Molecular approaches to the identification of pathogenic and nonpathogenic listeriae.

The genus Listeria consists of a closely related group of Gram-positive bacteria that commonly occur in the environment and demonstrate varied pathogenic potential. Of the 10 species identified to date, L. monocytogenes is a facultative intracellular pathogen of both humans and animals, L. ivanovii mainly infects ungulates (eg., sheep and cattle), while other species (L. innocua, L. seeligeri, L. welshimeri, L. grayi, L. marthii, L. rocourtiae, L. fleischmannii and L. weihenstephanensis) are essentially saprophytes. Within the species of L. monocytogenes, several serovars (e.g., 4b, 1/2a, 1/2b and 1/2c) are highly pathogenic and account for a majority of clinical isolations. Due to their close morphological, biological, biochemical and genetic similarities, laboratory identification of pathogenic and nonpathogenic Listeria organisms is technically challenging. With the development and application of various molecular approaches, accurate and rapid discrimination of pathogenic and nonpathogenic Listeria organisms, as well as pathogenic and nonpathogenic L. monocytogenes strains, has become possible.

Introduction

Listeria was first described by E.G.D. Murray in 1926 in Cambridge, England, who referred to the causative agent for monocytosis in laboratory rodents as Bacterium monocytogenes. In 1927, a bacterium causing mortality in gerbils was identified in Johannesburg, South Africa, and named Listerella hepatolytica in honor of Joseph Lister, a surgeon who pioneered antiseptic surgery. With the realization that Bacterium monocytogenes and Listerella hepatolytica were in fact the identical bacterium and that the name Listerella had been already taken for a slime mold and a protozoan, the organism was renamed Listeria monocytogenes in 1940.1 In addition to L. monocytogenes,9 other species (L. ivanovii, L. innocua, L. seeligeri, L. welshimeri, L. grayi, L. marthii, L. rocourtiae, L. fleischmannii and L. weihenstephanensis) have since been identified within the genus.

Although L. monocytogenes was implicated in human disease from the late 1920s, it was not until 1979 that the link of this bacterium to serious foodborne listeriosis in humans was established.1 In immunocompetent individuals, L. monocytogenes tends to cause gastrointestinal symptoms that are transient in nature and often disappear within a short period. In the immunocompromised individuals such as pregnant women, neonates, and the elderly, L. monocytogenes infection may lead to severe clinical diseases, with abortion and death being usual outcomes.2,3

Considering their close morphological and biological similarities and their varied pathogenicity, it is important that pathogenic and nonpathogenic Listeria species/L. monocytogenes serovars/strains are correctly identified. Over the years, a number of phenotypic procedures have been developed and used for identification and differentiation of Listeria organisms. However, given their variable performance and slow turnover, phenotypic tests for Listeria diagnosis have been largely superseded by molecular approaches. The purpose of this article is to provide an update on the utility of molecular techniques for the improved determination of pathogenic and nonpathogenic listeriae.

Listeria Classification

The genus Listeria covers a group of Gram-positive, non-spore-forming, rod-shaped bacteria of 0.4–0.5 μm × 1–1.5 μm in size and between 36–39% in G + C content. Taxonomically, the genus Listeria is classified in the family Listeriaceae, order Bacillales, class Bacilli, phylum Furmicutes, domain Bacteria, kingdom Prokaryotae. Apart from Listeria, the only other genus in the Listeriaceae family is Brochothrix. To date, 10 species are recognized within the genus: L. monocytogenes, L. ivanovii (previously known as L. monocytogenes serotype 5), L. seeligeri, L. innocua, L. welshimeri, L. grayi, L. marthii, L. rocourtiae, L. fleischmannii and L. weihenstephanensis.4–9 Of these, L. monocytogenes is a facultative intracellular pathogen of both humans and animals, L. ivanovii primarily infects ungulates (eg, sheep and cattle), and the other 8 species are free-living saprophytes.10–17 Nonetheless, non-monocytogenes Listeria species including L. ivanovii,18–21L. seeligeri,22L. innocua,23L. welshimeri,24 and L. grayi25–27 have been occasionally implicated in human clinical cases, mainly in individuals with suppressed immune functions and/or underlying illnesses.

