Literature DB >> 24809003

Identification of a Geranylgeranyl reductase gene for chlorophyll synthesis in rice.

Pingyu Wang1, Chunmei Li1, Yang Wang1, Rui Huang1, Changhui Sun1, Zhengjun Xu1, Jianqing Zhu1, Xiaoling Gao1, Xiaojian Deng1, Pingrong Wang1.   

Abstract

Geranylgeranyl reductase (CHL P) catalyzes the reduction of geranylgeranyl diphosphate to phytyl diphosphate, and provides phytol for both Chlorophyll (Chl) and tocopherol synthesis. In this study, we isolated a yellow-green leaf mutant, 502ys, in rice (Oryza sativa). The mutant exhibited reduced level of Chls, arrested development of chloroplasts, and retarded growth rate. The phenotype of the 502ys mutant was controlled by by a recessive mutation in a nuclear gene on the long arm of rice chromosome 2. Map-based cloning of the mutant resulted in the identification of an OsChl P gene (LOC_Os02g51080). In the 502ys mutant, a single base pair mutation was detected at residue 1279 in DNA sequence of the gene, resulting in an amino acid change (Gly-206 to Ser) in the encoded protein. HPLC analysis of Chls indicated that the majority of Chl molecules are conjugated with an unsaturated geranylgeraniol side chain, in addition to small amount of normal Chls in the mutant. Furthermore, the mutant phenotype was complemented by transformation with the wild-type gene. Therefore, this study has confirmed the 502ys mutant resulted from a single base pair mutation in OsChl P gene.

Entities:  

Keywords:  Chl P gene; Chlorophyll; Geranylgeranyl reductase; Rice

Year:  2014        PMID: 24809003      PMCID: PMC4008729          DOI: 10.1186/2193-1801-3-201

Source DB:  PubMed          Journal:  Springerplus        ISSN: 2193-1801


Introduction

Chlorophyll (Chl) is the main component of the photosynthetic pigments. Chl molecules consist of two parts: a hydrophilic tetrapyrrole moiety (chlorophyllide, Chlide) and a hydrophobic alcohol moiety (phytyl, Phy), which are formed from the precursor molecules glutamyl-tRNA and isopentenyl diphosphate, respectively, in two different pathways of tetrapyrrole and isoprenoid biosynthesis. The tetrapyrrole biosynthesis, entirely locating in plastids, has been extensively studied with various organisms by biochemical and genetic methods. So far, almost all genes for 15 steps of tetrapyrrole biosynthetic pathway have been identified in higher plants represented by Arabidopsis (Beale 2005;Nagata et al. 2005;Wu et al. 2007;Islam et al. 2008;Wang et al. 20102013;Sakuraba et al. 2013). The branched isoprenoid pathway is rather complex and comprises enzymatic steps in at least two compartments. In plants, Phy represents the side chain of Chls, tocopherols (TP) and phylloquinones, and is necessary for their integration into plastidmembranes (Soll et al. 19801983;Soll 1987;Bollivar et al. 1994). In both Chl and TP synthesis, the Phy chain is provided by geranylgeranyl pyrophosphate (GGPP), a plastidial isoprenoid, formed by four molecules of isopentenyl pyrophosphate (IPP), which are derived from the cytosolic and chloroplastidic pathways (Rohmer et al. 1993;Lichtentaler et al. 1997). In Chl synthesis, GGPP can either be reduced to phytyl pyrophosphate (PhyPP) and esterified with Chlide to generate phytyl Chl (ChlPhy), or first esterified with Chlide to form geranylgeranylated Chl (ChlGG) and then stepwise reduced into ChlPhy (Soll et al. 1983;Bollivar et al. 1994;Keller et al. 1998;Chew et al. 2008). In the TP pathway, tocopherols are generally believed to arise from the condensation of homogentisic acid and PhyPP (Schultz et al. 1985;Soll et al. 1980;Collakova and DellaPenna 2001;Savidge et al. 2002;Cahoon et al. 2003). Therefore, CHL P is demonstrated to provide Phy for both Chl and TP synthesis. CHL P catalyzes the reduction of ChlGGa into ChlPhya as well as the reduction of free GGPP into PhyPP (Keller et al. 1998). Genes encoding CHL P have been characterized in photosynthetic bacteria such as Syneclrocystis sp. PCC6803, Rhodobacter sphaeroides and Chlorobaculum tepidum (Addlesee et al. 1996;Addlesee and Hunter. 1999;Chew et al. 2008), and in higher plants such as Arabidopsis (Arabidopsis thaliana), tobacco (Nicotiana tabacum), peach (Prunus persica), olive (Olea europaea) and sesame (Sesamum indicum) (Keller et al. 1998;Tanaka et al. 1999;Giannino et al. 2004;Bruno et al. 2009;Park et al. 2010). But until recently, no Chl P gene was identified in monocotyledonous plants (Zhou et al. 2013). In this study, we isolated a rice yellow-green leaf mutant, 502ys, from ethyl methanesulfonate (EMS) mutagenesis. The mutant exhibited reduced level of Chls, arrested development of chloroplasts, and retarded growth rate. Map-based cloning of the mutant resulted in identification of the OsChl P gene. In the 502ys mutant, a single base pair mutation was detected in DNA sequence of the gene, resulting in an amino acid change in the encoded protein. HPLC analysis of Chls indicated that the majority of Chls molecules are conjugated with an unsaturated geranylgeraniol side chain, in addition to small amount of normal Chls in the mutant. Furthermore, the mutant phenotype was complemented by transformation with the wild-type gene. Therefore, this study has confirmed the 502ys mutant resulted from a single base pair mutation in OsChl P gene.

