Literature DB >> 24848277

Tert-butylhydroquinone alleviates early brain injury and cognitive dysfunction after experimental subarachnoid hemorrhage: role of Keap1/Nrf2/ARE pathway.

Zhong Wang1, Chengyuan Ji1, Lingyun Wu1, Jiaoxue Qiu1, Qi Li1, Zhong Shao1, Gang Chen1.   

Abstract

Tert-butylhydroquinone (tBHQ), an Nrf2 activator, has demonstrated neuroprotection against brain trauma and ischemic stroke in vivo. However, little work has been done with respect to its effect on early brain injury (EBI) after subarachnoid hemorrhage (SAH). At the same time, as an oral medication, it may have extensive clinical applications for the treatment of SAH-induced cognitive dysfunction. This study was undertaken to evaluate the influence of tBHQ on EBI, secondary deficits of learning and memory, and the Keap1/Nrf2/ARE pathway in a rat SAH model. SD rats were divided into four groups: (1) Control group (n=40); (2) SAH group (n=40); (3) SAH+vehicle group (n=40); and (4) SAH+tBHQ group (n=40). All SAH animals were subjected to injection of autologous blood into the prechiasmatic cistern once in 20 s. In SAH+tBHQ group, tBHQ was administered via oral gavage at a dose of 12.5 mg/kg at 2 h, 12 h, 24 h, and 36 h after SAH. In the first set of experiments, brain samples were extracted and evaluated 48 h after SAH. In the second set of experiments, changes in cognition and memory were investigated in a Morris water maze. Results shows that administration of tBHQ after SAH significantly ameliorated EBI-related problems, such as brain edema, blood-brain barrier (BBB) impairment, clinical behavior deficits, cortical apoptosis, and neurodegeneration. Learning deficits induced by SAH was markedly alleviated after tBHQ therapy. Treatment with tBHQ markedly up-regulated the expression of Keap1, Nrf2, HO-1, NQO1, and GSTα1 after SAH. In conclusion, the administration of tBHQ abated the development of EBI and cognitive dysfunction in this SAH model. Its action was probably mediated by activation of the Keap1/Nrf2/ARE pathway.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24848277      PMCID: PMC4029824          DOI: 10.1371/journal.pone.0097685

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Approximately 10 out of 100,000 people experience a subarachnoid hemorrhage (SAH) due to intracranial aneurysm rupture every year, worldwide [1]. Despite recent developments in microsurgical and endovascular surgical techniques, the prognosis for patients who suffer a SAH remains unsatisfactory. Early brain injury (EBI) and secondary cognitive or neurobehavioral dysfunction after SAH have been well documented, but the underlying mechanisms still remain unclear [2]. EBI is the most common cause of disability and mortality in patients suffering from SAH. Practical ways of treating EBI are a major goal in the management of SAH patients. However, the exact molecular mechanism of EBI still remains unknown, and this has hindered the development of effective and specific treatment paradigms for EBI [3]. Approximately 50% of all SAH patients die from EBI, and many of those that do survive experience lasting cognitive deficits [4]. The treatment of cognitive dysfunction has also been considered a major target in the management of patients who survive cerebral aneurysm rupture. Protective genes, whose products can reduce oxidative stress, contain a common promoter element called the antioxidant response element (ARE). Several transcription factors can bind ARE. However, the nuclear factor E2-related factor 2 (Nrf2) is responsible for activating transcription in response to oxidative stress. In the presence of numerous stimuli, Nrf2 moves from the cytoplasm to the nucleus, and sequentially binds to ARE. Nrf2 transactivates the expression of a group of cytoprotective enzymes, such as heme oxygenase-1 (HO-1), NAD(P)H: quinone oxidoreductase-1 (NQO1), and glutathione S-transferase α-1 (GST-α1) [5]. The present work is the first to report the possible role of the Nrf2-ARE pathway in the SAH model and results showed that activation of the Nrf2-ARE pathway can attenuate the development of EBI by up-regulating antioxidant and detoxifying enzymes after SAH [5]. Tert-butylhydroquinone (tBHQ), an oral Nrf2 activator, has been studied in different models of central nervous system (CNS) injury, such as brain trauma and ischemic stroke, and it has been proved to have neuroprotective effect in these models [6], [7]. Results of a previous study have shown that activation of the Nrf2 pathway may promote neurological function in SAH rats [5]. The purpose of the present work is to confirm the beneficial effect of tBHQ on EBI after SAH. Currently, it is still unknown whether tBHQ can influence cognitive outcome in stroke models. If tBHQ does attenuate the development of neurobehavioral dysfunction in oral form, the present work may provide novel ideas for the pursuit of therapeutic agents for secondary cognitive deficits and tBHQ may have extensive clinical applications for the treatment of SAH.

Materials and Methods

Ethics statement

All procedures were approved by the Institutional Animal Care Committee of Soochow University and were performed in accordance with the guidelines of the National Institutes of Health on the care and use of animals. All rats were placed under anesthesia before the fixation-perfusion and exsanguination euthanasia procedures.

Animals

Sprague-Dawley (SD) rats (300 to 350 g) were purchased from Animal Center of Chinese Academy of Sciences, Shanghai, China. The rats were housed in temperature and humidity controlled animal quarters with a 12 h light/dark cycle. All procedures were approved by the Institutional Animal Care Committee and were performed in accordance with the guidelines of the National Institutes of Health on the care and use of animals.

Rat SAH model

Rats were anesthetized with intraperitoneal urethane (1000 mg/kg). Then their heads were fixed in a stereotactic frame. An experimental SAH model was produced using stereotaxic insertion of a needle with a rounded tip and a hole in the prechiasmatic cistern, as in a previous study [5]. Then 0.3 ml non-heparinized fresh autologous arterial blood was slowly injected into the prechiasmatic cistern for 20 s with a syringe pump using aseptic technique. Control animals were injected with 0.3 ml saline. The animals were allowed to recover for 45 min after SAH. After the operation, the rats were returned to their cages and the temperature was maintained at 23±1°C. Twenty milliliters of 0.9% NaCl was injected subcutaneously immediately after the operation to prevent dehydration. The heart rate and rectal temperature were monitored, and the rectal temperature was maintained at 37±0.5°C throughout the experiments using physical cooling (ice bags) when required. It was observed in the present study that the inferior basal temporal lobe was always stained with blood.

Experimental design

We established 4 experimental groups in a randomized fashion (Fig. 1): (a) the control group (n = 40); (b) the SAH group (n = 40); (c) the SAH+vehicle group (n = 40); (d) the SAH+tBHQ group (n = 40). Rats of SAH+tBHQ group received tBHQ via oral gavage at a dose of 12.5 mg/kg at 2 h, 12 h, 24 h, and 36 h after SAH. Rats in the SAH+vehicle group received equal volumes of vehicle (saline) with the same schedule. In the first experimental setting, the animals were decapitated 48 h after SAH for tissue assays (n = 30 in each group). In the second experiment, the animals were trained and evaluated in a Morris water maze (MWM) (n = 10 in each group).
Figure 1

Experimental Design.

In the first experiment, 10 rats in each group were killed using the fixation-perfusion method. The cortex was taken for terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) and fluoro-jade B (FJB) staining method. Another 10 rats per group were exsanguinated and decollated. The brain sample was removed and rinsed in 0.9% normal saline (4°C) several times to wash away blood and blood clots. Then the tissue was immediately frozen in liquid nitrogen for molecular biological and biochemical experiments. The left 10 rats in each group for detection of blood–brain barrier (BBB) impairment (Evens blue study).