Since L. monocytogenes strains display notable variations in virulence, attempts have been made to develop and use laboratory procedures to differentiate pathogenic from nonpathogenic strains, and to monitor the strains involved in the listeriosis outbreaks. Serotyping on the basis of immunological reactions between listerial somatic (O)/flagellar (H) antigens and specific antibodies represents an early approach to identifying and tracking Listeria bacteria. Using this approach, Listeria is separated into at least 16 serovars, including 13 for L. monocytogenes (serovars 1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4a, 4ab, 4b, 4c, 4d, 4e and 7), 1 for L. ivanovii (serovar 5), 3 for L. innocua (serovars 1/2b, 6a and 6b), 3 for L. welshimeri (serovars 1/2b, 6a and 6b), 6 for L. seeligeri (serovars 1/2a, 1/2b, 3b, 4a, 4b, 4c and 6b), and 1 for L. grayi (serovar Grayi).28–32 The determination of L. monocytogenes serovars has clinical implications, as serovar 4b strains have been shown to cause endemic human listeriosis, and serovars 1/2a, 1/2b and 1/2c are responsible for sporadic listeriosis in humans. Indeed, according to a French study conducted in 2006, L. monocytogenes serovars 4b, 1/2a, 1/2b and 1/2c account for over 98% isolations from clinical cases of human listeriosis, with serovar 4b alone causing 49% of Listeria-related endemic foodborne diseases (Table 1).33 Similarly, in experimental mouse models, L. monocytogenes serovars 4b, 1/2a, 1/2b and 1/2c show a heightened infectivity through intragastric inoculation.34,35 However, all L. monocytogenes serovars except 4a are capable of inducing mouse mortality via intraperitoneal route.36–39

Table 1

L. monocytogenes serovars causing human listeriosis.*

Serotype	No. of isolates (%)	Tendency to cause
4b	294/603 (49%)	CNS infections > M/N diseases > Bacteremia
1/2a	163/603 (27%)	Bacteremia > M/N diseases > CNS infections
1/2b	120/603 (20%)	M/N diseases > Bacteraemia > CNS infections
1/2c	22/603 (4%)	Bacteremia > CNS infections > M/N diseases
3a/3b	4/603 (<1%)	Bacteremia

Adapted from Goulet et al33, which was based on the analysis of 603 L. monocytogenes isolates from 603 French patients during 2001–2003.

Abbreviations: M/N diseases, maternal-neonatal diseases; CNS infections, central nerve system infections.

In light of the extensive antigenic sharing among Listeria serovars (e.g., serovars 1/2a and 3a both contain H antigens A and B; serovars 1/2c and 3c both possess H antigens B and D; serovars 1/2b, 3b, 4a, 4b, 4c, 4d, 5, 6a, 6b and 7 all have H antigens A, B, and C; serovars 1/2a.1/2b, 1/2c, 3a, 3b and3c all share O antigen II; serovars 4a, 4ab, 4b, 4c, 4d, 4e, 5, 6a and 6b all have O antigen V), serotyping lacks desired specificity.40,41 As a consequence, genotyping techniques have been developed to improve the identification and epidemiological tracking of Listeria bacteria.42 This has facilitated the separation of L. monocytogenes bacteria into 4 genetic lineages (I–IV) (Table 2).43–50 While lineage I encompasses serovars 1/2b, 3b, 4b, 4d and 4e; lineage II covers serovars 1/2a, 1/2c, 3a and 3c; lineage III includes serovars 4a and 4c. In addition, lineage III has been further distinguished into subgroup IIIA (containing typical rhamnose-positive avirulent serovar 4a and virulent serovar 4c strains), subgroup IIIC (consisting of atypical rhamnose-negative virulent serovar 4c strains), and subgroup IIIB (which is now known as lineage IV) (covering atypical rhamnose-negative, virulent non-serovar 4a and non-serovar 4c, as well as serovar 7 strains).51

Table 2

Characteristics of L. monocytogenes lineages I–IV.*

Lineage	Serovar	Rhamnose activity	PCR reactivity
			inlA	lmo0733	lmo2672	inlJ	inlC**	lmo1134	ORF2819	ORF2110	lmo0737	lmo1118
I	1/2b	+	+	+	+	+	+	+	+	−	−	−
	3b	+	+	+	+	+	+	+	+	−	−	−
	4b	+	+	+	+	+	+	+	+	+	−	−
	4d	+	+	+	+	+	+	+	+	+	−	−
	4e	+	+	+	+	+	+	+	+	+	−	−
II	1/2a	+	+	+	+	+	+	+	−	−	+	−
	1/2c	+	+	+	+	+	+	+	−	−	+	+
	3a	+	+	+	+	+	+	+	−	−	+	−
	3c	+	+	+	+	+	+	+	−	−	+	+
IIIA	4a	+	+	+	−	−	−	−	−	−	−	−
	4c	+	+	+	−	+	−/+	−	−	−	−	−
IIIC	4c	−	+	+	+	+	+	−	−	−	−	−
IV (IIIB)	7 and unusual 4a,4b,4c	−	+	−	+	−	+	−	+	−	−	−

