Literature DB >> 24884404

Molecular basis of DEL phenotype in the Chinese population.

Juan Gu, Xue-Dong Wang1, Chao-Peng Shao, Jun Wang, An-Yuan Sun, Li-Hua Huang, Zhao-Lin Pan.   

Abstract

BACKGROUND: Rh blood group system is the most complex and immunogenetic blood group system. Prevalent RHD alleles vary in different populations. We conducted the present study to examine the genotype of DEL individuals and to elucidate whether novel alleles exist in the Chinese population.
METHODS: DEL phenotype was identified by a serologic adsorption-elution method. The nucleotide sequences of ten RHD exons and exon-intron boundary regions were evaluated by RHD gene-specific PCR-SSP and sequencing.
RESULTS: Of 42306 samples from individual donors and patients, 165 samples were typed as D-negative. Among these D-negative samples, 41 DEL individuals were observed. Thirty-seven DELs were confirmed to have the RHD1227A allele. Two DELs seemed to have RHD-CE-D hybrid alleles, including one RHD-CE (4-7)-D and one RHD-CE (2-5)-D. Two novel RHD alleles were found among the rest of the DEL samples, including one RHD93T > A and one RHD838G > A.
CONCLUSION: In this study, about 24.85% (41/165) of the apparent D-negative Chinese individuals were DEL. RHD1227G > A is the most frequent allele in Chinese DEL phenotypes, accounting for 90.24% (37/41). The RHD-CE-D hybrid allele might be the second most frequent DEL allele in the Chinese population. Our study would contribute to the understanding of the molecular mechanism underlying D antigen expression of DEL individuals and provide useful information for designing suitable genotyping strategies in RhD-negative individuals in Asia.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24884404      PMCID: PMC4024116          DOI: 10.1186/1471-2350-15-54

Source DB:  PubMed          Journal:  BMC Med Genet        ISSN: 1471-2350            Impact factor:   2.103


Background

The Rh blood group system is the most complex and immunogenetic blood group system. The Rh antigens are encoded by a pair of homologous genes, RHD and RHCE, which are located on chromosome 1p34.3-36.1. The two genes have opposite orientations at the RH locus, each gene has 10 exons and their sequences are highly homologous. RHD encodes the D polypeptide, while RHCE gives rise to the C/c and E/e polymorphisms. The RHD gene is flanked by an upstream Rh box (at its 5′ end) and a downstream Rh box (at its 3′ end). Both Rh boxes have a length of ≈ 9000 bp in identical orientation and share 98.6% homology. The region (breakpoint region) in which the RHD deletion occurs is located within a stretch of 1463 bp in which both Rh boxes have an identical sequence (identity region). The hybrid Rh box, only present when the RHD gene is deleted via the proposed mechanism of unequal crossing over, contains a sequence identical to that of the upstream Rh box in the 5′ part preceding the identity region, and the 3′ part following the identity region is identical to the downstream Rh box sequence in European people [1]. Studies of the blood group system have shown that racial differences exist not only in the genetic background of the RHD gene but also in the frequencies of the RHD allele [2-5]. About 15% of European people are D-negative phenotype and are mostly associated with the deletion of RHD between the upstream and the downstream Rhesus boxes. Interestingly, several studies, however, have revealed that there has been the presence of the RHD gene in the majority of D-negative Africans and about a quarter of D-negative Africans have an inactive RHD gene of pseudogene (RHDψ) with a 37 base pair (bp) insertion and a nonsense mutation [6]. In the Asian population, RHDψ is rare, and a certain percentage of RhD-negative individuals have RHD-CE-DS hybrid gene or RHD1227A allele. In contrast to the European population, the RhD-negative blood type only occurs in 0.3-0.5% of the Chinese population; [7] however, nearly 30% of the RhD-negative individuals belong to the DEL phenotype, which is a rare variant of the Rh system with a grossly intact RHD gene, of which one is the 1227G > A mutation that probably disrupts normal intron splicing. In the European population, the frequency of DEL phenotype was 1:3030 and that of RHD1227A allele was 1:9091 [8]. DEL phenotypes derive from several mechanisms. Previous studies showed that DEL phenotype was associated with either a long deletion of RHD gene from intron 8 to intron 9, including whole exon 9, or a missense mutation (RHD1227G > A) in exon 9, or splice-site mutation, including RHD (IVS3 + 1G > A), or a frameshift mutation, including RHD (X418 L) or a mutation in the coding region, or premature stop codons [8-13]. Those studies indicate the D-negative trait may be generated by multiple molecular mechanisms. DEL is the most frequent D variant phenotype in the RhD-negative Chinese population that is confirmed by the adsorption-elute test. Moreover, previous studies through genomic DNA analysis showed that the RHD1227 allele is the prevalent causal mutation for DEL individuals in China. Those individuals possess one or two of these alleles with Ccee or CCee phenotypes. Whether there are other DEL alleles in the Chinese population is not yet resolved. The aim of this study was therefore to collect large numbers of blood samples to explore the molecular basis of DEL in the Chinese population.