Brain water content

Brain edema was determined using the wet/dry method as previously described where % brain water  =  [(wet weight − dry weight)/wet weight] ×100% [8]. Briefly, brain samples were rapidly removed from the skull and placed into separate pre-weighed and labeled glass vials and weighed. The vials were then placed in an oven for 72 h at 100°C and then re-weighed to determine the dry weight content.

Blood-brain barrier permeability

Blood-brain barrier (BBB) permeability was determined by Evans blue (EB) extravasation 48 h after SAH. Briefly, 2% Evans blue was injected intravenously at a dose of 2 ml/kg. Animals were then re-anesthetized after 1 h with urethane (1000 mg/kg) and perfused using saline to remove intravascular EB dye. Animals were then decapitated. The brains were removed and homogenized in phosphate buffered saline. Trichloroacetic acid was then added to precipitate protein, and the samples were cooled and centrifuged. The resulting supernatant was measured for absorbance of EB at 610 nm using a spectrophotometer.

Neurologic scoring

Three behavioral activity examinations (Table 1) were performed, all of them 48 h after SAH and using the scoring system reported previously. These examinations indicated appetite, activity, and neurological deficits, respectively [9].
Table 1

Behavior and activity scores.

CategoryBehaviorScore
AppetiteFinished meal0
Left meal unfinished1
Scarcely ate2
ActivityWalked and reached at least three corners of the cage0
Walked with some stimulation1
Almost always lying down2
DeficitsNo deficits0
Unstable walk1
Impossible to walk2

TUNEL and fluoro-jade staining

Apoptosis was detected using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) according to the manufacturer's protocol (DeadEnd Flurometric kit, Promega, WI, U.S.). Slides were then counter-stained with 4′,6-diamidino-2-phenylindole (DAPI), washed, coverslipped with a water-based mounting medium, and sealed with nail polish. Fluoro-jade B (Histo-Chem Inc., Jefferson, AR, U.S.) was used as a marker of neuronal injury. Brain sections were deparaffinized and rehydrated. After incubation with deionized water for 1 min, the slides were incubated in 0.06% K permanganate (Sigma-Aldrich) for 15 min. Slides were then rinsed in deionized water and immersed in 0.001% fluoro-jade working solution (0.1% acetic acid) for 30 min. Then they were washed and dried in an incubator (50–60°C) for 10 min. Sections were cleared in xylene and coverslipped with a non-aqueous, low-fluorescence, styrene-based mounting medium (DPX, Sigma-Aldrich). Microscopy of the three stained tissue sections was performed by an experienced pathologist blinded to the experimental conditions. The number of positively stained cells in each section was counted in 10 microscope fields (at 200 magnification) throughout the identical regions of the studied brain, and the mean percentage per visual field was calculated.

Behavior testing

Spatial learning and memory were assessed using a modified version of the Morris water maze (MWM) including cued learning procedure, spatial acquisition task, reference memory task, and working memory task according to the previous study [10]. The MWM consisted of a circular pool 2 m in diameter and 0.75 m in height. It was filled with water to a depth of 0.4 m and kept at room temperature. Non-toxic blue paint was added to the water. Four equally spaced points were arbitrarily designated as north (N), south (S), east (E), and west (W) around the circumference of the pool. This established four quadrants (NW, NE, SE, and SW). The area of the pool within 20 cm of the outer wall was designated as the perimeter for the assessment of thigmotaxis. The annulus was defined as a 30 cm diameter circle surrounding the platform. A clear plexiglass platform (10 cm×10 cm) was submerged 2 cm below the water level in the middle of one of eight equally spaced arbitrary lines (N, S, E, W, NW, NE, SE, and SW). Six large unique shapes were placed on three walls to function as distal cues around the pool. A camera mounted in the center of the ceiling above the pool tracked the rat (Poly Track System, San Diego Instruments, San Diego, CA, U.S.). Behavior testing was performed between 10:00 and 18:00. All animals were housed at a constant temperature of 22°C under a 12 h light/dark cycle (light switched on at 6:00), with free access to food and water. The numbers of animals used in each group for MWM study were as follows: Control (n = 10), SAH (n = 10), SAH+vehicle (n = 10) and SAH+tBHQ (n = 10).

Western blot analysis

The frozen brain tissue was mechanically lysed in 20 mM Tris, pH 7.6 containing 0.2% SDS, 1% Triton X-100, 1% deoxycholate, 1 mM phenylmethylsulphonyl fluoride (PMSF), and 0.11 IU/ml aprotinin (all purchased from Sigma-Aldrich, Inc., St. Luis, MO, U.S.). Lysates were centrifuged at 12,000 ×g for 20 min at 4°C. The protein concentration was estimated by the Bradford method using the Nanjing Jiancheng (NJJC) protein assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The samples (60 µg per lane) were separated with 8% SDS-PAGE and electro-transferred onto a polyvinylidene-difluoride (PVDF) membrane (Bio-Rad Lab, Hercules, CA, U.S.). The membrane was blocked with 5% skim milk for 2 h at room temperature and incubated overnight at 4°C with primary antibodies directed against the Kelch-like ECH-associated protein 1 (Keap1), Nrf2, and heme oxygenase-1 (HO-1) in PBS+Tween 20 (PBST) at dilutions of 1∶200. GAPDH (diluted 1∶8000 in PBST, Sigma-Aldrich, Inc., St. Luis, MO, U.S.) was used as a loading control. After the membrane was washed six times for 10 min each in PBST, it was incubated in the appropriate HRP-conjugated secondary antibody (diluted 1∶400 in PBST) for 2 h. The blotted protein bands were visualized by enhanced chemiluminescence (ECL) Western blot detection reagents (Amersham, Arlington Heights, IL, U.S.) and then exposed to X-ray film. Developed films were digitized using an Epson Perfection 2480 scanner (Seiko Corp, Nagano, Japan). Optical densities were obtained using Glyko Bandscan software (Glyko, Novato, CA, U.S.) and the protein expression levels were normalized to GAPDH.

Nuclear protein extract and electrophoretic mobility shift assay (EMSA)

Nuclear protein was extracted and quantified as described [11]. EMSA was performed using a commercial kit (Gel Shift Assay System; Promega, Madison, WI, U.S.) in accordance with the methods standard in the laboratory in question. The Nrf2 oligonucleotide probe (5′-TTT TAT GCT GTG TCA TGG TT-3, 3′-AAA ATA CGA CAC AGT ACC AA-5′) was end-labeled with [γ-32P]ATP (Free Biotech, Beijing, China). EMSA was performed as in a previous study [11].