Materials and methods

Plant materials and mapping population

The 502ys mutant was a yellow-green leaf mutant isolated from the progeny of japonica cv Nipponbare treated with 0.7% of ethyl methanesulfonate (v: v, Sigma). The F2 mapping population was generated by crossing the 502ys mutant with normal green indica cv Minghui 63. All rice materials were planted under natural conditions in April to August, in Wenjiang District (Latitude 30°42′N, Longitude 103°50′E, and Altitude 539.3 m), Chengdu City, Sichuan, China.

Marker development

The SSR markers were obtained from Gramene (http://archive.gramene.org/markers/microsat/) based on the SSR linkage map constructed by McCouch et al. (2002). To narrow down the region of the target locus, the BLAST search in the National Center for Biotechnology Information database was conducted to find insertion/deletion (InDel) sequence divergence between japonica cv Nipponbare and indica cv 9311 around this locus (http://www.ncbi.nlm.nih.gov/BLAST/), and InDel markers were designed around the sequence divergence including 15 to 100 bp InDel using the Primer 5.0 software.

Sequence analysis

The full-length DNA and protein sequences of OsChl P and its homologs were retrieved from GenBank (http://www.ncbi.nlm.nih.gov). The chloroplast signal peptide was predicted with http://www.cbs.dtu.dk/services/TargetP (Emanuelsson et al. 2000). Multiple sequence alignment and phylogenetic analysis were conducted using DNAMAN version 6.0 (Lynnon Biosoft).

Transmission electron microscopy analysis

Rice leaf samples of 502ys and Nipponbare were harvested from four-week-old seedlings grown in natural conditions. Leaf sections were fixed in a solution of 3% glutaraldehyde and post-fixed with 1% osmium tetroxide. The tissues were dehydrated in a gradient acetone series and embedded in Epon812 medium prior to thin sectioning. The samples were stained with uranyl acetate and Reynolds’ lead citrate, and observed under a transmission electron microscope (Hitachi H-600IV, Japan).

Analysis of pigments

Chls were extracted from 0.2 g fresh leaves of the 502ys mutant and its wild-type Nipponbare with 80% acetone, and Chl contents were determined with UV-1700 UV-visible spectrophotometer (Shimadzu) according to the method of Arnon (1949). Chls used for HPLC analysis were extracted from fresh rice leaf tissue of four-week-old 502ys and wild-type plants with 100% acetone. The extract was centrifuged at 7,197 g (Eppendorf 5430R; 7,830 rpm) for 15 min, and the supernatants were subjected to HPLC on a C18 column (Eclipse XDB-C18, 4.6 mm i.d. × 150 mm long, 5 μm; Agilent) and eluted with solvent (methanol: acetonitrile: acetone = 1:3:1) at a flow-rate of 1.0 mL min−1 at 40°C, as previously described (Zapata et al. 2000;Nakanishi et al. 2005;Tanaka et al. 19992010;Zhou et al. 2013). Elution profiles were monitored by measuring A660, and Chl a and b standards (Sigma) were used as control.