Methods

Blood samples

EDTA-anticoagulated peripheral blood samples were collected from outpatients, inpatient and blood donors at the Anhui Provincial Hospital, the Affiliated Hospital of Anhui Medical University, the Clinical College of Nanjing Medical University, the Affiliated Hospital of Gulin Medical College, the Shaoxing People’s Hospital of Zhejiang Province, the 4th Affiliated Hospital of Jiangsu University, Blood Center of Anhui Province, Shenzhen Blood Center of Guangdong Province and Wuxi Blood Center of Jiangsu Province in the southeast China. This study was approved by the institutional Ethics Review Board of Nanjing Medical University and all subjects provided written informed consent to their participation in it.

Serological studies

Rh blood type phenotype D status was determined by a microplate technique with IgM monoclonal anti-D reagent (Immucor, Norcross, GA; Gamma Biologicals, Houston, TX) [14]. Subsequently, the Rh C/c and E/e antigens were determined by using agglutinating monoclonal anti-C (Novaclone, Dominion Biologicals, Dartmouth, Canada), anti-E (Gamma Biologicals), anti-c (Immucor) and anti-e reagents (Immucor). All samples that were negative with anti-D in the direct agglutination were retested by using the indirect anti-human globulin test (IAT). The indirect anti-human globulin test was used to detect weak D or partial D phenotype. Furthermore, samples typed as D-negative by the IAT were retested for the DEL phenotype through an adsorption-elution test in tubes. If the result was positive (≥1+), the sample was determined to belong to the DEL phenotype. If the result was negative, the sample was determined to be truly RhD-negative phenotype.

Molecular studies

Genomic DNA extraction

Genomic DNA of DEL samples was prepared using QIAamp DNA Blood Mini Kit according to the manufacturer's recommendations (Qiagen, Valencia, CA, USA). The column-bound circulatory DNA was eluted in distilled water and quantified by using a spectrophotometer (NanoDrop 2000c, Thermo Scientific, Wilmington, DE, USA).

Amplification of RHD exons

Primers for RHD exons 1 to 10 were given in Table  1. β-actin gene was used as an internal control. Amplification was carried out in a thermal cycler (Veriti 96, Applied Biosystems, Foster City, CA). Cycling conditions for RHD exon 1 and 10 were denatured at 95°C for 5 min, then 40 cycles of 30s at 94°C, annealing time was 40 seconds at 64°C (exon 2–4, 6, 8), 62°C (exon 1, 7, 9, 10, RHD1227A) and 60°C (exon 5), and extension for 1 min at 72°C. The final extension was at 72°C for 10 minutes. PCR products were visualized by electrophoresis on a 1.5% agarose gel with ethidium bromide staining and these were photographed under UV light.
Table 1

Primers used for PCR analysis and DNA sequencing

Primer name*Sequence 5′ to 3′Location # SpecificityProduct size (bp)
E1-s
ATGCCTGGTGCTGGTGGA
promoter, -43 to -26
RHD/CE
228
E1-a
ATTTGCTCCTGTGACCACTT
intron 1, 37 to 18
RHD
E1-seq
ATGCCTGGTGCTGGTGGA
 
 
 
E2-s
TGACGAGTGAAACTCTATCTCGAT
intron 1, -1064 to -1041
RHD
1475
E2-a
GGATTCCTTGTGATACACGGAGTAG
intron 2, 224 to 200
RHD
E2-seq
TGACGAGTGAAACTCTATCTCGAT
 
 
 