Immunohistochemical study

Immunohistochemistry was performed on formalin-fixed paraffin-embedded sections to determine the immunoreactivity of Keap1, Nrf2, and HO-1. Sections were deparaffinized and rehydrated in graded concentrations of ethanol to distilled water. Endogenous peroxidase activity was blocked with 3% H2O2 for 5 min, followed by a brief rinse in distilled water and a 15 min wash in PBS. Sections were placed in 10 mm citrate buffer (pH 6.0) and heated in a microwave oven at 95°C for 30 min. Sections were cooled at room temperature for 20 min and rinsed in PBS. Nonspecific protein binding was blocked by 40 min of incubation in 5% horse serum. Sections were incubated with primary antibodies (all diluted 1∶200; from Santa Cruz Biotechnology, Inc.) for 1 h at room temperature, followed by a 15 min wash in PBS. Sections were incubated with HRP-conjugated IgG (1∶500 dilution; Santa Cruz Biotechnology, Inc.) for 60 min at room temperature. DAB was used as a chromogen, and counterstaining was performed with hematoxylin. Sections incubated in the absence of primary antibody were used as negative controls. Microscopy of the immunohistochemically stained tissue sections was performed by an experienced pathologist blinded to the experimental condition. The number of positively immunostained cells in each section was counted in 10 microscope fields (at 200 magnification) throughout identical regions of the brains studied, and the mean percentage per visual field was calculated.

Quantitative real-time polymerase chain reaction

The mRNA levels of HO-1, NAD(P)H:quinoneoxidoreductase 1 (NQO1), and glutathione S-transferase-a1 (GST-a1) were determined using quantitative real-time polymerase chain reaction (PCR). Total cellular RNA was isolated from sample brain using Trizol Reagents (Invitrogen Life Technologies, Carlsbad, CA, U.S.) as per the manufacturer's instructions. RNA quality was insured using gel visualization and spectrophotometric analysis (OD260/280). The quantity of RNA was measured using the OD260. RNA was transcribed to cDNA using MMLV Reverse Transcriptase (Promega, Madison, WI, U.S.) and oligo dT primers. The primers were synthesized by ShineGene Biotechnology (Shanghai, China) and are shown in Table 2. Quantitative real-time PCR analysis was performed using the Rotor-Gene™ 3000 Real-time DNA Analysis System (Corbett Research, Sydney, Australia) using real-time SYBR Green PCR technology. The reaction mixtures contained diluted cDNA, SYBR Green I Nucleic Acid Stain (Invitrogen Life Technologies), 20 µm of each gene-specific primer, and nuclease-free water to a final volume of 25 µL. Test cDNA results were normalized to β-actin measured on the same plate. All samples were analyzed in triplicate.
Table 2

PCR primer sequences.

Target geneSense primer (5′ to 3′)Antisense primer (5′ to 3′)Annealing temperature (°C)Number of cyclesSize (bp)
NQO1 GCGTCTGGAGACTGTCTGGG CGGCTGGAATGGACTTGC 6040170
HO-1 GCGAAACAAGCAGAACCCA GCTCAGGATGAGTACCTCCCA 5840185
GST-α1 CGGTACTTGCCTGCCTTTG ATTTGTTTTGCATCCACGGG 5940248
β-actin CCCATCTATGAGGGTTACGC TTTAATGTCACGCACGATTTC 6040150

Enzyme activity assay

The frozen cortex tissue was homogenized in ice-cold 10 mM Tris-HCl (pH 7.8) and centrifuged at 12,000 g for 15 min at 48°C. The supernatant was then collected and total protein was determined as described above. NQO1 enzyme activity was determined by calculating the dicumarolsensitive fraction of 2,6-dichlorophenol-indo-phenol reduction. Reactions consisting of 30 µg/ml protein, 25 mM Tris-HCl (pH 7.4), 0.7 mg/ml crystalline bovine serum albumin, 5 µM flavine adenine dinucleotide, 0.2 mM nicotinamide adenine dinucleotide, and 0 or 20 mM dicoumarol were preincubated for 10 min at 258°C (final concentrations in 200 mL of reaction volume). To initiate the reaction, 40 mM of 2,6-dichlorophenol-indo-phenol was added, and the initial velocity of the reduction of dichlorophenolindo-phenol was measured spectrophotometrically at 540 nm. The extinction coefficient for 2,6-dichlorophenol-indo-phenol was 2.1×104 M/cm. The total GST-α1 enzyme activity assay consisted of 100 µg/mL protein, 1 mM 1-chloro-2,4-dinitrobenzene, and 1 mM glutathione at 37°C in 100 mM potassium phosphate buffer (pH 6.5) (final concentrations in 150 µL of reaction volume). The reaction was monitored at 340 nm and the non-enzymatic slope was subtracted from the total observed slope. The extinction coefficient for 1-chloro-2,4-dinitrobenzene was 9600 M/cm. All values are expressed in nanomoles per minute per milligram of protein and analyzed by an experienced research technician blinded to the experimental condition.

Measurement of malondialdehyde (MDA) levels

MDA levels were determined as in previous studies [12], [13]. The principle of the assay depends on the reaction of lipid peroxidation products with thiobarbituric acid and formation of products named as thiobarbituric acid reacting substances, which give maximum absorbance at 532 nm wavelength. Serial dilutions of 1,1,3,3 tetraethoxypropane were used to obtain a standard absorbance vs. concentration curve, and MDA concentrations of the tissue samples were determined from this curve.

Measurement of tissue superoxide dismutase (SOD) activities

SOD enzyme activities were determined with RANSOD (Randox, U.K.) SOD assay kit. The method of the assay employs xanthine and XOD to generate superoxide radicals which react with INT to form a red formazan dye. The SOD activity is then measured by the degree of inhibition of the reaction. One unit of SOD is that which causes a 50% inhibition of the rate of reduction of INT under the conditions of the assay.

Measurement of tissue glutathione peroxidases (GSH-Px) activities

A GSH-Px Assay Kit (Northwest Life Science Specialities Vancouver, WA, U.S.) was used to assess tissue GSH-Px activities. This assay is an adaptation of a method used in previous studies [13], [14]. The principle of the assay is as follows: GSH-Px catalyzes the reduction of H2O2, oxidizing reduced GSH to form GSSG. GSSG is then reduced by GR and β-nicotinamide denine dinucleotide phosphate forming NADP+ (resulting in decreased absorbance at 340 nm) and recycling the GSH. Because GSH-Px is limiting, the decrease in absorbance at 340 nm is directly proportional to the GSH-Px concentration. GSH-Px activity is reported as units based on the definition: 1 U of GSH-Px  =  the amount of enzyme necessary to catalyze the oxidation (by H2O2) of 1.0 µmol GSH to GSSG per minute at 25°C, pH 7.0.

Statistical analysis

All data are presented as mean±SD. SPSS 12.0 was used for statistical analysis of the data. All data were subjected to one-way ANOVA. Differences between experimental groups were determined using Fisher's LSD post-test. Statistical significance was inferred at P<0.05.

Results

General observation

No significant changes in body weight, mean arterial blood pressure (MABP), temperature, or injected arterial blood gas data were detected in any of the experimental groups (data not shown). The mortality rate of rats in the control group was 0% (0/40 rats), but it was 20% (30/150 rats) in the SAH group. As shown in Fig. 2, the rats in SAH groups exhibited blood clots over the basal surface of the brainstem and Willis circle.
Figure 2

Schematic representation of the areas taken for assay.

tBHQ supplementation ameliorated EBI after experimental SAH

Significantly more water content was detected in the brain samples 48 h after SAH than in the control group (Fig. 3A) (P<0.05). Administration of tBHQ was associated with lower brain water content in the cortex than in the SAH+vehicle group (P<0.05). The pattern of Evans blue extravasation after SAH is shown in Fig. 3B. Rats in the SAH+vehicle group demonstrated a significant increase (P<0.01) in BBB permeability to Evans blue relative to rats in the control group. Administration of tBHQ significantly inhibited Evans blue extravasation (P<0.01), indicating a reduced BBB opening in response to tBHQ treatment. Clinical behavioral function impairment caused by SAH was evident in blood injection subjects but not in controls (P<0.01, Fig. 3C). No significant differences were seen between the SAH group and SAH+vehicle group (P>0.05). TBHQ-treated rats showed better performance in this scale system than vehicle-treated rats 48 h after SAH (Fig. 3C), and the difference was found to be statistically significant (P<0.05).
Figure 3

Brain Injury Detection: (A) Water content results: Alterations in brain water content in the control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10).

