Literature DB >> 24860254

Ny-1 and Ny-2 genes conferring hypersensitive response to potato virus Y (PVY) in cultivated potatoes: mapping and marker-assisted selection validation for PVY resistance in potato breeding.

Katarzyna Szajko1, Danuta Strzelczyk-Żyta1, Waldemar Marczewski1.   

Abstract

Potato virus Y (PVY) is one of the most important viruses affecting potato (Solanum tuberosum) production. In this study, a novel hypersensitive response (HR) gene, Ny-2, conferring resistance to PVY was mapped on potato chromosome XI in cultivar Romula. In cultivars Albatros and Sekwana, the Ny-1 gene was mapped on chromosome IX. In cv. Romula, the local lesions appeared in leaves inoculated with the PVYN-Wi isolate at 20 and 28 °C; PVY systemic infections were only occasionally observed at the higher temperature. In cvs. Albatros and Sekwana, expression of the necrotic reaction to virus infection was temperature-dependent. PVYN-Wi was localized at 20 °C; at 28 °C, the systemic, symptomless infection was observed. We developed the B11.61600 marker co-segregating with Ny-2 and the S1d11 marker specific for the Ny-1 gene. Fifty potato cultivars were tested with markers B11.6 and S1d11 and marker SC895 linked to the Ny-1 gene in cv. Rywal. These results indicated the utility of these markers for marker-assisted selection of HR-like PVY resistance in potato breeding programs.

Entities:  

Keywords:  Hypersensitivity; Mapping; Marker-assisted selection; PVY; Potato cultivars

Year:  2014        PMID: 24860254      PMCID: PMC4030098          DOI: 10.1007/s11032-014-0024-4

Source DB:  PubMed          Journal:  Mol Breed        ISSN: 1380-3743            Impact factor:   2.589