Complementation of the 502ys mutant

For complementation of the 502ys mutation, the full-length 2,141-bp OsChl P (LOC_Os02g51080) gene was amplified using primer 1 F (5′-ACATCTAGAATGACCTCGCTGTCGTCC-3′) and primer 1R (5′-AGCCTGCAGTCACAAGGTGACCTTCTC-3′) from the wild-type Nipponbare. The primers incorporated an XbaI site at the N-terminal end and a PstI site at the C-terminal end of the gene. The PCR products were inserted into the pMD19-T vector (TaKaRa) and sequenced to obtain the correct clone pMD-OsChl P. The pMD-OsChl P plasmid was then digested with XbaI and PstI, and cloned into the corresponding site of the binary vector pCAMBIA2300. The resulting pC2300-OsChl P plasmid, which contained the OsChl P sequence driven by the actin 1 promoter, was introduced into Agrobacterium tumefaciens strain EHA105, and transformed to the 502ys mutant for complementation test. To identify whether the wild-type OsChl P gene were inserted into the mutant, the 502ys mutant and its transgenic plants were amplified using primer 2 F (5′-GAATCCCTCAGCATTGTTC-3′) and primer 2R (5′-AGGGCAGCATAAATCAAGT-3′) that were designed to anneal to sequences located on the actin 1 promoter and OsChl P gene, respectively, in which the PCR conditions were: 94°C for 3 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 1 min; and finally 72°C for 7 min.

Results

Characteristics of the 502ys mutant

The 502ys mutant was isolated from japonica rice cv Nipponbare via EMS mutagenesis. The mutant exhibited a yellow-green leaf phenotype throughout development and retarded growth rate (Figure 1). Although its days to heading increased 10.4 d, its height of plants and number of productive panicles decreased by 9.8% and 44.0% compared with the wild type, respectively (Table 1). Besides, its seed-setting rate and 1000-grain weight also declined by 9.1% and 6.2%, respectively.
Figure 1

Plant phenotype of the mutant. a. Four-week-old plants of wild-type Nipponbare (left) and 502ys mutant (right). b. Plants of wild-type Nipponbare (left) and 502ys mutant (right) at mature stage.

Table 1

Comparison of major agronomic traits between the mutant and its wild-type Nipponbare

TraitsNipponbare (WT) 502ys Compared with WT (%)
Days to heading (d)87.3 ± 0.697.7 ± 2.5+11.9%*
Plant height (cm)104.0 ± 2.493.8 ± 1.6−9.8%*
No. of productive panicles per plant10.9 ± 0.76.1 ± 0.6−44.0%*
No. of spikelets per panicle116.3 ± 3.2113.1 ± 2.4−2.8%
Seed-setting rate (%)87.4 ± 2.578.3 ± 1.9−9.1%*
1000-grain weight (g)27.4 ± 0.325.7 ± 0.4−6.2%*

*Significantly different at P = 0.05.

Plant phenotype of the mutant. a. Four-week-old plants of wild-type Nipponbare (left) and 502ys mutant (right). b. Plants of wild-type Nipponbare (left) and 502ys mutant (right) at mature stage. Comparison of major agronomic traits between the mutant and its wild-type Nipponbare *Significantly different at P = 0.05. To characterize the yellow-green phenotype of the 502ys mutant, we measured its Chl contents, and found its contents of Chl a, b, and total Chls to be 28.4% to 72.8%, 17.6% to 50.7%, and 26.2% to 67.3% of those in wild type, respectively (Table 2), which indicated that the mutant phenotype resulted from reduced Chl level.
Table 2

Pigment contents in leaves of the mutant and its wild-type Nipponbare, in mg g fresh weight

Growth stageLineTotal ChlChla a Chlb a Chl a/b Ratio
Seedling stageWild-type2.84 ± 0.192.13 ± 0.100.71 ± 0.093.00 ± 0.14
502ys 1.91 ± 0.081.55 ± 0.090.36 ± 0.034.31 ± 0.32
Heading stageWild-type3.36 ± 0.032.68 ± 0.020.68 ± 0.063.94 ± 0.22
502ys 0.88 ± 0.040.76 ± 0.020.12 ± 0.026.33 ± 0.48

aChls were measured in 80% acetone extracts from the first, second and third leaves from the top at indicated growth stages. Values shown are the mean ± SD from five independent determinations.