The brain water content was significantly higher 48 h after SAH than at other times. TBHQ treatment was found to markedly reduce brain water content significantly. No difference in brain water content was detected between SAH and SAH+vehicle groups. (B)Evans blue results: Alterations in Evans blue extravasation in the control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10). SAH was found to induce a marked increase in BBB extravasation in rat brains relative to untreated controls. After administration of tBHQ, the Evans blue extravasation was significantly less pronounced than in the SAH+vehicle group. (C)Clinical behavior results: Effects of tBHQ administration on functional outcomes in the rats in the control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10). *P<0.05 and **P<0.01 vs. control group, #P<0.05 and ##P<0.01 vs. SAH+vehicle group, vs. P>0.05 vs SAH group.

Brain Injury Detection: (A) Water content results: Alterations in brain water content in the control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10).

The brain water content was significantly higher 48 h after SAH than at other times. TBHQ treatment was found to markedly reduce brain water content significantly. No difference in brain water content was detected between SAH and SAH+vehicle groups. (B)Evans blue results: Alterations in Evans blue extravasation in the control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10). SAH was found to induce a marked increase in BBB extravasation in rat brains relative to untreated controls. After administration of tBHQ, the Evans blue extravasation was significantly less pronounced than in the SAH+vehicle group. (C)Clinical behavior results: Effects of tBHQ administration on functional outcomes in the rats in the control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10). *P<0.05 and **P<0.01 vs. control group, #P<0.05 and ##P<0.01 vs. SAH+vehicle group, vs. P>0.05 vs SAH group.

TBHQ administration repressed cortical apoptosis and degeneration in the brain after SAH

Few TUNEL- or FJB- positive apoptotic cells were found in the control group rat brains (Fig. 4, 5, and 6). In SAH and SAH+vehicle groups, the apoptotic and neurodegenerative index in the cortex was found to be significantly higher than in control animals (P<0.01) (Fig. 4, 5, and 6). There was no statistically significant difference between SAH group and SAH+vehicle group (P>0.05). There were fewer TUNEL-positive and FJB-positive cells in the cortex in the SAH+tBHQ group than in the SAH+vehicle group (P<0.01) (Fig. 4, 5, and 6). Results showed that tBHQ administration after SAH could lead to less cell death in the brain and so ameliorate early brain damage after SAH (Fig. 4, 5, and 6).
Figure 4

Fluoro-jade B (FJB) staining (400X).

Representative images demonstrating a lack of FJB positive neurons in the cortex of a saline-injected rats and a number of cells positively stained for FJB in cortex of rats in SAH and SAH+vehicle groups. In SAH+tBHQ group, the number of necrotic cells stained by FJB was decreased remarkably.

Figure 5

TUNEL staining (400X).

Representative cortical sections from SAH animals showing TUNEL-positive cells co-localized with the nuclear marker DAPI in the SAH animal. Control group rats showing few TUNEL apoptotic cells; SAH group rats showing strong TUNEL staining; SAH + vehicle group rats still showing more TUNEL apoptotic cells; SAH + tBHQ group rats showing less TUNEL apoptotic cells than SAH or SAH + vehicle group.

Figure 6

Administration of tBHQ significantly decreased the necrotic index and apoptotic index in rat brain following SAH.

**P<0.01 vs. control group, ##P<0.01 vs. SAH + vehicle group, nsP>0.05 vs. SAH group.

Fluoro-jade B (FJB) staining (400X).

Representative images demonstrating a lack of FJB positive neurons in the cortex of a saline-injected rats and a number of cells positively stained for FJB in cortex of rats in SAH and SAH+vehicle groups. In SAH+tBHQ group, the number of necrotic cells stained by FJB was decreased remarkably.

TUNEL staining (400X).

Representative cortical sections from SAH animals showing TUNEL-positive cells co-localized with the nuclear marker DAPI in the SAH animal. Control group rats showing few TUNEL apoptotic cells; SAH group rats showing strong TUNEL staining; SAH + vehicle group rats still showing more TUNEL apoptotic cells; SAH + tBHQ group rats showing less TUNEL apoptotic cells than SAH or SAH + vehicle group.

Administration of tBHQ significantly decreased the necrotic index and apoptotic index in rat brain following SAH.

**P<0.01 vs. control group, ##P<0.01 vs. SAH + vehicle group, nsP>0.05 vs. SAH group. One of the representative trials in each group is also indicated in Fig. 7. For all behavioral measurements, swimming speed and thigmotaxis (relative amount of time spent in the perimeter of the pool) were evaluated and no significant differences were found among the four groups. Most rats were able to find the visible platform, usually during the first trial. The failure rate was low and relatively even across all groups. There was no difference in the escape latency or swimming speed in the cued learning procedure among the four groups (P>0.05). Spatial learning was also the same for all four groups during the second and third days after blood injection. Spatial learning deficits relative to controls appeared during the fourth and fifth days in the SAH group. The tBHQ group exhibited significantly shorter escape latency than the vehicle group during the 4th and 5th days (Fig. 7A and 7B). Animals in all four groups learned to find the platform and so escape from water within one testing day (Fig. 7A–7D). However, the SAH group showed significantly less ability than controls (the 4th and 5th days), which was alleviated by tBHQ compare to the vehicle group. Repeated measures ANOVA indicated a significant difference in escape latency (Fig. 7A, P<0.01) and in swimming distance (Fig. 7C, P<0.01) between the SAH group and control groups, which was also improved by tBHQ compare to the vehicle group. When the escape latency and swimming distance from all of the testing days were separated into the four daily trials, the escape latency of the SAH group was shown to be significantly longer than that of the control group. That of the tBHQ group was significantly shorter than in the vehicle group (Fig. 7B, P<0.01). However, in swimming distance, only the tBHQ group was significantly different from the vehicle group on the 5th day (Fig. 7D, P<0.01).
Figure 7

Upper: Representative images of MWM trials of the rats of four groups; Bottom: Spatial learning and memory in the MWM.

Escape latency and swimming distance over 16 trials (A, C) and averaged for each day (B, D) over days 2–5. The SAH group exhibited significantly longer escape latency and swimming distance (A, C, *P<0.01 repeated ANOVA) over the 16 trials than control groups did. The tBHQ group exhibited significantly shorter escape latency and swimming distance (A, C, #P<0.01 repeated ANOVA) over the 16 trials than the vehicle group. The averaged data showed a similar increase in escape latency (B, *P<0.01 one-way ANOVA) in SAH animals on the fifth day relative to controls. In the tBHQ group, the averaged data exhibited significantly shorter escape latency (B, #P<0.01 one-way ANOVA) and swimming distance (D, #P<0.05 one-way ANOVA) on the 4th and 5th days than the vehicle group. On day 5, the relative improvement in escape latency from the previous training day was significantly lower in the SAH group than among controls (E, *P<0.01). The tBHQ group was higher on day 4 than the vehicle group (E, & P<0.05). The control group exhibited significantly more time saved on day 6 than in the SAH group on the working memory task (matching-to-place task), here indicated by the difference between the time required in latency to find the platform on the second (test) trial and that required to find the platform on the first (sample) trial (F, *P<0.01). There was no significant difference between the tBHQ group and the vehicle group (values are means±SD, n = 10 per group).

