindole. For scoring meiotic progression and H1t-positive pachytene cells, 100 nuclei were scored from each of three wild-type and three HSPBP1− mice.

Immunoprecipitation of HSPBP1 complexes from testes

To characterize endogenous interaction between HSPBP1 and HSPA2, testes from wild-type and HSPBP1− mice were prepared as described and suspended in RIPA buffer (25 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.5% sodium deoxycholate, 1% Nonidet P-40, 10% glycerol, and 1× Complete Protease Inhibitor [Roche]). After 20 min of incubation, samples were centrifuged (30,000 × g, 30 min, 4°C), and protein concentrations were determined using Bradford reagent (Bio-Rad, Hercules, CA). Samples were adjusted to a concentration of 8 μg/μl. A 4-μg amount of antibody (specific against HSPBP1 or immunoglobulin G as control) was added to 80 μg of protein and incubated at 4°C on a spinning wheel overnight. Afterward, 20 μl of protein G–Sepharose was added to each sample, followed by incubation for another 6 h. Protein G–Sepharose pellets were washed seven times with RIPA buffer by successive centrifugation steps (1 min, 3000 rpm). Finally, Sepharose pellets were sedimented and boiled in 20 μl of SDS sample buffer (2 min, 92°C). The resulting supernatant was analyzed by SDS–PAGE and Western blotting.

In vitro ubiquitylation of HSP70 chaperones

Purified histidine (His)-HSPA2 at a final concentration of 1 μM was incubated with purified HSP40 (0.3 μM), UBCH5b (3 μM), CHIP (1 μM), E1 enzyme (0.1 μM), and ubiquitin (2.5 μg/μl) in ubiquitylation buffer (20 mM 3-(N-morpholino)propanesulfonic acid, pH 7.2, 100 mM KCl, 10 mM dithiothreitol, 5 mM ATP, 5 mM MgCl2, 0.002% phenylmethylsulfonyl fluoride) in a final volume of 20 μl. Where indicated, purified HSPBP1 was added at a concentration of 1 or 5 μM, respectively. A sample without CHIP served as negative control. Samples were incubated for 30 min at 30°C and subsequently boiled in SDS sample buffer at 95°C for 3 min.

His-HSPA1L ubiquitylation was performed as described using HSP40 (0.06 μM), UBCH5b (0.6 μM), E1 enzyme (0.02 μM), and ubiquitin (0.5 μg/μl). The following primary antibodies were used for detection of ubiquitylated HSPA2 and HSPA1L: mouse anti-HIS-tag (MCA1396P; AbD Serotec, Raleigh, NC), rabbit anti-HSC70 (customized antibody generated by BioGenes GmbH, Berlin, Germany), and mouse anti-polyubiquitin (FK2; Biotrend, Destin, FL).

Analysis of HSP70 stability in HeLa and MEF cells

HeLa cells were transfected using jetPRIME transfection reagent (Peqlab, Wilmington, DE) according to the manufacturer's instructions. For the analysis of HSPA1L stability, cells were transfected with pCMV-Tag2B-HSPA1L for FLAG-HSPA1L expression and siRNA against HSPBP1 and/or BAG2 as indicated. Unspecific siRNA (Allstars; Qiagen) was used as negative control. Two days after transfection, HSPBP1- and BAG2-depleted cells were treated with MG132 (20 μM, 16 h) to analyze proteasomal degradation of FLAG-HSPA1L. After 3 d, cells were harvested, lysed in RIPA buffer (25 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.5% sodium deoxycholate, 1% Nonidet P-40, 0.1% SDS, 10% glycerol, 1× Complete Protease Inhibitor), and incubated for 20 min on ice. Lysates were centrifuged at 30,000 × g for 20 min at 4°C. Supernatants were collected and analyzed by SDS–PAGE and Western blotting.

For the analysis of HSPA2 stability, MEF cells were transfected as described, using pCMV-Tag2B-HSPA2 and respective siRNAs. MG132 treatment was performed after 36 h of transfection, and cells were subsequently harvested after 2 d. Lysis and Western blot analysis were performed as described.

The following primary antibodies were used: mouse anti-HSPBP1 (H98620; BD Biosciences), rabbit anti-BAG2 (ab47106; Abcam), mouse anti-FLAG (M2; Sigma-Aldrich), rabbit anti-HSPA8 (SAB2101098; Sigma-Aldrich), and mouse anti-tubulin (T5326; Sigma-Aldrich).