Summarized from Liu et al36–39; Doumith et al54; Roberts et al.122

inlC is also found in some L. ivanovii strains.38

Genus-Specific Identification

Being small, Gram-positive rods, listeriae resemble other Gram-positive bacteria such as streptococci and corynebacteria morphologically. To differentiate the genus Listeria from other bacterial genera, a batch of biochemical tests has been traditionally employed.32,52,53 Recent application of molecular techniques has simplified the genus-specific identification of listeriae, with the following gene targets being commonly exploited:

the house-keeping genes prs and ldh flanking the prs-prfA-plcA-hly-mpl-actA-plcB-orfX-orfZ-orf B-orfA-ldh cluster, which consists of the well known 9.6 kb PrfA-regulated virulence gene cluster (or Listeria pathogenicity island 1, LIPI-1). While the ldh gene codes for lactate dehydrogenase (~310 amino acids), the prs gene encodes phosphoribosyl pyrophosphate synthetase (318 amino acids).54 Additionally, the underlying gene encoding VclB (Lmo0209/Lin0289), a conserved protein of unknown function, is also found in all Listeria species and can be used for Listeria determination.

the 23S rRNA-16S rRNA locus (consisting of about 1500 and 2500 bp, respectively), which is a highly conserved gene region encoding ribosomal RNA molecules (rRNA). The key functions of rRNA are to decode messenger RNA (mRNA) into amino acids and to interact with the transfer RNA (tRNA) during translation by providing petidyltransferase activity. Because of its conserved nature, the 23S rRNA-16S rRNA locus offers a valuable target for phylogenetic analysis.30,55–58 Paillard et al58 employed primers S2F and S2R to generate an 890 bp fragment from the 5′ end of Listeria rRNA 23S gene. Subsequent digestion of this fragment with restriction enzyme XmnI enabled distinction of L. monocytogenes, L. ivanovii and L. seeligeri (forming 770 and 120 bp bands) from L. innocua, L. welshimeri and L. grayi (forming 650, 120 and 120 bp bands). Moreover, digestion of the 890 bp fragment with restriction enzyme CfoI facilitated differentiation of L. ivanovii, L. seeligeri and L. grayi (forming 600, 170 and 120 bp bands) from L. monocytogenes, L. innocua and L. welshimeri (forming 470, 170, 130 and 120 bp bands).

the iap gene. This gene encodes the “invasion-associated protein” (IAP, also known as P60 reflecting its molecular size of 60 kDa), which is involved in host cell invasion by pathogenic listeriae and acts in all Listeria species as a murein hydrolase necessary for proper cell division. The iap gene has been successfully incorporated in PCR for Listeria genus specific detection.59,60

An added benefit of incorporating a genus-specific primer set in a PCR assay for listerial identification lies in the fact that it also functions as an internal control for the assay.

Species-Specific Identification

Correct identification of Listeria species is critical for effective control and prevention of listeriosis. Previously, phenotype-based methods (such as biochemical and serological tests) have been employed for the speciation of Listeria bacteria.61–63 In view of their superior sensitivity and specificity over the phenotypic methods, molecular techniques have been widely adopted in clinical and research laboratories for discrimination between pathogenic and nonpathogenic Listeria organisms.64,65 Evolving from non-amplified procedures (eg., DNA hybridization), molecular detection of Listeria bacteria has increasingly moved towards nucleic acid amplification and real time detection.66–69

The identification of a range of gene targets has further enhanced the appeal and versatility of molecular procedures for Listeria species-specific determination. While several shared genes such as 16S and 23S rRNA genes, their intergenic spacer regions, ssrA gene (which encodes a transfer-messenger RNA or tmRNA), and iap (which encodes invasion associated protein) have proven valuable for identification of all Listeria species,56,58,59,70–77 many Listeria species-specific genes have been described. For instance, the following genes targets may be used for specific determination of L. monocytogenes: hly,78,79plcA,80plcB,80actA,81inlA,82,83inlB,83,84lmaA/lmaB,85flaA,86pepC,87clpE,81fbp,88lmo0733,89 and lmo223490 Similarly, liv22–22891 and smcL92 have been specifically targeted for L. ivanovii, lse24–31593 for L. seeligeri, lin046494 and lin248395 for L. innocua, fbp,88lwe7–57196 and lwe180197 for L. welshimeri, and lgr20–24698 for L. grayi.