Upper: Representative images of MWM trials of the rats of four groups; Bottom: Spatial learning and memory in the MWM.

Escape latency and swimming distance over 16 trials (A, C) and averaged for each day (B, D) over days 2–5. The SAH group exhibited significantly longer escape latency and swimming distance (A, C, *P<0.01 repeated ANOVA) over the 16 trials than control groups did. The tBHQ group exhibited significantly shorter escape latency and swimming distance (A, C, #P<0.01 repeated ANOVA) over the 16 trials than the vehicle group. The averaged data showed a similar increase in escape latency (B, *P<0.01 one-way ANOVA) in SAH animals on the fifth day relative to controls. In the tBHQ group, the averaged data exhibited significantly shorter escape latency (B, #P<0.01 one-way ANOVA) and swimming distance (D, #P<0.05 one-way ANOVA) on the 4th and 5th days than the vehicle group. On day 5, the relative improvement in escape latency from the previous training day was significantly lower in the SAH group than among controls (E, *P<0.01). The tBHQ group was higher on day 4 than the vehicle group (E, & P<0.05). The control group exhibited significantly more time saved on day 6 than in the SAH group on the working memory task (matching-to-place task), here indicated by the difference between the time required in latency to find the platform on the second (test) trial and that required to find the platform on the first (sample) trial (F, *P<0.01). There was no significant difference between the tBHQ group and the vehicle group (values are means±SD, n = 10 per group). The relative improvement in latency in the SAH group had decreased significantly by day 5 (Fig. 7E, P<0.05), and while rats in the control groups showed a gradual, non-significant decrease in relative improvement. However, the relative improvement in the tBHQ group became negative by day 4. There was no significant difference in reference memory among the groups as measured by the relative amount of time spent in the target quadrant in the probe trial, although there was a trend towards fewer annulus crossings between the four groups (data not shown). Animals with control showed significantly more time saved in the working memory task on days 6–8 than in the SAH groups, as shown by the difference between the time required to find the platform during the first trial and the time required to find it during the second trial. However, there was no significant difference among the tBHQ group and the vehicle group (Fig. 7F, P>0.05).

tBHQ and Keap1, Nrf2, and HO-1 protein expression in the SAH brain

To determine the influence of tBHQ on Keap1/Nrf2/ARE pathway in the cortex after SAH, Western blot was performed to detect changes in Keap1, Nrf2, and HO-1 expression, as described in the materials and methods section. As shown in Fig. 8, levels of Keap1, Nrf2, and HO-1 were low in the control group. On day 2 (48 h after SAH), the levels of Keap1, Nrf2, and HO-1 were significantly higher in the SAH group and SAH+vehicle group than they had been before SAH (P<0.05) (Fig. 8). There was no statistically significant difference between SAH group and SAH+vehicle group (P>0.05) (Fig. 8). After tBHQ administration, the increased expression of Keap1, Nrf2, and HO-1 was markedly more pronounced in animals in the SAH+tBHQ group than in the control group (P<0.05) (Fig. 8).
Figure 8

Top: Representative autoradiogram of Keap1, Nrf2, and HO-1 expression in the brain after SAH.

Results show that there was more expression of these proteins in the SAH groups and further up-regulated after tBHQ treatment. Lane 1, control; lane 2, SAH; lane 3, SAH+vehicle; lanes 4, SAH+tBHQ, respectively. Bottom: Quantitative analysis of the Western blot results shows that these protein levels in SAH groups are significantly higher than in control group and progressively induced by tBHQ. Bars represent the mean±SD (n = 10, each group). **P<0.01 and *P<0.05 between control animals vs. SAH animals; ##P<0.01 and #P<0.05 between SAH+vehicle animals vs. SAH+tBHQ animals; nsP >0.05 between SAH animals vs. SAH+vehicle animals.

Top: Representative autoradiogram of Keap1, Nrf2, and HO-1 expression in the brain after SAH.

Results show that there was more expression of these proteins in the SAH groups and further up-regulated after tBHQ treatment. Lane 1, control; lane 2, SAH; lane 3, SAH+vehicle; lanes 4, SAH+tBHQ, respectively. Bottom: Quantitative analysis of the Western blot results shows that these protein levels in SAH groups are significantly higher than in control group and progressively induced by tBHQ. Bars represent the mean±SD (n = 10, each group). **P<0.01 and *P<0.05 between control animals vs. SAH animals; ##P<0.01 and #P<0.05 between SAH+vehicle animals vs. SAH+tBHQ animals; nsP >0.05 between SAH animals vs. SAH+vehicle animals.

Administration of tBHQ up-regulated Nrf2 DNA binding activity after SAH

EMSA autoradiography of Nrf2 DNA binding activity of the brain samples is shown in Fig. 9. Low Nrf2 binding activity (weak EMSA autoradiography) was found in the control group. Nrf2 binding activity in the injured brain was significantly higher in SAH and vehicle-treated groups than in the control group (P<0.05). In SAH+tBHQ group, the Nrf2 binding activity was significantly more up-regulated in the brain area surrounding the blood clot site after SAH than before SAH (P<0.05).
Figure 9

Nrf2 activity in the brain area surrounding the blood clot in control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10).

Top, EMSA autoradiography of NF-κB DNA binding activity. Lane 1, control; lane 2, SAH; lane 3, SAH+vehicle; lane 4, SAH+tBHQ, respectively. Bottom, Levels of Nrf2 DNA binding activity quantified by computer-assisted densitometric scanning and expressed as arbitrary densitometric units (ADU). Nrf2 binding activity measured by EMSA was significantly higher than in the control group after SAH. tBHQ rendered Nrf2 activation significantly higher in the SAH+tBHQ group than in the SAH+vehicle group. *P<0.05 between control animals vs. SAH animals; ##P<0.01 between SAH+vehicle animals vs. SAH+tBHQ animals; nsP>0.05 between SAH animals vs. SAH+vehicle animals.

Nrf2 activity in the brain area surrounding the blood clot in control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10).

Top, EMSA autoradiography of NF-κB DNA binding activity. Lane 1, control; lane 2, SAH; lane 3, SAH+vehicle; lane 4, SAH+tBHQ, respectively. Bottom, Levels of Nrf2 DNA binding activity quantified by computer-assisted densitometric scanning and expressed as arbitrary densitometric units (ADU). Nrf2 binding activity measured by EMSA was significantly higher than in the control group after SAH. tBHQ rendered Nrf2 activation significantly higher in the SAH+tBHQ group than in the SAH+vehicle group. *P<0.05 between control animals vs. SAH animals; ##P<0.01 between SAH+vehicle animals vs. SAH+tBHQ animals; nsP>0.05 between SAH animals vs. SAH+vehicle animals.