E3-s
GTCGTCCTGGCTCTCCCTCTCT
intron 2, -29 to -8
RHD
219
E3-a
CTTTTCTCCCAGGTCCCTCCT
intron 3, 39 to 19
RHD/CE
E3-seq
GTCGTCCTGGCTCTCCCTCTCT
 
 
 
E4-s
GCCGACACTCACTGCTCTTAC
intron 3, -36 to -16
RHD/CE
378
E4-a
TGAACCTGCTCTGTGAAGTGC
intron 4, 194 to 174
RHD
E4-seq
GCCGACACTCACTGCTCTTAC
 
 
 
E5-s
TACCTTTGAATTAAGCACTTCACAG
intron 4, -267 to -233
RHD
1458
E5-a
TTATTGGCTACTTGGTGCC
intron 5, 1024 to 1006
RHD
E5-seq
TACCTTTGAATTAAGCACTTCACAG
 
 
 
E6-s
CAGGGTTGCCTTGTTCCCA
intron 5, -95 to -77
RHD/CE
274
E6-a
CTTCAGCCAAAGCAGAGGAGG
intron 6, 41 to 21
RHD
E6-seq
CAGGGTTGCCTTGTTCCCA
 
 
 
E7-s
TGCCCATCCCCCTTTGGTGGCC
intron 6, -106 to -85
RHD
411
E7-a
CCAAGGTAGGGGCTGGACAG
intron 7, 171 to 152
RHD
E7-seq
TGCCCATCCCCCTTTGGTGGCC
 
 
 
E8-s
GGTCAGGAGTTCGAGATCAC
intron 7, -594 to -575
RHD
709
E8-a
TGGCAATGGTGGAAGAAAG
intron 8, 35 to 16
RHD/CE
E8-seq
GGTCAGGAGTTCGAGATCAC
 
 
 
E9-s
CTGTCGTTTTGACACACAATATTTC
intron 8, -91 to -67
RHD
190
E9-a
CACGTTAATAGGTGAAAAATCTTACC
intron 9, 25 to exon 9, 1227
RHD
E9-seq
CTGTCGTTTTGACACACAATATTTC
 
 
 
E10-s
CAAGAGATCAAGCCAAAATCAGT
intron 9, -67 to -45
RHD/CE
382
E10-a
AGCTTACTGGATGACCACCA
3’UTR, 291 to 272
RHD
E10-seq
CAAGAGATCAAGCCAAAATCAGT
 
 
 
RHD1227A-s
GATGACCAAGTTTTCTGGAAA
exon 9, 1207 to 1227
RHD1227A
109
RHD1227A-a
CATAAACAGCAAGTCAACATATATACT
intron9, 88 to 62
RHD
RHD1227A-seq
GATGACCAAGTTTTCTGGAAA
 
 
 
β-actin-s
GGAAATCGTGCGTGACATT

 
473
β-actin-aCGTCATACTCCTGCTTGCTG 

*s = sense primer; a = antisense primer. seq = sequencing primer.

#The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons or relative to their adjacent exon-intron boundaries for all other primers.

Primers used for PCR analysis and DNA sequencing *s = sense primer; a = antisense primer. seq = sequencing primer. #The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons or relative to their adjacent exon-intron boundaries for all other primers.

PCR-restriction fragment length polymorphism (PCR-RFLP) for RHD zygosity determination

The PCR amplification was performed by using the expand high-fidelity PCR system with primers rez7 (consensus, 5′ of the Rh box identity region) and rnb31 (specific for downstream of the Rh box, 3′ of the Rh box identity region) [1]. PCR products were digested with PstI at 37°C for 3 h, and the fragments were resolved by electrophoresis on a 1.5% agarose gel with ethidium bromide staining and these were photographed under UV light.

Purification and sequencing

Amplified DNA products were purified using an isolation kit (NucleoSpin Extract II, Macherey-Nagel, Düren, Germany) and sequenced on a genetic analyzer by DNA technology (ABI 3130 XL, Applied Biosystems, Aarhus, Denmark). The complete RHD exons 1 to 10 including adjacent intron regions were sequenced from PCR products with cycle-sequencing kits (BigDye-terminators v.1.1; Applied Biosystems, Weiterstadt, Germany) and Sequence determination of amplicons was performed on both strands using the respective PCR primers with an ABI PRISM 3730 automated sequencer (Applied Biosystems, Foster City, USA). The nucleotide and deduced amino acid sequences were analyzed and compared with the published sequences using computer software (Lasergene 99, DNASTAR, Madison, WI) as a sequencing analysis tool. All sequenced PCR products were compared with GenBank Accession Number BN000065.