Lineage Delineation

As L. monocytogenes lineages I (particularly serovars 1/2b and 4b) and II (especially serovars 1/2a and 1/2c) strains are commonly associated with human clinical cases, it is important that they are accurately identified and subtyped.99–101

Similar to species-specific identification, 2 major approaches are used for L. monocytogenes lineage delineation and subtyping: phenotypic and genetic.102 The phenotypic subtyping approach utilizes serotyping, phage typing, multilocus enzyme electrophoresis (MLEE) and esterase typing techniques.103 The genetic subtyping approach ranges from pulsed-field gel electrophoresis (PFGE), ribotyping, PCR-based subtyping [e.g., random amplification of polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), PCR-restriction fragment length polymorphism (PCR-RFLP), repetitive element PCR (REP-PCR)], to DNA sequencing-based subtyping techniques [such as multilocus sequence typing (MLST)].30,43–45,55,57,104–118 With its high sensitivity, discriminatory power and reproducibility, the genetic subtyping approach offers a method of choice for the laboratory determination of L. monocytogenes lineages and subtypes. In particular, a combination of 2 or more subtyping techniques helps clarify the ambiguity that can be encountered when a single typing method is used.119–121

Due to their sequence divergences among Listeria serovars, the actA and plcB genes have been often targeted for the determination of L. monocytogenes lineages and genotypes.44,113,120,122 Analyses of 2 housekeeping genes (ribC and purM) together with 2 virulence genes (actA and inlA) uncovered evidence of a more prevalent recombination in lineage II than in lineage I.123 Moreover, comparisons of the actA gene sequences of L. seeligeri isolates from different habitats permitted discrimination of 2 different actA subtypes forming 2 phylogenetic lineages.124

Another important group of gene targets for Listeria lineage determination is internalin genes. Through sequencing analysis of the ascB-dapE internalin cluster, Chen et al125 showed that L. monocytogenes lineage II can be distinguished into 3 distinct sublineages, IIA, IIB, and IIC, with inlGHE, inlGC2DE, and inlC2DE for IIA, IIB, and IIC, respectively. While IIA and IIC displayed a higher frequency of recombination, IIB was more notably affected, leading to high nucleotide diversity. Furthermore, internalin profiling of 13 L. monocytogenes lineage III strains identified 10 internalin types that are clustered in 4 subpopulations IIIA–1, IIIA–2, HIB, and IIIC. Whereas lineage IIIA–2 strains had reduced pathogenicity, the other lineage III strains had comparable virulence to lineages I and II. Because of its phylogenetical distinction from other sub-populations, HIB may represent a novel lineage.126 Similarly, examination of internalin genes of L. innocua resulted in the identification of 4 subgroups within the species.127

Group-Specific Identification

Given the predominance of L. monocytogenes serovars 4b, 1/2a, 1/2c and 1/2b in human clinical isolations, the availability of methods to determine the serotype of a particular strain is vital for its epidemiological tracking and therapeutic monitoring (Table 3). Although conventional serotyping methods have played a valuable role in the tracking of L. monocytogenes isolates involved in listeriosis, they are sometimes unable to correlate serovars directly with species identities, and are expensive to set up and maintain.40,128,129 Without these obvious shortcomings, molecular techniques provide a precise and low-cost alternative for determination of L. monocytogenes serovars/groups.130,131

Table 3

L. monocytogenes group-specific gene targets.

Gene	Specificity	Reference
inlJ (lmo2821)	All L. monocytogenes serovars but 4a	Liu et al36–39
lmo2470	All L. monocytogenes serovars but 4a and some 4c	Liu et al36
inlC	All L. monocytogenes serovars but 4a and some 4c	Liu et al38
lmo2672	All L. monocytogenes serovars but 4a and some 4c	Liu et al36,37
lmo1134	All L. monocytogenes serovars but 4a and 4c	Liu et al36
lmaA	All L. monocytogenes serovars but 4a and 4c	Schaferkordt and Chakraborty79
lmaB	All L. monocytogenes serovars but 4a and 4c	Schaferkordt and Chakraborty79
lmo0038	All L. monocytogenes serovars but 4a and 4c	Chen et al100
ORF2819	L. monocytogenes serovars 1/2b, 3b, 4b, 4d, 4e and 7	Doumith et al54
ORF2110	L. monocytogenes serovars 4b, 4d and 4e	Doumith et al54
ORF2372	L. monocytogenes serovars 4b, 4d and 4e	Zhang and Knabel135
lmo0737	L. monocytogenes serovars 1/2a, 1/2c, 3a and 3c	Doumith et al54
lmo0171	L. monocytogenes serovars 1/2a, 1/2c, 3a and 3c	Zhang and Knabel135
lmo1118	L. monocytogenes serovars 1/2c and 3c	Doumith et al54
Gene region flanking gltA-gltB	L. monocytogenes serovars 1/2b and 3b	Borucki and Call133
flaA	L. monocytogenes serovars 1/2a and 3a	Borucki and Call133