Immunohistochemistry for Keap1/Nrf2/ARE pathway after SAH

Immunohistochemical study showed that positive Keap1, Nrf2, and HO-1 were mainly located the neurons and glial cells. The immunoreactivity of Keap1, Nrf2, and HO-1 was weak in the cortex samples in control group, which showed only a few positive cells in the brain (Fig. 10). More cells were positively immunostained for Keap1, Nrf2, and HO-1 in SAH and SAH+vehicle groups 48 h after SAH than in the control group (Fig. 10, P<0.05). In the SAH+tBHQ group, the number of positive cells was even greater (Fig. 10, P<0.05).
Figure 10

Immunohistochemical results: (A) Immunohistochemical study of Keap1, Nrf2, and HO-1 on brain samples.

Few Keap1-, Nrf2-, and HO-1-positive cells were observed in the control group, which indicates the constitutional activation of Keap1/Nrf2/HO-1 pathway in the normal cortex of rats. High numbers of Keap1-, Nrf2-, and HO-1-positive cells (arrows) were stained brown and observed in the brains of the rats in the subarachnoid hemorrhage (SAH) groups. Significant up-regulation of Keap1, Nrf2, and HO-1 immunoreactivity (arrows) was observed in the neurons and glia cells of SAH brains treated with tBHQ (400X). (B) Quantitative analysis showed relatively low concentrations of Keap1, Nrf2, and HO-1 in the control group. The concentrations of Keap1, Nrf2, and HO-1 expression were higher in the SAH and SAH+vehicle groups. After tBHQ therapy, all three proteins were progressively activated in the treatment group. Bars represent the mean ± SD (n = 10, each group). *P<0.05 compared with control group, #P<0.05 and ##P<0.01 compared with SAH+vehicle group.

Immunohistochemical results: (A) Immunohistochemical study of Keap1, Nrf2, and HO-1 on brain samples.

Few Keap1-, Nrf2-, and HO-1-positive cells were observed in the control group, which indicates the constitutional activation of Keap1/Nrf2/HO-1 pathway in the normal cortex of rats. High numbers of Keap1-, Nrf2-, and HO-1-positive cells (arrows) were stained brown and observed in the brains of the rats in the subarachnoid hemorrhage (SAH) groups. Significant up-regulation of Keap1, Nrf2, and HO-1 immunoreactivity (arrows) was observed in the neurons and glia cells of SAH brains treated with tBHQ (400X). (B) Quantitative analysis showed relatively low concentrations of Keap1, Nrf2, and HO-1 in the control group. The concentrations of Keap1, Nrf2, and HO-1 expression were higher in the SAH and SAH+vehicle groups. After tBHQ therapy, all three proteins were progressively activated in the treatment group. Bars represent the mean ± SD (n = 10, each group). *P<0.05 compared with control group, #P<0.05 and ##P<0.01 compared with SAH+vehicle group.

tBHQ and mRNA expression of HO-1, NQO1, and GST-α1 in the SAH cortex

The mRNA levels of three genes, HO-1, NQO1, and GST-α1, were detected using quantitative real-time PCR. The mRNA of these proteins was expressed at low levels in the brains of control group rats. The levels of HO-1, NQO1, and GST-α1 mRNA were significantly higher in the cortex in SAH and SAH+vehicle group than in the control group (P<0.05). mRNA expression showed no significant difference between SAH group and SAH+vehicle group (P>0.05). The levels of mRNA expression of HO-1, NQO1, and GST-α1 in the brains of SAH+tBHQ group were significantly up-regulated relative to those of the SAH+vehicle group (Fig. 11).
Figure 11

The mRNA expressions of HO-1, NQO1, and GST-α1 in the brains in control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10).

SAH was found to induce a marked increase in HO-1, NQO1, and GST-α1 mRNA expression in the rat SAH brains compared with control group. After tBHQ administration, the mRNA expressions of the downstream Keap1/Nrf2/ARE pathway related agents were significantly up-regulated relative to the SAH+vehicle group. ** P<0.01 and * P<0.05 vs. control group, ## P<0.01 and # P<0.05 vs. SAH+vehicle group, vs. P>0.05 vs. SAH group.

The mRNA expressions of HO-1, NQO1, and GST-α1 in the brains in control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10), and SAH+tBHQ group (n = 10).

SAH was found to induce a marked increase in HO-1, NQO1, and GST-α1 mRNA expression in the rat SAH brains compared with control group. After tBHQ administration, the mRNA expressions of the downstream Keap1/Nrf2/ARE pathway related agents were significantly up-regulated relative to the SAH+vehicle group. ** P<0.01 and * P<0.05 vs. control group, ## P<0.01 and # P<0.05 vs. SAH+vehicle group, vs. P>0.05 vs. SAH group.

tBHQ and expression of antioxidant and detoxifying enzymes in the brain

As shown in Fig. 12, NQO1 and GST-α1 activity was low in the brains of control group rats. Cortical levels of these antioxidant and detoxifying enzymes were much after SAH than among uninjured controls. Administration of tBHQ after SAH was found to lead to significantly increased NQO1 and GST-α1 activity in rat brain tissue.
Figure 12

Changes of NQO1 and GST-α1 enzymes activity in the brain as determined by biochemical tests in control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10) and SAH+tBHQ group (n = 10).

SAH was found to induce the significant increases in the activity of NQO1 and GST-α1 in rat brain tissue. In the SAH+tBHQ group, the cortical activity of NQO1 and GST-α1 was markedly up-regulated relative to the SAH+vehicle group. *P<0.05 vs. control group; #P<0.05 vs. control group; vs. P>0.05 relative to the SAH group.

Changes of NQO1 and GST-α1 enzymes activity in the brain as determined by biochemical tests in control group (n = 10), SAH group (n = 10), SAH+vehicle group (n = 10) and SAH+tBHQ group (n = 10).

SAH was found to induce the significant increases in the activity of NQO1 and GST-α1 in rat brain tissue. In the SAH+tBHQ group, the cortical activity of NQO1 and GST-α1 was markedly up-regulated relative to the SAH+vehicle group. *P<0.05 vs. control group; #P<0.05 vs. control group; vs. P>0.05 relative to the SAH group.

tBHQ and oxidative stress in the cortex after SAH

The values of the tissue MDA levels, tissue SOD and GSH-Px enzyme activities are shown in Fig. 13. SAH significantly increased tissue MDA levels (P<0.05) and significantly decreased tissue SOD and GSH-Px enzyme activity (P<0.05) relative to controls. tBHQ treatment has shown protective effects by decreasing MDA levels(P<0.05) and increasing the activity of antioxidant enzymes (SOD, P<0.01; GSH-Px, P<0.05).
Figure 13

Cerebral antioxidant status of the experimental group of animals (n = 10 for each group).

After tBHQ administration, the post-SAH reduced antioxidative status was ameliorated in this SAH model. Values are expressed as mean±SD. (*P<0.05 and *P<0.01 vs. Control group, nsP>0.05 vs. SAH group, #P<0.05 and ##P<0.01 vs. SAH+ vehicle group).

Cerebral antioxidant status of the experimental group of animals (n = 10 for each group).

After tBHQ administration, the post-SAH reduced antioxidative status was ameliorated in this SAH model. Values are expressed as mean±SD. (*P<0.05 and *P<0.01 vs. Control group, nsP>0.05 vs. SAH group, #P<0.05 and ##P<0.01 vs. SAH+ vehicle group).