Potato virus Y (PVY) is the most harmful virus infecting potato crops (Valkonen 2007). In potato cultivars, Ry genes confer extreme resistance (ER) to all PVY strains. Plants expressing ER typically remain symptomless, with extremely low viral accumulation in inoculated leaves (Valkonen et al. 1996; Hämäläinen et al. 1998). Three genes that confer ER resistance were identified in potato: the Ry gene (also designated as Ry-f ) derived from S. stoloniferum on potato chromosome XII (Flis et al. 2005; Song et al. 2005); the Ry gene from S. tuberosum ssp. andigena on chromosome XI (Hämäläinen et al. 1997), and Ry from S. chacoense on chromosome IX (Sato et al. 2006). The hypersensitive response (HR) is another potato defense mechanism against PVY (Valkonen et al. 1996). The typical HR involves effective pathogen restriction in infected cells, which is associated with necrotic lesion generation at infection sites (Kang et al. 2005). Studies have shown that HR is responsible for limiting pathogen spread, which has the potential to result in systemic necrosis development (Valkonen et al. 1996). Rywal is the first potato cultivar in which temperature-dependent HR expression against PVYO and PVYN strains was detected. The Ny-1 gene was mapped on potato chromosome IX (Szajko et al. 2008). Here we report mapping of HR-like genes conferring resistance to PVY in potato cultivars Albatros, Sekwana, and Romula, and the development of PCR markers useful for marker-assisted selection in potato breeding programs. Three potato cultivars, Albatros, Romula and Sekwana, were evaluated for resistance to the isolate PVYN-Wi (accession number Z70238). The PVYN-Wi status was verified using the protocol reported by Lorenzen et al. (2006). Potato plants were grown for 2 weeks under greenhouse conditions, and transferred 1 week prior to infection experiments to growth chambers under controlled environmental conditions (20 or 28 °C, 16 h light at 100 mol/s/m2, 8 h dark). For each cultivar, six plants were mechanically inoculated with a sap extracted from the tobacco plants that were infected with PVYN-Wi. Inoculated potato plants were divided into two groups; one group was incubated at 20 °C, the other at 28 °C. Water-treated detached leaves and plants were used as negative controls. Samsun tobacco plants inoculated with PVYN-Wi were used as positive controls. Hypersensitivity was visualized after 4–6 days. Nine days following inoculation, 1 g of inoculated and non-inoculated upper leaf samples from each of the plants was collected to detect the virus by RT-PCR, which was performed as described by Szajko et al. (2008) with minor modifications. In addition, ELISA tests were performed on inoculated and upper leaves 3 weeks post-inoculation at 20 °C. PVY monoclonal cocktail Bioreba AG kit (Reinach, Switzerland) was used. Experiments were repeated three times with similar results. At 20 °C, cvs. Albatros and Sekwana exhibited a hypersensitive response to PVYN-Wi infection in inoculated leaves. The virus was not detected in the upper, non-inoculated leaves. At 28 °C, systemic symptomless infections were observed. In cv. Romula, the local necrotic lesions appeared at 20 and 28 °C. Occasionally, HR failed to restrict PVY progression to upper, non-inoculated leaves of cv. Romula grown at 28 °C. Albatros (A) and Sekwana (Se) were crossed with the PVY-susceptible Dutch cultivar Accent (Ac) to obtain mapping populations A × Ac and Se × Ac with 42 and 58 F1 individuals, respectively. A segregating F1 population R × F was established consisting of 52 individuals derived from a cross between cv. Romula (R) and Polish cultivar Felka (F). Two tuber-derived plants per each F1 individual clone representing populations A × Ac, Se × Ac, and R × F were screened for HR to PVYN-Wi infection at 20 °C. Plants which developed necrotic symptoms 6 days post-inoculation were classified as resistant. The following ratios of resistant to susceptible plants were detected: A × Ac − 24:18, Se × Ac − 30:28, and R × F − 24:28. The segregation ratios of 1:1 (χ2 = 0.85, P = 0.35; χ2 = 0.07, P = 0.79; and χ2 = 0.31, P = 0.58, respectively) confirmed the presence of single, dominant genes for HR to PVY in simplex states in all three resistant cultivars. Five markers, S1d11, GP129, U38666, ShkB, and Nl27, were amplified in 20 μl of 20 mM TrisHCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 0.1 mM of each dNTP, 0.2 μM of each primer, 1 U Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), and 30 ng genomic DNA. MgCl2 concentration was increased to 3 mM for amplification of three markers: U276927, TG186, and TG591. In addition, 1 U of DreamTaq™ DNA polymerase and 1× buffer containing 2 mM MgCl2 (Fermentas, Vilnius, Lithuania) were used for marker B11.6. The following PCR parameters were employed: initial denaturation at 94 °C for 60 s followed by 40 cycles of denaturation at 93 °C for 25 s, annealing at 54 − 62 °C for 35 s (Table 1), and extension at 72 °C for 90 s, with a final extension at 72 °C for 5 min. The sequence characterized amplified region (SCAR) marker SC895 (NCBI GenBank accession EF555209) was amplified as described by Szajko et al. (2008). The At3g24050 (SGN U270244) marker was co-amplified with SC895 as an internal PCR control. At3g24050 primers comprised forward: 5′-CCTCTGGGGCCGAAAACACT-3′ and reverse: 5′-TCCATCACGAGCGAACACCAC-3′.
Table 1

CAPS markers used in genetic linkage maps

Chromosome no.Marker nameAccession no.Primer sequence (5′–3′) T a (°C)Amplicon size (bp)Restriction enzymeMarker size (s) (bp)
IXS1d11AJ489115