Pigment contents in leaves of the mutant and its wild-type Nipponbare, in mg g fresh weight aChls were measured in 80% acetone extracts from the first, second and third leaves from the top at indicated growth stages. Values shown are the mean ± SD from five independent determinations. To explore whether low Chl content in the mutant leaves affects the chloroplast development and morphology, we examined the ultrastructure of chloroplast using transmission electron microscopy. In wild type, the chloroplasts displayed well-developed membrane systems composed of grana connected by stroma lamellae (Figure 2a and b). However, the grana stacks in the 502ys mutant appeared less dense compared with that in wild type. The thylakoid membrane systems of the mutant chloroplasts were disturbed, and the membrane spacing was not as clear as that in wild-type chloroplasts. In addition, the mutant chloroplasts exhibited vacuolation (Figure 2c and d). These results indicated that the development of chloroplast was suppressed in the 502ys mutant.
Figure 2

Electron microscopic analysis of the rice mutant. a. and b. Mesophyll cells and chloroplast of wild-type Nipponbare, respectively. c. and d. Mesophyll cell and chloroplast of 502ys mutant, respectively. Bar equals 1 μm.

Electron microscopic analysis of the rice mutant. a. and b. Mesophyll cells and chloroplast of wild-type Nipponbare, respectively. c. and d. Mesophyll cell and chloroplast of 502ys mutant, respectively. Bar equals 1 μm.

Map-based cloning of the mutant gene

The 502ys mutant was crossed with normal green variety Minghui 63 and wild-type Nipponbare. As result, all F1 plants displayed normal green phenotype. F2 population from the two crosses showed a segregation ratio of 3:1 (green:yellow-green plants, χ2 < χ20.05 = 3.84, P > 0.05). The data suggested that the yellow-green phenotype of 502ys mutant is controlled by a single recessive nuclear gene. To map the 502ys locus, an F2 mapping population was generated from the cross between the 502ys mutant with Minghui 63 (an indica cultivar). The 502ys mutant gene was mapped to an interval between the SSR markers RM318 and RM240 on the long arm of chromosome 2 (Figure 3a). To further define the position of the 502ys gene, six InDel makers were developed (Table 3). As result, the 502ys locus was narrowed down to a 61-kb region between the two InDel makers Y3 and Y4 (Figure 3b).
Figure 3

Fine mapping of the locus al. The 502ys locus was mapped to a region between InDel marker Y1 and SSR marker RM240 on the long arm of rice chromosome 2. b. The 502ys locus was finely mapped to a region between InDel markers Y3 and Y4. c. The 61-kb region contains eight putative genes. d. The candidate LOC_Os02g51080 gene is comprised of three exons and two introns, and a single nucleotide G-to-A substitution at position 1279 of its coding region was found in the 502ys mutant.

Table 3

Insertion/deletion (InDel) makers used for fine mapping of the locus

MakerForward primer (5′ 3′)Reverse primer (5′ 3′)
Y1GAAGATGATGCCAACTGAGAGCCAATCCACAATACA
Y2CCTCCTTAACTTTGCCTCTGAGCCAGTAATAGCGTCCTCA
Y3CCGTGGTTCAGTCAAAGAAACGCGGTGATACATTCC
Y4TATGGACGAGATGAGGAGTAAGAGGCAGGTTGAAAA
Y5AGAGGCGAGGAGGATTGGAGGGCAGTAGCAGTGCAAGA
Fine mapping of the locus al. The 502ys locus was mapped to a region between InDel marker Y1 and SSR marker RM240 on the long arm of rice chromosome 2. b. The 502ys locus was finely mapped to a region between InDel markers Y3 and Y4. c. The 61-kb region contains eight putative genes. d. The candidate LOC_Os02g51080 gene is comprised of three exons and two introns, and a single nucleotide G-to-A substitution at position 1279 of its coding region was found in the 502ys mutant. Insertion/deletion (InDel) makers used for fine mapping of the locus Within the Y3 and Y4 region, eight putative genes had been annotated in Rice Genome Annotation Project (http://rice.plantbiology.msu.edu). According to recombinants between the two InDel markers and the 502ys mutant gene, we found one gene (LOC_Os02g51080) encoding a putative FAD binding domain containing protein, and sequence BLAST showed its encoded product has a significant similarity to CHL P (73% identities) in Arabidopsis. Then, we cloned the LOC_Os02g51080 gene from the 502ys mutant and its wild-type, respectively. DNA sequencing results revealed a single nucleotide G-to-A substitution at position 1279 of its coding region in 502ys mutant. Next, its cDNA sequence was amplified by reverse transcription (RT)-PCR, and the G-to-A substitution at codon 616 (corresponding to position 1279 in the coding region) was confirmed in the mutant, which resulted in an amino acid change from Gly-206 to Ser (Figure 3d) in the encoded protein. Thus, LOC_Os02g51080 gene was considered as the candidate gene of 502ys, and designated tentatively as OsChl P gene. In addition, we also sequenced the 1975-bp upsteam of LOC_Os02g51080 gene and found its promoter region did not change in the 502ys mutant.