Results

Serologic studies

A total of 165 apparent D-negative samples were found among the 42306 blood donors and patients through the microplate determination. When the D-negative samples were retested by the IAT and the adsorption-elution test, a total of 41 DELs were found among these samples. In the Chinese population examined, approximately 24.58% (41/165) of the apparent D-negative individuals belong to DEL phenotypes (Table  2).
Table 2

Results of phenotype and genotype analyses of the 41 DEL samples

Sample no.Number of subjectsRhD
RhCcEe RHD zygosity* RHD allele
Micro-plateIATAdsorption/elute
13001-13030
30


+
Ccee
RHD+/RHD-
RHD1227A
13031-13033
3


+
CCee
RHD+/RHD-
RHD1227A
13034-13035
2


+
Ccee
RHD+/RHD+
RHD1227A
13036
1


+
CCEe
RHD+/RHD-
RHD1227A
13037
1


+
CcEe
RHD+/RHD-
RHD1227A
13038
1


+
Ccee
RHD+/RHD-
RHD-CE (2-5)-D
13039
1


+
Ccee
RHD+/RHD-
RHD-CE (4-7)-D
13040
1


+
Ccee
RHD+/RHD+
RHD93T>A
130411+CceeRHD+/RHD-RHD838G>A

*Presence (+) or absence (–) of the RHD gene.

Results of phenotype and genotype analyses of the 41 DEL samples *Presence (+) or absence (–) of the RHD gene.

Molecular characterization of DELs

Among the 41 DELs samples, a total of 37 samples were determined to have the RHD1227A allele by PCR-SSP analysis and sequencing (Table  2, Figures  1a and 2a), accounting for 90.24% (37/41) in the Chinese DEL individuals. All of these individuals carrying RHD1227A allele were demonstrated that the mutation is located in the splice site at the exon 9 and intron 9 junctions. The remaining four DEL samples did not have RHD1227A (Figure  1a; lines 6 to 9). Two samples seemed to have RHD-CE-D hybrid alleles. According to the PCR-SSP for the RHD gene exons 1 to 10 determination, the first sample (sample No: 13039) lacked RHD exons 4 to7, the second sample (sample No: 13038) lacked exons 2 to 5 (Figure  1b and c). The two samples were confirmed to be RHD-CE (4–7)-D and RHD-CE (2–5)-D, respectively. No mutation was found in the RHD-specific exons by sequencing.
Figure 1

Results of the PCR-SSP analysis. In all lanes, a 473-bp product was amplified as the internal positive control; M, molecular marker (2000, 1000, 750, 500, 250 and 100 bp, respectively). (a) PCR-SSP for RHD1227A allele in 9 DEL samples. Lanes 1 to 9 showed the PCR-SSP results of 9 DEL samples. Lanes 1 to 5 showed that the RHD1227A specific amplifications (band of 109 bp) were positive (Sample No.13001-13005). They were shown as representatives of 37 DEL individuals carrying RHD1227A allele. Lane 6 to 9 showed that the RHD1227A specific amplifications were negative (Sample No.13038-13041). (b) PCR-SSP for RHD-CE (4–7)-D in one DEL sample (Sample No.13039). Lanes 1 to 10 showed the PCR-SSP results of the RHD exons 1 to 10; Lanes 4 to 7 showed that the RHD specific amplifications were negative for exons 4 to 7; RHD specific amplifications were positive for exons 1 to 3 and 8 to 10. (c) PCR-SSP for RHD-CE (2–5)-D in one DEL sample (Sample No.13038); lanes 1 to 10 showed the PCR-SSP results of the RHD exons 1 to 10; Lanes 2 to 5 showed that the RHD specific amplifications were negative for exons 2 to 5; RHD specific amplifications were positive for exons 1, 6 to 10.