f: GCCAAAAAGGGTAGGAAAAATG

r: TCATCTTCACGAATCGGACTAAA

54400 MnlI390
TG591SGN-M462

f: TCCAATCCGATGACCTCTG

r: AGCTGCAAATCTACTCGTG

54450 XapIa 260
HaeIIIb 310
GP129AJ487342

f: GTGGTAGCAAAGTATTCATC

r: CGTTATCTGGACTCCTTTAG

54500 XapI500
U38666SGN-U38666

f: AGCTGCCGTGTCCTGTATCA

r: ACTCATGTTCACGCCACTTTCTTA

56600 DdeI550,600
U276927SGN-U276927

f: GCATTAGCGCAATTGGAATCCC

r: GGAGAGCATTAGTACAGCGTC

541,250 DdeI430
TG186SGN-M561

f: AACGGTGTACGAGATTTTAC

r: ACCTACATAGATGAACCTCC

54600 AluI490
XIShkBM95201

f: CATCTTCTCCATAACCCTTTACC

r: GCTCACAGTTCTCCACAAAATC

561,100 NlaIII1,000
Nl27AJ009720

f: CGGGAGTAGGCAAAACGACAATAGCAA

r: ACTCAATCCTATATCAGCTCCAAAATCACAG

62750 HinfI310
B11.6AC238172

f: ATAGCTTCAGGTCGGGAGATTTGT

r: GATTGGGCTGCTGCTGTGG

601,800 EcoRI1,600

f forward, r reverse

aUsed for mapping of Ny-1 in cv. Albatros

bUsed for mapping of Ny-1 in cv. Sekwana

CAPS markers used in genetic linkage maps f: GCCAAAAAGGGTAGGAAAAATG r: TCATCTTCACGAATCGGACTAAA f: TCCAATCCGATGACCTCTG r: AGCTGCAAATCTACTCGTG f: GTGGTAGCAAAGTATTCATC r: CGTTATCTGGACTCCTTTAG f: AGCTGCCGTGTCCTGTATCA r: ACTCATGTTCACGCCACTTTCTTA f: GCATTAGCGCAATTGGAATCCC r: GGAGAGCATTAGTACAGCGTC f: AACGGTGTACGAGATTTTAC r: ACCTACATAGATGAACCTCC f: CATCTTCTCCATAACCCTTTACC r: GCTCACAGTTCTCCACAAAATC f: CGGGAGTAGGCAAAACGACAATAGCAA r: ACTCAATCCTATATCAGCTCCAAAATCACAG f: ATAGCTTCAGGTCGGGAGATTTGT r: GATTGGGCTGCTGCTGTGG f forward, r reverse aUsed for mapping of Ny-1 in cv. Albatros bUsed for mapping of Ny-1 in cv. Sekwana Nine cleaved amplified polymorphic sequence (CAPS) markers were employed for mapping (Table 1). Four markers, TG591, S1d11, U38666, and TG186, exhibited utility in mapping the HR gene on potato chromosome IX in cv. Albatros. TG591 and S1d11, as well as GP129 and U276927, confirmed the presence of the HR gene in the same region of chromosome IX in cv. Sekwana (Fig. 1). The infection symptoms and the map positions of the PVY resistance loci in these cultivars were similar to those described for the Ny-1 gene in cv. Rywal (Szajko et al. 2008). The HR genes in cvs. Albatros and Sekwana were therefore designated Ny-1. However, further molecular studies are necessary to determine whether Ny-1 in cvs. Albatros, Rywal, and Sekwana reside at the same resistance locus, or whether these cultivars carry PVY resistance genes located at different loci on potato chromosome IX. Three DNA markers, Nl27, ShkB, and B11.6, were useful for mapping the HR-like gene Ny-2 for PVY resistance on chromosome XI in cv. Romula (Fig. 1), in a resistance hotspot containing genes for qualitative and quantitative resistance to pathogens. The Ry gene for ER to PVY has been previously mapped to this chromosome region (Hämäläinen et al. 1997). However, the diagnostic marker RYSC3 for the Ry gene (Kasai et al. 2000) was not amplified in cv. Romula.
Fig. 1

Positions of the loci Ny-1 on chromosome IX in cvs. Albatros and Sekwana and Ny-2 on chromosome XI cv. Romula. Genetic distances in cM are shown on the left. The map distances were calculated from recombination frequencies between DNA markers and resistance loci