Characterization of the OsChl P gene

Sequence comparison between genomic DNA and cDNA revealed that the OsChl P gene is comprised of three exons and two introns. The cDNA sequence of OsChl P consists of 1392 bp and encodes a 463-amino acid protein with a molecular mass of approximately 50 kD. OsCHL P protein contains an apparent chloroplast-targeting sequence of 37 amino acid residues at its N terminus (http://www.cbs.dtu.dk/services/TargetP/; Additional file 1: Figure S1). BlastP search indicated that CHL P exists widely in various species, including higher plant, moss, Chlorophyceae and Cyanobacteria. Multiple amino acid sequence alignment suggested that OsCHL P has a high similarity to monocotyledonous plant sorghum (Sorghum bicolor), maize (Zea mays) and wheat (Triticum aestivum) CHL P, and dicotyledons plant cucumer (Cucumis sativus) and Arabidopsis CHL P, with identity of 93%, 92%, 91%, 81% and 73%, respectively. In addition, OsCHL P is also 77% and 76% identical to CHL P proteins in fruiter species, olive and peach, respectively (Additional file 1: Figure S1). At the same time, we analyzed the possible phylogenetic relationships between OsCHL P and its related proteins from higher plants and other photosynthetic organisms, indicating that the OsCHL P is more closely related to CHL P proteins from the monocotyledonous plants sorghum, maize and wheat than to those of other species (Figure 4).
Figure 4

Phylogenetic tree representing alignment of OsCHL P protein and its homologues. The rooted neighbor-joining tree using percentage identities was constructed based on a multiple sequence alignment generated with the program DNAMAN. Accession numbers for the respective protein sequences are as follows: Oryza sativa (OsCHL P, LOC_Os02g51080), Sorghum bicolor (SbCHL P, XP_002454287), Zea mays (ZmCHL P, NP_001149382), Triticum aestivum (TaCHL P, AAZ67145), Arabidopsis thaliana (AtCHL P, CAA74372), Cucumis sativus (CsCHL P, XP_004138167), Prunus persica (PpCHL P, EMJ10306), Sesamum indicum (SiCHL P, ADK35887), Olea europaea (OeCHL P, ABD73016), Synechocystis sp. PCC 6803 (Chl P, NP_441659), Chlorobium tepidum TLS (CT2225, AAM73471), Rhodobacter sphaeroides (bch P, AAF24283). Scale represents percentage substitution per site.

Phylogenetic tree representing alignment of OsCHL P protein and its homologues. The rooted neighbor-joining tree using percentage identities was constructed based on a multiple sequence alignment generated with the program DNAMAN. Accession numbers for the respective protein sequences are as follows: Oryza sativa (OsCHL P, LOC_Os02g51080), Sorghum bicolor (SbCHL P, XP_002454287), Zea mays (ZmCHL P, NP_001149382), Triticum aestivum (TaCHL P, AAZ67145), Arabidopsis thaliana (AtCHL P, CAA74372), Cucumis sativus (CsCHL P, XP_004138167), Prunus persica (PpCHL P, EMJ10306), Sesamum indicum (SiCHL P, ADK35887), Olea europaea (OeCHL P, ABD73016), Synechocystis sp. PCC 6803 (Chl P, NP_441659), Chlorobium tepidum TLS (CT2225, AAM73471), Rhodobacter sphaeroides (bch P, AAF24283). Scale represents percentage substitution per site.

Analysis of chlorophylls

Because CHL P catalyzes the reduction of ChlGG to ChlPhy (Keller et al. 1998), the final product of Chl biosynthesis should be ChlGG when the plants have a defect in CHL P. So we examined Chl compositions of the 502ys mutant by HPLC. The result showed that the majority of Chl molecules in the mutant were conjugated with an unsaturated geranylgeraniol side chain, in addition to small amount of normal ChlPhy (Figure 5;Tanaka et al. 2010;Zhou et al. 2013), indicated that the mutant has a defective OsCHL P. Therefore, we concluded the candidate gene underlying the 502ys mutant phenotype is OsChl P.
Figure 5

HPLC analysis of Chls. The elution profiles of wild type (a), 502ys mutant (b) and 502ys/OsCHL P transgenic line (c) were detected at 660 nm. Peak 1, Chl b; peak 2, Chl a; peak 3, 4 and 5, ChlTHGG a, ChlDHGG a and ChlGG a, respectively; peak 6, ChlGG b. The absorption spectra of the peaks 1 and 6 (d) and the peaks 2, 3, 4 and 5 (e) in acetone were compared, respectively.