Jinneman and Hill132 reported a mismatch amplification mutation assay (MAMA) targeting a 446-bp region within the hly gene for rapid screening and characterization of L. monocytogenes lineage types I–III. Borucki and Call133 utilized primers from an iron transport protein gene, GLT primers (from a 1/2b serotype-specific region flanking the gltA-gltB cassette), the MAMA-C PCR primers,132 and primers from the flaA gene (encoding the L. monocytogenes flagellin protein) to identify L. monocytogenes serotypes. Doumith et al54,134 developed a multiplex PCR that incorporates L. monocytogenes lmo0737 gene primers for recognition of serovars 1/2a, 1/2c, 3a, and 3c; lmo1118 gene primers for detection of serovars 1/2c and 3c; ORF2819 primers for serovars 1/2b, 3b, 4b, 4d, and 4e; ORF2110 primers for serovars 4b, 4d, and 4e; and prs primers as an internal amplification control covering all L. monocytogenes serovars. Zhang and Knabel135 described a multiplex PCR assay for rapid identification and easily interpretable differentiation of serovars 1/2a and 4b from other serovars of L. monocytogenes by simultaneously targeting 2 virulence genes (inlB and inlC ) and 2 serovar-specific genes (ORF2372 and lmo0171). Nightingale et al136 combined a multiplex PCR with sigB allelic typing to classify the 4 major serovars (i.e., 1/2a, 1/2b, 1/2c, and 4b) into unique genetic subgroups, and to differentiate lineage I serovar 4b isolates from the genetically distinct lineage III serovar 4b isolates. More recently, Kérouanton et al137 designed 2 multiplex PCR assays to cluster L. monocytogenes strains into 5 molecular serogroups: IIa, IIb, IIc, IVa, and IVb. The first multiplex PCR recognizes L. monocytogenes serotypes 1/2a, 1/2c, 1/2b and 4b, together with the prfA gene primers for L. monocytogenes species confirmation. The second multiplex PCR incorporating the flaA gene primers (specific for 1/2a and 3a strains) and prs gene primers (specific for Listeria genus) resolves a small number of IIa and IIc molecular serogroup strains (consisting of serotypes atypical 1/2a, 3a and 1/2c strains) that give equivocal results in the first multiplex PCR, leading to a total agreement between molecular and conventional serotyping methods.

In addition, by using primers from inlA for species-specific recognition, and those from inlJ (or lmo2821) and inlC for virulence determination in a multiplex PCR, L. monocytogenes naturally avirulent serovar 4a strains were rapidly differentiated from other serovars that have the potential to cause mouse mortality via the intraperitoneal route.37

Identification of Epidemic Clones

Although a variety of L. monocytogenes strains have been isolated from environments and foodstuff, only a limited number of virulent strains are known to cause listeriosis epidemics, particularly of those belonging to serovars 4b, 1/2a, and 1/2b.138–141 The term “epidemic clone” refers to a group of genetically related isolates of a common ancestor that are implicated in geographically and temporally unrelated outbreaks.142 To date, 5 epidemic clones (ECs) of L. monocytogenes (ECI, ECII, ECIII, ECIV, and ECV) have been defined (Table 4).60,142–146

Table 4

Listeria monocytogenes epidemic clones.