Positions of the loci Ny-1 on chromosome IX in cvs. Albatros and Sekwana and Ny-2 on chromosome XI cv. Romula. Genetic distances in cM are shown on the left. The map distances were calculated from recombination frequencies between DNA markers and resistance loci Fifty potato cultivars (Table 2), bred in Poland, Germany, and The Netherlands, were tested for the presence of the SCAR marker SC895 and two CAPS markers, S1d11 and B11.6. Markers TG591 and Nl27 were not informative. Pedigree information (available for most cvs. at http://www.plantbreeding.wur.nl/potatopedigree/) shows that these cultivars represent various potato genetic backgrounds. They were classified into three groups: ER (extreme resistance to PVY), HR (hypersensitive), and S (susceptible). DNA of seven ER German cultivars (Assia, Barbara, Esta, Heidrun, Pirola, Ute, and Wega) were received from the Max Planck Institute for Plant Breeding Research, courtesy of Dr. C. Gebhardt. The remaining 43 were classified for PVY resistance at Młochów as previously described (Flis et al. 2005; Witek et al. 2006; Szajko et al. 2008; Valkonen et al. 2008). SC895, S1d11, and B11.6 were not detected in the sixteen cvs. susceptible to PVY and eighteen cvs. that expressed ER to PVY. In cvs. Mors and Syrena, which were also negative for all three markers, recombination events or the presence of another source of HR against PVY might be possible. SC895 was specific only to cv. Rywal. Therefore, this marker has potent utility for PVY resistance selection in progeny originated from the Rywal-derived source. The possibility that Ny-1 and Ny-2 genes are involved in resistance to PVY in the corresponding cvs. Koga, Neptun, Niagara, and Korona should be supported by additional genetic studies. Detection of the B11.6 marker in six cvs. from the ER group might be explained by epistatic expression of the Ry gene over Ny genes, where both types of PVY resistance genes are present in these cultivars, but the hypersensitive response is not induced. In diploid potato, this interaction type was exhibited between the PVY resistance genes Ry and Ny (Valkonen et al. 1994).
Table 2

Distribution of markers SC895, S1d11, and B11.6 in potato cultivars

Response to PVYPotato cultivarPresence of markers
SC895S1d11B11.6
HRRywal+
Albatros, Koga, Neptun, Niagara, Sekwana+
Korona, Romula+
Mors, Syrena
ERGabi, Jasia, Maryna, Santé, Ślęza, Sonda+
Ania, Assia, Baszta, Beata, Barbara, Danusia, Dunajec, Esta, Fregata, Heidrun, Hinga, Kuba, Nimfy, Pirola, Umiak, Ursus, Ute, Wega
SAccent, Balbina, Delikat, Drop, Felka, Grot, Karatop, Karlena, Oda, Orłan, Pirol, Tara, Tokaj, Triada, Wawrzyn, Wolfram

HR hypersensitive response, ER extreme resistance, S susceptible, + presence of marker; − absence of marker

Distribution of markers SC895, S1d11, and B11.6 in potato cultivars HR hypersensitive response, ER extreme resistance, S susceptible, + presence of marker; − absence of marker In cultivated potato, a cross between a clone possessing two resistance alleles and a susceptible clone, or between two simplex resistant parents, resulted in a large percentage of resistant clones in F1 generations (Solomon-Blackburn and Mackay 1993). The PCR-based markers developed in this study might facilitate the production of PVY-resistant tetraploid potato clones with double HR gene doses, or the combination of HR and ER resistance factors, thereby improving breeding efficiency for PVY resistance in cultivated potato.
  5 in total

1.  Development of SCAR markers to the PVY resistance gene Ryadg based on a common feature of plant disease resistance genes.

Authors:  K Kasai; Y Morikawa; V A Sorri; J P Valkonen; C Gebhardt; K N Watanabe
Journal:  Genome       Date:  2000-02       Impact factor: 2.166

Review 2.  Genetics of plant virus resistance.

Authors:  Byoung-Cheorl Kang; Inhwa Yeam; Molly M Jahn
Journal:  Annu Rev Phytopathol       Date:  2005       Impact factor: 13.078

3.  Mapping of extreme resistance to PVY (Ry (sto)) on chromosome XII using anther-culture-derived primary dihaploid potato lines.