HPLC analysis of Chls. The elution profiles of wild type (a), 502ys mutant (b) and 502ys/OsCHL P transgenic line (c) were detected at 660 nm. Peak 1, Chl b; peak 2, Chl a; peak 3, 4 and 5, ChlTHGG a, ChlDHGG a and ChlGG a, respectively; peak 6, ChlGG b. The absorption spectra of the peaks 1 and 6 (d) and the peaks 2, 3, 4 and 5 (e) in acetone were compared, respectively.

Complementation analysis

The identity of OsChl P was subsequently confirmed by genetic complementation experiments. The plasmid pC2300-OsChl P, containing the entire OsChl P (LOC_Os02g51080) genomic sequence of the wild-type Nipponbare under the control of the actin 1 promoter, was introduced into the 502ys mutant, and 87 independent transgenic lines were obtained. Among them, 78 PCR-positive lines showed a complementation of the 502ys phenotype and their growth rates were nearly identical to those of wild-type plants, whereas the other 9 PCR-negative lines failed to rescue the 502ys mutant (Figure 6). Furthermore, HPLC analyses confirmed that the PCR-positive transgenic lines containing the wild-type OsChl P gene all accumulated normal Chlphy (Figure 5C). Therefore, we concluded that we succeeded to clone Chl P gene in rice, and that the 502ys mutant resulted from a single base pair mutation in OsChl P gene.
Figure 6

Complementation of the mutant by the wild-type gene. a. Phenotype of T0 transgenic plants. Arrowheads indicated PCR-negative transgenic plants, the others plants were PCR-positive transgenic plants. b. Identification of transgenic plants by PCR. M, DL-2000 marker; 1 and 2, PCR-positive transgenic plants; 3, The 502ys mutant (PCR-negative control) or PCR-negative transgenic plants; 4, pC2300-OsChl P plasmid (control).

Complementation of the mutant by the wild-type gene. a. Phenotype of T0 transgenic plants. Arrowheads indicated PCR-negative transgenic plants, the others plants were PCR-positive transgenic plants. b. Identification of transgenic plants by PCR. M, DL-2000 marker; 1 and 2, PCR-positive transgenic plants; 3, The 502ys mutant (PCR-negative control) or PCR-negative transgenic plants; 4, pC2300-OsChl P plasmid (control).