Discussion

The main findings of this study are as follows: 1) After administration of tBHQ, early brain damage, including brain edema, BBB permeability, decreases in clinical scale scores, and cortical apoptosis and necrosis attributable to SAH were ameliorated; 2) after oral administration of tBHQ, SAH-induced behavioral and cognitive dysfunction was attenuated in this prechiasmatic blood injection model; 3) the up-regulated cortical levels of these agents related to Keap1/Nrf2/ARE signaling pathways were further activated when treated with tBHQ at both the mRNA and protein synthesis levels; 4) the cerebral state of oxidative stress improved when experimental SAH was followed by tBHQ supplementation. These findings suggest for the first time that tBHQ may modulate the SAH-induced Keap1/Nrf2/ARE signaling pathway activation and may so prevent the development of EBI after SAH. This neurobehavioral study supports the hypothesis that the Keap1/Nrf2/ARE pathway and its anti-oxidative influence in the brain may be important in the protection of cognition. Together, these results highlight the potential of Nrf2 activation by small molecule inducers such as tBHQ as a new therapeutic strategy for neurobehavioral dysfunction of surviving SAH patients. Several studies have focused on the neuroprotective effects of tBHQ in other brain injury models [6], [7]. Shih et al. investigated the neuroprotective effects of tBHQ with two different models of ischemia-reperfusion in rats and mice, using three different routes of administration (intracerebroventricular, intraperitoneal, and oral) [7]. Their results indicated that tBHQ treatment improved functional recovery for up to 1 month after transient middle cerebral artery occlusion (MCAO) in rats, suggesting that tBHQ may reduce neuronal death during delayed apoptosis long after the onset of stroke. More recently, Saykally et al. used a brain trauma model to show that post-injury visual memory was improved by a 7 day course of treatment of tBHQ and that the concentration of activated caspase-3 in the hippocampus was reduced [6]. The injury-induced memory loss was also reversed by administration of tBHQ after brain trauma. In this current study, the data are consistent with those of previous studies performed using other models. It was here found that administration of tBHQ after SAH could reduce cerebral edema and BBB permeability and improve neurological scoring. These issues are majors part of the EBI that can follow SAH. At the same time, the neurobehavioral results were consistent with the present hypothesis, and rats treated with tBHQ exhibited better performance than vehicle-treated rats in MWM testing, which suggested that up-regulation of Keap1/Nrf2/ARE signaling could mitigate the SAH-induced damage to spatial working memory. The Neh2 domain of Nrf2, which is localized at the N-terminus, is the binding site of the repressor protein Keap1. Keap1 protein contains conserved cysteine residues, which are components of a molecular switch that is triggered by intracellular redox changes. They play a critical role in the maintenance of the cellular redox balance. Keap1 links Nrf2 to the cytoskeleton to keep Nrf2 in the cytoplasm, thereby promoting its degradation. Oxidative stress enables Nrf2 to escape Keap1-mediated proteasomal degradation, leading to Nrf2 stabilization and subsequent nuclear translocation [15]. Once the cellular redox homeostasis is restored, Nrf2 is dissociated from the nucleus by Keap1 and subsequently transported out of the nucleus into the cytoplasm, where it is ubiquitinated and degraded [16]. Keap1/Nrf2/ARE activation induces the production of a battery of endogenous enzymes, such as SOD, catalase, GSH-Px, peroxiredoxins, NQOs, and HOs. Together these free-radical-scavenging enzymes are a powerful antioxidant defense mechanism [17]. In the SAH model, a previous study showed this theoretical system by using sulforaphane (another Nrf2 activator). This was a pilot study and did not involve Keap1 analysis or neurobehavioral evaluation after experimental SAH. The present study is a further exploration of the relationship between the Keap1/Nrf2/ARE pathway and SAH. In the present study, the levels of Keap1/Nrf2/ARE pathway in the brain were found to be activated after SAH and could be additionally up-regulated after tBHQ administration. This is consistent with previous in vivo and in vitro studies. However, the mechanism underlying the initial effect on Keap1/Nrf2/ARE signaling pathway after SAH remains unclear. The main Keap1/Nrf2/ARE ligands in the brain after SAH and the whole mechanism related to tBHQ merits further research. A substantial portion of survivors of SAH have cognitive impairment. These, rather than focal neurological deficits, account for their disability [18], [19]. These impairments include deficits in attention, memory, learning, language, executive and motor functions and memory, and learning and executive functions [19]–[24]. The first experimental study concerning cognitive dysfunction after SAH in animal models was reported by Takata et al. [25]. The authors demonstrated that rats reliably develop long-term vestibulomotor dysfunction and visual spatial memory impairment after SAH and cognitive dysfunction is correlated with selective neuronal loss in the hippocampus and cortex. However, until now, no work has been done with respect to the relationship between oxidative stress and cognitive dysfunction in SAH. In the present study, a cerebral anti-oxidative state was confirmed through analysis of MDA, SOD, and GSH-Px. The data showed that tBHQ could facilitate the expression of antioxidants and detoxifying enzymes and mitigate the over-activated state of oxidative stress, which may play important roles in the pathogenesis of cognitive dysfunction. An increase in MDA levels in the brain is a marker of lipid peroxidation damage to brain tissue. A number of experimental and clinical studies have suggested that the MDA level increases significantly in the brain after SAH and ultimately contributes to neuronal death and neurologic deficits [26]. SOD is the first line of defense against oxidative stress. It acts by catalyzing the dismutase reaction of superoxide anion to hydrogen peroxide. Its concentration is representative of the antioxidative capacity of the tissue. This study showed that the redox balance shifted toward a more oxidative condition after SAH, whereas treatment with tBHQ post-SAH significantly increased the impaired SOD activity and decreased the MDA level, indicating a rebalancing of the oxidative-antioxidant system. Although the precise mechanism underlying the antioxidative stress action of tBHQ is still unclear, several lines of evidence have indicated that Keap1-Nrf2-ARE signaling pathways contribute to this process. SAH has been found to significantly enhance the activation of Nrf2 and the induction of Nrf2-mediated downstream antioxidant enzymes, such as HO-1 in the rat brain [5]. There is also direct evidence that HO-1 can modulate oxidative activity. Treatment with hemin, an HO-1 inducer, can increase HO-1 and Nrf2 levels and decrease oxidative activity relative to sham groups [27]. Treatment with tBHQ can increase Nrf2 and HO-1 levels, which may together confer an adaptive neuroprotective response to oxidative insults mediated by decreased ROS. It was also observed that Nrf2 could reduce ROS levels and affect the redox-sensitive NF-κB signaling pathway involved in neuroinflammation [28]. In this way, the decreased ROS levels may exert feedback control on the oxidative level. These findings suggest that tBHQ augments the cellular antioxidative system via the upregulation of Nrf2 and inactivation oxidative stress. In summary, this present study is the first to evaluate the effects of tBHQ on EBI and secondary neurobehavioral dysfunction in this experimental SAH model. It also evaluated the influence of tBHQ on Keap1/Nrf2/ARE anti-oxidative pathway after SAH. It was here found that SAH could up-regulate the protein expression of Keap1/Nrf2/ARE-pathway-related mediators, upstream factors (Keap1 and Nrf2), and downstream factors (HO-1, NQO1, and GST-α1) in the brain tissue surrounding blood clots. These effects were found to be markedly up-regulated by tBHQ therapy. These results suggest that SAH could induce activation of the Keap1/Nrf2/ARE signaling pathway in the rat brain, which might play a central role in the anti-oxidative effects that lead to better outcomes after SAH. The therapeutic benefits of post-SAH tBHQ administration might be attributable to its salutary effect on modulating the Keap1/Nrf2/ARE signaling pathway.
  26 in total

Review 1.  Nrf2:INrf2 (Keap1) signaling in oxidative stress.

