Yeast identification by DNA sequencing in an undergraduate mycology laboratory.

INTRODUCTION

Our undergraduate microbiology courses discuss the importance of nucleic acid-based techniques for the classification and identification of microbes but our teaching laboratories do not provide hands-on experience with these methods. To remedy this, it was decided that a module on yeast identification by DNA sequencing would be included in the laboratory portion of our general mycology course. This module could be used in the laboratories of other mycology courses, the mycology sections of general microbiology labs, or in undergraduate courses in genetics or molecular biology. The benefits of this robust and inexpensive procedure are that students learn the identification method of choice used by yeast investigators and it introduces the students to the basic molecular techniques of DNA isolation and purification, gel electrophoresis, DNA sequencing, and bioinformatics.

The yeast identification procedure is based on the sequencing of the polymerase chain reaction (PCR)-amplified 600 base pair D1/D2 region of the yeast 26S ribosomal DNA (2), which is compared by a BLAST search to the D1/D2 regions of all validly described yeast species on file in the GenBank database, facilitating accurate and rapid identification (1, 3).

METHODS AND MATERIALS

The equipment and supplies required for the module are listed in Appendix 1. This equipment will not usually be found in a typical undergraduate microbiology teaching laboratory but these instruments can be borrowed from other teaching or research laboratories.

The group of environmental yeasts chosen for study were basidiomycetious ballistosporic yeast growing on the upper surfaces of leaves (5). Students collect leaves from plants of their choice and, with sterile molten water agar, secure them to the inside lid of a Petri dish containing Yeast Malt Agar Rose Bengal Agar (3 g yeast extract, 3 g malt extract, 5 g peptone, 10 g glucose, 0.25 g Rose Bengal (Acros Organics, product No. 189450050), 100 mg of chloramphenicol, 20 g agar, 1 L distilled water) so that the upper surfaces of the leaves are facing down toward the agar when the lid is in place. The dye Rose Bengal inhibits the growth of bacteria and slows the growth of fast-growing filamentous fungi and the chloramphenicol inhibits Gram-positive and Gram-negative bacteria. During incubation at room temperature the ballistosporic yeast discharge their conidia from microcolonies on the leaf onto the agar surface which is examined for yeast colonies after 48 and 72 hours.

The ballistosporic yeasts were the subject of this exercise because leaves are easy to collect and set up for culture and because these yeasts would be a low risk for causing disease in healthy individuals. As with any micro-biology exercise, aseptic transfer techniques should be used when manipulating cultures. Students experiencing any type of immunosuppression or with other health issues should see their physician to discuss if they should participate in the lab, and safety guidelines for Biosafety Level 2 microbiology teaching laboratories should be observed (Guidelines for Biosafety in Teaching Laboratories, ASM Task Committee on Laboratory Safety, http://www.asm.org/images/asm_biosafety_guidelines-FINAL.pdf).

Extract and amplify yeast D1/D2 DNA as described in Appendix 2. The amplification of the D1/D2 region is performed by a modification of the original protocol (4) to amplify an approximately 1000 bp fragment containing the D1/D2 region and a 400 bp section of the adjacent 26S rDNA internal transcribed spacer 2 region. The purified ampicons and the sequencing primer NL-1 (GCATATCAATAAGCGGAGGAAAAG) were sent to Eton Biosciences (San Diego, CA) for sequencing. The sequencing results were returned by e-mail and were analyzed by the students independently outside of lab according to the guidance provided in Appendix 3.

When students have no experience with most of the necessary equipment and only enough time for one attempt, teams of three or four students can be formed with one student performing the required steps of a particular stage of the procedure while the others observe and critique their performance. The roles of students and coaches should be rotated until all members of the group complete that stage for their isolate.

Forty students, primarily junior- and senior-level microbiology and biology major undergraduates, participated in the module over two lab sessions. The first session required 1.5 hours to isolate the genomic DNA and to set up the PCR reaction. The second session required 2 hours to purify and quantitate the DNA for sequencing. Of the thirty-seven yeast isolates tested, 33 (89%) returned usable sequences for BLAST identification.

CONCLUSION

The procedure returned a high rate of usable sequence even when performed by many inexperienced students. Prior instructor experience with PCR-based procedures would be useful to conduct this exercise but lack of experience should not prevent it from being presented. Because of its demonstrated robustness, the procedure is currently being used by the author for undergraduate research projects studying yeast diversity and ecology and it will be offered throughout the next mycology lab as a basic identification tool for student yeast isolates. Using a coordinated approach to sampling, the procedure could be used for open-ended class size projects, such as comparing the effect of microenvironment on the yeast flora of a single plant species or contrasting the yeast flora on different plant species in the same microenvironment.

Appendix 1: Instruments and supplies

Appendix 2: Subculture of yeast and extraction and PCR amplification of yeast DNA

Appendix 3: Student instructions for performing and analyzing a BLAST search