Discussion

CHL P reduces GGPP to PhyPP and provides the side chain for Chl, tocopherols, and plastoquinones, which is prerequisite to their integration into plastid membranes (Soll et al. 19801983;Soll 1987;Bollivar et al. 1994;Graßes et al. 2001;Giannino et al. 2004). Addlesee et al. (1996) cloned the chlP gene from the cyanobacterium Syneclrocystis sp. PCC 6803, and subsequently demonstrated this cyanobacterium gene was able to partially complement a bchP mutant of purple photosynthetic bacterium R. sphaeroides. Addlesee and Hunter (1999) identified the bchP gene in Rhodobacter sphaeroides transposon mutant, and demonstrated the activity of a bchP gene product using the recombinant protein. Keller et al. (1998) cloned a cDNA encoding CHL P from Arabidopsis thaliana and suggested that a multifunctional CHL P catalyzed the stepwise reduction of ChlGGa into Chlphya as well as the reduction of GGPP into phyPP. Tanaka et al. (1999) cloned a tobacco cDNA sequence encoding CHL P, and showed reduction in Chl and tocopherol contents and accumulation of partially ChlGG in transgenic tobacco expressing antisense Chl P. Giannino et al. (2004) identified a Chl P gene in peach and suggested that its expression was regulated by photosynthetic activity. Bruno et al. (2009) characterized a Chl P gene in olive, and found that OeChl P expression was modulated during leaf and fruit development and rapidly enhanced under stress conditions. Park et al. (2010) isolated a Chl P cDNA in sesame and showed SiChl P expression was induced by light but repressed by dark, ABA and ethylene. However, no Chl P gene had been identified in monocotyledonous plants until 2012. Most recently, Zhou et al. (2013) isolated a yellow leaf mutant (lyl1) from the progeny of a japonica rice ZH11 treated with 60Co radiation, and demonstrated the lyl1 mutant phenotype was caused by a point mutation in the LOC_Os02g51080 gene for CHL P via map-based cloning and RNA interference (RNAi) approaches. In present study, we isolated the yellow-green leaf mutant 502ys from a japonica rice Nipponbare through EMS mutagenesis and cloned OsChl P gene (LOC_Os02g51080). In the 502ys mutant, DNA sequence of the OsChl P gene had a single base pair mutation, resulting in an amino acid change in the encoded protein, and the majority of Chl molecules were conjugated with an unsaturated geranylgeraniol side chain. Furthermore, the mutant phenotype was rescued by transformation with the wild-type gene. Therefore, a Chl P gene was identified successfully in monocotyledonous plants. Several Chl P (bchP) deficient mutants have been identified. A bch P mutant of the purple photosynthetic bacterium Rhodobacter sphaeroides accumulated only bChlGG and the maximal photosynthetic growth rate were significantly reduced (Addlesee et al. 1996;Addlesee and Hunter 1999). Transgenic tobacco expressing antisense Chl P exhibited reduction in Chl and tocopherol contents, and up to 58% of Chls was esterified with geranylgeraniol instead of phytol under low light conditions (Tanaka et al. 1999). In addition, the transgenic plants were much more sensitive to light stress (Graßes et al. 2001). Graßes et al. (2001) suggested that ChlGG did not affect the harvesting and transfer of light energy, but the reduced tocopherol content is a limiting factor for defensive reaction to photo-oxidative stress of the transgenic plants. In this study, the 502ys mutant exhibited a yellow-green leaf phenotype, reduced Chl level, arrested chloroplast development, and retarded growth rate. HPLC analysis of Chls indicated that the 502ys mutant accumulated Chls esterified with phytol, GG, dihydro-GG, and tetrahydro-GG. Our data are consistent with the above-mentioned reports that the Chl P mutants were capable of photosynthetic growth using Chls with an unsaturated geranylgeraniol side chain, although their growth rate was decreased remarkably. Arabidopsis CHL P was able to catalyze the reduction of ChlGGa into ChlPhya (Keller et al. 1998). The 502ys mutant accumulated ChlGGa, ChlDHGGa, ChlTHGGa and ChlPhya, which implied that OsCHL P is also involved in the reduction of ChlGGa. However, when the recombinant OsCHL P protein was expressed in E. coli, we found that only a very small amounts of ChlGGa was detected to be converted to the ChlDHGGa after 5 h of incubation with the recombinant protein (data not show), implying its enzymatic activity were very low when ChlGGa was used as substrate. It is possible that the recombinant OsChl P product did not form a proper conformation, or the enzyme reaction system was not optimal, or additional proteins were required for its catalytic activity. In any case, further studies are necessary to clarify the function of the OsCHL P protein. Additional file 1: Figure S1: Alignment of the deduced amino acid sequence of OsCHL P and its homologues. Identical residues were boxed in black, similar residues (≥75% identical) were highlighted in gray. The red arrowhead indicates mutational site (G206S) of the 502ys mutant, and the red underline indicates the putative chloroplast-targeting sequence of 37 amino acid residues at its N terminus. Accession numbers for the respective protein sequences are as Figure 4. (DOC 1 MB)
  28 in total

1.  COPPER ENZYMES IN ISOLATED CHLOROPLASTS. POLYPHENOLOXIDASE IN BETA VULGARIS.

Authors:  D I Arnon
Journal:  Plant Physiol       Date:  1949-01       Impact factor: 8.340

2.  Identification of the bchP gene, encoding geranylgeranyl reductase in Chlorobaculum tepidum.

Authors:  Aline Gomez Maqueo Chew; Niels-Ulrik Frigaard; Donald A Bryant
Journal:  J Bacteriol       Date:  2007-11-09       Impact factor: 3.490

3.  Predicting subcellular localization of proteins based on their N-terminal amino acid sequence.

Authors:  O Emanuelsson; H Nielsen; S Brunak; G von Heijne
Journal:  J Mol Biol       Date:  2000-07-21       Impact factor: 5.469

4.  Metabolic compartmentation of plastid prenyllipid biosynthesis--evidence for the involvement of a multifunctional geranylgeranyl reductase.

Authors:  Y Keller; F Bouvier; A d'Harlingue; B Camara
Journal:  Eur J Biochem       Date:  1998-01-15

5.  Identification of a vinyl reductase gene for chlorophyll synthesis in Arabidopsis thaliana and implications for the evolution of Prochlorococcus species.