Figure 2

Electropherograms of DNA sequencing. (a) Sequencing analysis of the RHD1227A allele. The arrow indicates the position of nucleotide mutation between RHD exon 9 and intron 9. A representative example of 37 RHD1227A genotyped cases is shown; (b) Sequencing analysis of the RHD93T > A allele in one DEL sample (Sample No.13040). The arrow indicates the position of nucleotide mutation in RHD exon 1; (c) Sequencing analysis of the RHD838G > A allele in one DEL sample (Sample No.13041). The arrow indicates the position of nucleotide mutation in RHD exon 6.

Results of the PCR-SSP analysis. In all lanes, a 473-bp product was amplified as the internal positive control; M, molecular marker (2000, 1000, 750, 500, 250 and 100 bp, respectively). (a) PCR-SSP for RHD1227A allele in 9 DEL samples. Lanes 1 to 9 showed the PCR-SSP results of 9 DEL samples. Lanes 1 to 5 showed that the RHD1227A specific amplifications (band of 109 bp) were positive (Sample No.13001-13005). They were shown as representatives of 37 DEL individuals carrying RHD1227A allele. Lane 6 to 9 showed that the RHD1227A specific amplifications were negative (Sample No.13038-13041). (b) PCR-SSP for RHD-CE (4–7)-D in one DEL sample (Sample No.13039). Lanes 1 to 10 showed the PCR-SSP results of the RHD exons 1 to 10; Lanes 4 to 7 showed that the RHD specific amplifications were negative for exons 4 to 7; RHD specific amplifications were positive for exons 1 to 3 and 8 to 10. (c) PCR-SSP for RHD-CE (2–5)-D in one DEL sample (Sample No.13038); lanes 1 to 10 showed the PCR-SSP results of the RHD exons 1 to 10; Lanes 2 to 5 showed that the RHD specific amplifications were negative for exons 2 to 5; RHD specific amplifications were positive for exons 1, 6 to 10. Electropherograms of DNA sequencing. (a) Sequencing analysis of the RHD1227A allele. The arrow indicates the position of nucleotide mutation between RHD exon 9 and intron 9. A representative example of 37 RHD1227A genotyped cases is shown; (b) Sequencing analysis of the RHD93T > A allele in one DEL sample (Sample No.13040). The arrow indicates the position of nucleotide mutation in RHD exon 1; (c) Sequencing analysis of the RHD838G > A allele in one DEL sample (Sample No.13041). The arrow indicates the position of nucleotide mutation in RHD exon 6. Two novel RHD alleles were found in the remaining two DEL samples. One sample (sample No: 13040) was found to have a RHD93T > A mutation (Figure  2b), the other sample (sample No: 13041) had a RHD838G > A mutation (Figure  2c). Their DNA sequences were deposited under GenBank accession numbers: RHD93T > A (KJ558352 for exon 1), RHD838G > A (KJ558353 for exon 6). The RHD93T > A and RHD838G > A alleles were missense mutations, which caused F31L and A280T amino acid mutations, respectively, both of the two mutations occurred in the RhD transmembrane domain. The samples with RHD93T > A and RHD838G > A alleles belong to Ccee phenotype. The sample assigned to RHD93T > A allele was found to be RHD+/RHD + homozygote by PCR-RFLP analysis and the other sample with RHD838G > A allele was RHD+/RHD– heterozygote (Table  2).