Authors:  Ye-Su Song; Leonard Hepting; Günther Schweizer; Lorenz Hartl; Gerhard Wenzel; Andrea Schwarzfischer
Journal:  Theor Appl Genet       Date:  2005-10-18       Impact factor: 5.699

4.  A Multiplex PCR Assay to Characterize Potato virus Y Isolates and Identify Strain Mixtures.

Authors:  James H Lorenzen; Lisa M Piche; Neil C Gudmestad; Teresa Meacham; Pat Shiel
Journal:  Plant Dis       Date:  2006-07       Impact factor: 4.438

5.  The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance.

Authors:  K Szajko; M Chrzanowska; K Witek; D Strzelczyk-Zyta; H Zagórska; C Gebhardt; J Hennig; W Marczewski
Journal:  Theor Appl Genet       Date:  2007-11-06       Impact factor: 5.699

  5 in total
  11 in total

Review 1.  Elucidation of virus-host interactions to enhance resistance breeding for control of virus diseases in potato.

Authors:  Jari P T Valkonen
Journal:  Breed Sci       Date:  2015-03-01       Impact factor: 2.086

Review 2.  Diversity of potato genetic resources.

Authors:  Ryoko Machida-Hirano
Journal:  Breed Sci       Date:  2015-03-01       Impact factor: 2.086

Review 3.  Potato genetics, genomics, and applications.

Authors:  Kazuo Watanabe
Journal:  Breed Sci       Date:  2015-03-01       Impact factor: 2.086

4.  Graphical genotyping as a method to map Ny (o,n)sto and Gpa5 using a reference panel of tetraploid potato cultivars.

Authors:  Herman J van Eck; Peter G Vos; Jari P T Valkonen; Jan G A M L Uitdewilligen; Hellen Lensing; Nick de Vetten; Richard G F Visser
Journal:  Theor Appl Genet       Date:  2016-11-21       Impact factor: 5.699

5.  Molecular and genetic characterization of the Ryadg locus on chromosome XI from Andigena potatoes conferring extreme resistance to potato virus Y.

Authors:  María Del Rosario Herrera; Laura Jara Vidalon; Juan D Montenegro; Cinzia Riccio; Frank Guzman; Ida Bartolini; Marc Ghislain
Journal:  Theor Appl Genet       Date:  2018-05-31       Impact factor: 5.699

6.  Extreme resistance to Potato virus Y in potato carrying the Rysto gene is mediated by a TIR-NLR immune receptor.

Authors:  Marta Grech-Baran; Kamil Witek; Katarzyna Szajko; Agnieszka I Witek; Karolina Morgiewicz; Iwona Wasilewicz-Flis; Henryka Jakuczun; Waldemar Marczewski; Jonathan D G Jones; Jacek Hennig
Journal:  Plant Biotechnol J       Date:  2019-09-04       Impact factor: 9.803

Review 7.  Plant Molecular Responses to Potato Virus Y: A Continuum of Outcomes from Sensitivity and Tolerance to Resistance.

Authors:  Špela Baebler; Anna Coll; Kristina Gruden
Journal:  Viruses       Date:  2020-02-15       Impact factor: 5.048

8.  Glutathione Modulation in PVYNTN Susceptible and Resistant Potato Plant Interactions.

Authors:  Katarzyna Otulak-Kozieł; Edmund Kozieł; Włodzimierz Przewodowski; Katarzyna Ciacka; Agnieszka Przewodowska
Journal:  Int J Mol Sci       Date:  2022-03-30       Impact factor: 5.923

9.  Hypersensitive response to Potato virus Y in potato cultivar Sárpo Mira is conferred by the Ny-Smira gene located on the long arm of chromosome IX.

Authors:  Iga Tomczyńska; Florian Jupe; Ingo Hein; Waldemar Marczewski; Jadwiga Sliwka
Journal:  Mol Breed       Date:  2014-02-19       Impact factor: 2.589

10.  Mapping Loci That Control Tuber and Foliar Symptoms Caused by PVY in Autotetraploid Potato (Solanum tuberosum L.).

Authors:  Washington L da Silva; Jason Ingram; Christine A Hackett; Joseph J Coombs; David Douches; Glenn J Bryan; Walter De Jong; Stewart Gray
Journal:  G3 (Bethesda)       Date:  2017-11-06       Impact factor: 3.154

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.