Authors:  James W Kaspar; Suryakant K Niture; Anil K Jaiswal
Journal:  Free Radic Biol Med       Date:  2009-08-07       Impact factor: 7.376

2.  Melatonin modulates neuroinflammation and oxidative stress in experimental diabetic neuropathy: effects on NF-κB and Nrf2 cascades.

Authors:  Geeta Negi; Ashutosh Kumar; Shyam S Sharma
Journal:  J Pineal Res       Date:  2010-11-09       Impact factor: 13.007

Review 3.  Delayed cerebral ischemia after subarachnoid hemorrhage: a systematic review of clinical, laboratory, and radiological predictors.

Authors:  Nicolien K de Rooij; Gabriel J E Rinkel; Jan Willem Dankbaar; Catharina J M Frijns
Journal:  Stroke       Date:  2012-12-18       Impact factor: 7.914

4.  Inhibitory effect on cerebral inflammatory agents that accompany traumatic brain injury in a rat model: a potential neuroprotective mechanism of recombinant human erythropoietin (rhEPO).

Authors:  Gang Chen; Ji Xin Shi; Chun Hua Hang; Weiying Xie; Jian Liu; Xiaoming Liu
Journal:  Neurosci Lett       Date:  2007-08-19       Impact factor: 3.046

5.  A prospective study of impairment of cognition and memory and recovery after subarachnoid hemorrhage.

Authors:  J A Ogden; E W Mee; M Henning
Journal:  Neurosurgery       Date:  1993-10       Impact factor: 4.654

6.  Ras protein contributes to cerebral vasospasm in a canine double-hemorrhage model.

Authors:  Mitsuo Yamaguchi; Changman Zhou; Anil Nanda; John H Zhang
Journal:  Stroke       Date:  2004-05-13       Impact factor: 7.914

7.  N-acetylcysteine suppresses oxidative stress in experimental rats with subarachnoid hemorrhage.

Authors:  Hua Lu; Dong-Mei Zhang; Hui-Ling Chen; Yi-Xing Lin; Chun-Hua Hang; Hong-Xia Yin; Ji-Xin Shi
Journal:  J Clin Neurosci       Date:  2009-03-04       Impact factor: 1.961

8.  Which neuropsychological deficits are hidden behind a good outcome (Glasgow = I) after aneurysmal subarachnoid hemorrhage?

Authors:  B O Hütter; J M Gilsbach
Journal:  Neurosurgery       Date:  1993-12       Impact factor: 4.654

9.  Cognitive outcome after aneurysmal subarachnoid hemorrhage: time course of recovery and relationship to clinical, radiological, and management parameters.

Authors:  Tonje Haug; Angelika Sorteberg; Wilhelm Sorteberg; Karl-Fredrik Lindegaard; Tryggve Lundar; Arnstein Finset
Journal:  Neurosurgery       Date:  2007-04       Impact factor: 4.654

10.  Long-term cognitive deficits in patients after surgery on aneurysms of the anterior communicating artery.

Authors:  L M Stenhouse; R G Knight; B E Longmore; S N Bishara
Journal:  J Neurol Neurosurg Psychiatry       Date:  1991-10       Impact factor: 10.154

View more
  29 in total

Review 1.  Preventive and Protective Roles of Dietary Nrf2 Activators Against Central Nervous System Diseases.

Authors:  Yang Sun; Tuo Yang; Rehana K Leak; Jun Chen; Feng Zhang
Journal:  CNS Neurol Disord Drug Targets       Date:  2017       Impact factor: 4.388

Review 2.  Neurobehavioral testing in subarachnoid hemorrhage: A review of methods and current findings in rodents.

Authors:  Nefize Turan; Brandon A Miller; Robert A Heider; Maheen Nadeem; Iqbal Sayeed; Donald G Stein; Gustavo Pradilla
Journal:  J Cereb Blood Flow Metab       Date:  2016-10-01       Impact factor: 6.200

3.  Tert-butylhydroquinone post-treatment attenuates neonatal hypoxic-ischemic brain damage in rats.

Authors:  Juan Zhang; Lorelei Donovan Tucker; Yujiao Lu; Luodan Yang; Chongyun Wu; Yong Li; Quanguang Zhang
Journal:  Neurochem Int       Date:  2018-03-09       Impact factor: 3.921

Review 4.  Targeting the NF-E2-Related Factor 2 Pathway: a Novel Strategy for Traumatic Brain Injury.

Authors:  Li Zhang; Handong Wang
Journal:  Mol Neurobiol       Date:  2017-02-21       Impact factor: 5.590

5.  α- and β-Naphthoflavone synergistically attenuate H2O2-induced neuron SH-SY5Y cell damage.

Authors:  Yong Zhu; Fangfang Bi; Yanchun Li; Huiming Yin; Na Deng; Haiquan Pan; Dongfang Li; Bo Xiao
Journal:  Exp Ther Med       Date:  2017-01-13       Impact factor: 2.447

6.  Tert-butylhydroquinone Ameliorates Early Brain Injury After Experimental Subarachnoid Hemorrhage in Mice by Enhancing Nrf2-Independent Autophagy.

Authors:  Tao Li; Kang-jian Sun; Han-Dong Wang; Meng-Liang Zhou; Ke Ding; Xin-Yu Lu; Wu-Ting Wei; Chun-Xi Wang; Xiao-Ming Zhou
Journal:  Neurochem Res       Date:  2015-08-12       Impact factor: 3.996

7.  Propofol Attenuates Early Brain Injury After Subarachnoid Hemorrhage in Rats.

Authors:  Song-sheng Shi; Hua-bin Zhang; Chun-hua Wang; Wei-zhong Yang; Ri-sheng Liang; Ye Chen; Xian-kun Tu
Journal:  J Mol Neurosci       Date:  2015-09-05       Impact factor: 3.444

Review 8.  Nrf2 Weaves an Elaborate Network of Neuroprotection Against Stroke.

Authors:  Shuai Jiang; Chao Deng; Jianjun Lv; Chongxi Fan; Wei Hu; Shouyin Di; Xiaolong Yan; Zhiqiang Ma; Zhenxing Liang; Yang Yang
Journal:  Mol Neurobiol       Date:  2016-02-05       Impact factor: 5.590

Review 9.  Potential therapeutic effects of Nrf2 activators on intracranial hemorrhage.

Authors:  Takahiko Imai; Hirofumi Matsubara; Hideaki Hara
Journal:  J Cereb Blood Flow Metab       Date:  2021-01-14       Impact factor: 6.200

10.  Streptococcus pneumoniae exerts oxidative stress, subverts antioxidant signaling and autophagy in human corneal epithelial cells that is alleviated by tert-Butylhydroquinone.

Authors:  Prerana Sharma; Sanhita Roy
Journal:  Med Microbiol Immunol       Date:  2022-03-24       Impact factor: 3.402

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.