Discussion

DEL phenotype was determined on the basis of non-agglutination by the IAT procedure and positive result by an adsorption-elution technique. Molecular studies have shown that a heterogeneous array of variant RHD allele can result in the DEL phenotype [15]. Körmöczi and colleagues suggested that the DEL phenotypes might be subdivided into two groups, partial DEL with characteristic D epitope loss caused by either RHD-CE-D hybrid genes or RHD point mutation such as carrier of RHD (IVS3 + 1G > A) affecting extracellular RhD loops and complete DEL where the majority of D epitopes are conserved such as RHD1227A [16]. According to the published data [9,17] and our results, the RHD1227A allele was the most frequent allele in the Chinese DEL individuals. In our study, two DELs seemed to have RHD-CE-D hybrid alleles, including one RHD-CE (4–7)-D and one RHD-CE (2–5)-D. The RHD-CE (4–7)-D was thought to be a DEL allele by our laboratory, while a similar hybrid RHD-CE (4–7)-D was described as D-negative [10]. Whether there were miniscule differences between these two alleles has not yet been clarified. The RHD-CE (2–5)-D was similar to the RH allele that is also called DVI type 4. Hasekura et al. have suggested that some DELs were caused by a trans effect of C on a haplotype containing a weak D allele [18]. Whether the DVI-like DEL has a similar mechanism, that the DEL was resulted from the influence of C in trans on a haplotype with a partial D allele, needs to be further analysed. The hybrid gene individuals were detected with Rh box zygosity. They were found to be RHD+/RHD– heterozygote (Table  2). These results may also be in concordance with the studies of Li et al [17]. Two samples with the novel RHD93T > A and RHD838G > A alleles showed slightly stronger positive results (2+) than other DEL samples (1+) in the adsorption-elution test. This phenomenon suggested that there might be scant differences in the D antigen between these two samples and other DELs. The possibility that these two samples might be two new kinds of weak DS could not be excluded. DEL is the weakest D positive phenotype, whether the potential danger that DEL RBCs might cause a clinical transfusion reaction cannot be completely excluded. Recipients with a truly D-negative phenotype developed anti-D after transfusion with DEL RBCs [19,20]. Recently, Richard and his colleagues found a patient with a DEL phenotype who developed anti-D [11,12]. Other members of our team have not yet reported analogous cases in the Chinese population. Shao and his colleagues found that the Asian type DEL displays the complete repertoire of RhD antigen epitopes. They suggested that people in East Asia who carry the DEL variants could safely receive blood transfusion from RhD-positive donors [21]. Our previous study also supported the biochemical observations that DEL variants express normal RhD and pose virtually no risk of inducing anti-D antibodies [22]. We also confirmed that this is an exact model test that people carrying the DEL variants can safely receive blood transfusion from RhD-positive donors. Throughout the world, the majority of DEL phenotypes are misinterpreted as D-negative owing to the limits of routine typing. For this reason, the recipient with a truly D-negative phenotype would be likely to develop into anti-D alloimmunization after transfusion with DEL RBCs. So it would be of interest to routinely screen serologically D-negative donors for the presence of the RHD gene in order to discriminate all clinically relevant RHD DEL alleles. An optimized PCR strategy that checks for RHD-specific polymorphism, supplemented by the specific detection of aberrant alleles, would be a good choice. Samples carrying RHD deletion should be correctly typed by multiple PCR utilized for RHD genotyping. Testing additional RHD exons would improve the specificity of RhD prediction. Although direct sequencing is currently the gold standard in mutation identification, it is still relatively laborious and expensive, whereas PCR-SSP as a one-step method is less expensive and less time consuming. In any case, the combined use of serologic and molecular D typing techniques may reduce the number of such transfusion incidents. All of these findings suggested that it might be important to explore the molecular basis of DEL individuals in Asia and to form molecular screening techniques to determine the DEL phenotype accurately.

Conclusion

In this study, about 24.85% (41/165) of the apparent D-negative Chinese individuals were DEL. RHD1227G > A is the most frequent allele in Chinese DEL phenotypes, accounting for 90.24% (37/41). The RHD-CE-D hybrid allele might be the second most frequent DEL allele in the Chinese population. Novel DEL alleles are still relatively rare and frequencies of occurrence are also very low. Our study would contribute to the understanding of the molecular mechanism underlying D antigen expression of DEL individuals and provide useful information for designing suitable genotyping and transfusion strategies for the RhD-negative individuals in Asia.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

Authors who obtained funding included XDW and JG; Authors who participated in conception and design were XDW, JG and CPS; Authors who carried out data analysis and interpretation included JG, AYS, JW, ZLP and LHH; Authors who drafted and finalized the manuscript were XDW, JG, and CPS. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2350/15/54/prepub
  21 in total

1.  RHD gene deletion occurred in the Rhesus box.

Authors:  F F Wagner; W A Flegel
Journal:  Blood       Date:  2000-06-15       Impact factor: 22.113

2.  Flow cytometric studies of the D antigen of various Rh phenotypes with particular reference to Du and Del.

Authors:  H Hasekura; M Ota; S Ito; Y Hasegawa; A Ichinose; H Fukushima; H Ogata
Journal:  Transfusion       Date:  1990 Mar-Apr       Impact factor: 3.157

3.  Systemic analysis and zygosity determination of the RHD gene in a D-negative Chinese Han population reveals a novel D-negative RHD gene.