Epidemic clone (EC)	Serovar	Ribotype	MVLST ST (VT)#	Molecular marker	Outbreak involved	Reference
ECI	4b	DUP-1038B	20	LMOf2365_2798 (AATAGAAATAAGCGGAAGTGT/TTATTTCCTGTCGGCTTAG) 303 bp	Nova Scotia, 1981California, 1985Switzerland, 1983–1987Denmark, 1985–1987France, 1992	Chen and Knabel60; Yildirim et al151
ECII	4b	DUP-1044A	19	LMOh7858_0487.8 to inlA (ATTATGCCAAGTGGTTACGGA/ATCTGTTTGCGAGACCGTGTC) 889 bp	USA, 1998–1999USA, 2002	Chen and Knabel60; Evans et al138
ECIII	1/2a	DUP-1053A	1	LMOF6854_2463.4 (TTGCTAATTCTGATGCGTTGG/GCGCTAGGGAATAGTAAAGG) 497 bp	USA, 2000	Chen and Knabel60
ECIV (formerly ECIa)	4b	DUP-1042B	21	Reactive with 4b-specific primers (ORF2110), but not with LMOf2365_2798 and LMOh7858_0487primers	Boston, 1979,1983UK, 1989	Chen and Knabel60
ECV	1/2a		59	LM5578_2229 (TTGTTGAAGGAAGAGGTGGTC/TCTTTTCGGCTCATTTTCGT) 191 bpLM5578_2228_30 (CTGGTGTTGCCTCCTTTGTT/AGCACAGGGTTCCTTTGACA) 982 bp	Canada, 1988–2000	Knabel et al145

Multi-virulence-locus sequence typing (MVLST) sequence types (Virulence Types, VTs) were assigned according to Chen et al.60

Sources: Chen Y, Zhang W, and Knabel SJ. J Clin Microbiol. 2007;45:835. Knabel SJ, et al. J Clin Microbiol. 2012;50:1748.

Identification and tracking of L. monocytogenes epidemic clones are critical to understanding the long-term transmission of L. monocytogenes and to establishing efficient surveillance systems for this pathogen.147–149 The methods for the identification of L. monocytogenes epidemic clones have evolved over the years from the phenotypic (e.g., serotyping and phage typing) to genotypic methods.150–153 The latter include the fragment-based typing methods, which range from (i) restriction digestion-based methods such as ribotyping (RT) and pulsed-field gel electrophoresis (PFGE) and (ii) PCR-based methods such as randomly amplified polymorphic DNA and repetitive sequence-based PCR to (iii) combined amplification-restriction methods such as amplified fragment length polymorphism (at endonuclease restriction or primer annealing sites) and PCR-restriction fragment length polymorphism. This was followed by DNA sequence-based methods such as multilocus sequence typing (MLST) that combines PCR and automated DNA sequencing to analyze slowly diversified housekeeping gene sequences.154 More recently, multi-virulence-locus sequence typing (MVLST, targeting virulence genes prfA, inlB, inlC, dal, clpP, and lisR) was developed to overcome the limited discriminatory power associated with MLST, allowing categorization of L. monocytogenes isolates into higher-level groups, such as evolutionary lineages, clonal complexes, and epidemic clones.90,155 Indeed, Knabel et al145 employed multilocus sequence typing (MLST) and multi-virulence-locus sequence typing (MVLST) to identify a predominant clone (clonal complex 8; virulence type 59; proposed epidemic clone 5 [ECV]) belonging to serotype 1/2a that has caused human illness across Canada for more than 2 decades.

To further streamline the identification of L. monocytogenes epidemic clones, Chen and Knabel60 developed a multiplex PCR assay that facilitated simultaneous detection of Listeria genus, L. monocytogenes serovar 1/2a and 4b, and L. monocytogenes epidemic clones I, II, and III. This multiplex PCR assay offers a powerful tool to screen and subgroup L. monocytogenes cultures and significantly reduces the number of isolates that need to be subtyped by more expensive and discriminatory molecular methods, such as PFGE and sequence-based typing.

Conclusion

The genus Listeria contains 10 closely related Gram-positive bacterial species with ubiquitous distribution. Although a majority of Listeria species are nonpathogenic, L. monocytogenesis is a well known pathogen of both humans and animals, and L. ivanovii causes severe diseases in ungulates. For the epidemiological tracking and control of listeriosis outbreaks, it is important to distinguish beween pathogenic and nonpathogenic Listeria species, as well as between pathogenic and nonpathogenic L. monocytogenes strains. While traditional phenotypic methods have contributed to the identification and detection of Listeria organisms in the past, they are largely overtaken by new generation molecular techniques that demonstrate superior sensitivity, specificity and speed. It is envisaged that continuing innovations such as microarrays, biosensors, and next generation sequencing will offer promise to further improve the sensitivity, rapidity and specificity of laboratory characterization of Listeria genus, species, lineages, serovars and epidemic clones.