Authors:  Q Xu; X Qun; M G H M Grootkerk-Tax; P A Maaskant-van Wijk; C E van der Schoot
Journal:  Vox Sang       Date:  2005-01       Impact factor: 2.144

4.  Presence of RHD in serologically D-, C/E+ individuals: a European multicenter study.

Authors:  Christoph Gassner; Andrea Doescher; Tadeja Dovc Drnovsek; Primoz Rozman; Nicole I Eicher; Tobias J Legler; Sergey Lukin; Henk Garritsen; Thomas Kleinrath; Bernd Egger; Rainer Ehling; Günther F Körmöczi; Susanne Kilga-Nogler; Diether Schoenitzer; Eduard K Petershofen
Journal:  Transfusion       Date:  2005-04       Impact factor: 3.157

5.  Anti-D immunization by DEL red blood cells.

Authors:  Thomas Wagner; Günther F Körmöczi; Christoph Buchta; Maria Vadon; Gerhard Lanzer; Wolfgang R Mayr; Tobias J Legler
Journal:  Transfusion       Date:  2005-04       Impact factor: 3.157

6.  The presence of an RHD pseudogene containing a 37 base pair duplication and a nonsense mutation in africans with the Rh D-negative blood group phenotype.

Authors:  B K Singleton; C A Green; N D Avent; P G Martin; E Smart; A Daka; E G Narter-Olaga; L M Hawthorne; G Daniels
Journal:  Blood       Date:  2000-01-01       Impact factor: 22.113

7.  Molecular background of Rh D-positive, D-negative, D(el) and weak D phenotypes in Chinese.

Authors:  C-P Shao; J-H Maas; Y-Q Su; M Köhler; T J Legler
Journal:  Vox Sang       Date:  2002-08       Impact factor: 2.144

8.  Molecular basis of weak D in Taiwanese.

Authors:  I-L Lin; M-C Shih; M-H Hsieh; T-C Liu; S-E Chang; C-L Lin; J-G Chang
Journal:  Ann Hematol       Date:  2003-07-31       Impact factor: 3.673

9.  Molecular basis for the RhD negative phenotype in Chinese.

Authors:  Ching-Tien Peng; Mu-Chin Shih; Ta-Chih Liu; I-Ling Lin; San-Jang Jaung; Jan-Gowth Chang
Journal:  Int J Mol Med       Date:  2003-04       Impact factor: 4.101

10.  RHD positive haplotypes in D negative Europeans.

Authors:  F F Wagner; A Frohmajer; W A Flegel
Journal:  BMC Genet       Date:  2001-07-16       Impact factor: 2.797

View more
  6 in total

Review 1.  Serological weak D phenotypes: a review and guidance for interpreting the RhD blood type using the RHD genotype.

Authors:  S Gerald Sandler; Leonard N Chen; Willy A Flegel
Journal:  Br J Haematol       Date:  2017-05-16       Impact factor: 6.998

2.  DEL.

Authors:  Willy Albert Flegel; Franz Friedrich Wagner
Journal:  Blood Transfus       Date:  2020-03-17       Impact factor: 3.443

3.  It's time to phase in RHD genotyping for patients with a serologic weak D phenotype. College of American Pathologists Transfusion Medicine Resource Committee Work Group.

Authors:  S Gerald Sandler; Willy A Flegel; Connie M Westhoff; Gregory A Denomme; Meghan Delaney; Margaret A Keller; Susan T Johnson; Louis Katz; John T Queenan; Ralph R Vassallo; Clayton D Simon
Journal:  Transfusion       Date:  2014-12-01       Impact factor: 3.157

4.  DEL phenotype.

Authors:  Dong H Kwon; S G Sandler; Willy A Flegel
Journal:  Immunohematology       Date:  2017-09

5.  Proceed with care: the "uncommon" serologic weak D phenotypes.

Authors:  Willy Albert Flegel
Journal:  Blood Transfus       Date:  2021-07       Impact factor: 3.443

Review 6.  DEL in China: the D antigen among serologic RhD-negative individuals.

Authors:  Qinan Yin; Willy Albert Flegel
Journal:  J Transl Med       Date:  2021-10-20       Impact factor: 5.531

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.