Authors:  Nozomi Nagata; Ryouichi Tanaka; Soichirou Satoh; Ayumi Tanaka
Journal:  Plant Cell       Date:  2005-01       Impact factor: 11.277

6.  One divinyl reductase reduces the 8-vinyl groups in various intermediates of chlorophyll biosynthesis in a given higher plant species, but the isozyme differs between species.

Authors:  Pingrong Wang; Chunmei Wan; Zhengjun Xu; Pingyu Wang; Wenming Wang; Changhui Sun; Xiaozhi Ma; Yunhua Xiao; Jianqing Zhu; Xiaoling Gao; Xiaojian Deng
Journal:  Plant Physiol       Date:  2012-11-15       Impact factor: 8.340

7.  The rice faded green leaf locus encodes protochlorophyllide oxidoreductase B and is essential for chlorophyll synthesis under high light conditions.

Authors:  Yasuhito Sakuraba; Md Lutfor Rahman; Sung-Hwan Cho; Ye-Sol Kim; Hee-Jong Koh; Soo-Cheul Yoo; Nam-Chon Paek
Journal:  Plant J       Date:  2013-03-04       Impact factor: 6.417

8.  Metabolic redesign of vitamin E biosynthesis in plants for tocotrienol production and increased antioxidant content.

Authors:  Edgar B Cahoon; Sarah E Hall; Kevin G Ripp; Thaya S Ganzke; William D Hitz; Sean J Coughlan
Journal:  Nat Biotechnol       Date:  2003-08-03       Impact factor: 54.908

9.  slr1923 of Synechocystis sp. PCC6803 is essential for conversion of 3,8-divinyl(proto)chlorophyll(ide) to 3-monovinyl(proto)chlorophyll(ide).

Authors:  M Rafiqul Islam; Shimpei Aikawa; Takafumi Midorikawa; Yasuhiro Kashino; Kazuhiko Satoh; Hiroyuki Koike
Journal:  Plant Physiol       Date:  2008-08-20       Impact factor: 8.340

10.  Isolation and characterization of homogentisate phytyltransferase genes from Synechocystis sp. PCC 6803 and Arabidopsis.

Authors:  Beth Savidge; James D Weiss; Yun-Hua H Wong; Michael W Lassner; Timothy A Mitsky; Christine K Shewmaker; Dusty Post-Beittenmiller; Henry E Valentin
Journal:  Plant Physiol       Date:  2002-05       Impact factor: 8.340

View more
  16 in total

1.  Lipid profiles reveal different responses to brown planthopper infestation for pest susceptible and resistant rice plants.

Authors:  Jiajiao Zhang; Yi Li; Jianping Guo; Bo Du; Guangcun He; Yingjun Zhang; Rongzhi Chen; Jiaru Li
Journal:  Metabolomics       Date:  2018-09-03       Impact factor: 4.290

2.  A recruiting protein of geranylgeranyl diphosphate synthase controls metabolic flux toward chlorophyll biosynthesis in rice.

Authors:  Fei Zhou; Cheng-Yuan Wang; Michael Gutensohn; Ling Jiang; Peng Zhang; Dabing Zhang; Natalia Dudareva; Shan Lu
Journal:  Proc Natl Acad Sci U S A       Date:  2017-06-12       Impact factor: 11.205

3.  High Temporal-Resolution Transcriptome Landscape of Early Maize Seed Development.

Authors:  Fei Yi; Wei Gu; Jian Chen; Ning Song; Xiang Gao; Xiangbo Zhang; Yingsi Zhou; Xuxu Ma; Weibin Song; Haiming Zhao; Eddi Esteban; Asher Pasha; Nicholas J Provart; Jinsheng Lai
Journal:  Plant Cell       Date:  2019-03-26       Impact factor: 11.277

4.  Physiological, epigenetic, and proteomic responses in Pfaffia glomerata growth in vitro under salt stress and 5-azacytidine.

Authors:  Evandro Alexandre Fortini; Diego Silva Batista; Sérgio Heitor Sousa Felipe; Tatiane Dulcineia Silva; Ludmila Nayara Freitas Correia; Letícia Monteiro Farias; Daniele Vidal Faria; Vitor Batista Pinto; Claudete Santa-Catarina; Vanildo Silveira; Clelia De-la-Peña; Eduardo Castillo-Castro; Wagner Campos Otoni
Journal:  Protoplasma       Date:  2022-07-05       Impact factor: 3.356

Review 5.  The terminal enzymes of (bacterio)chlorophyll biosynthesis.

Authors:  Matthew S Proctor; George A Sutherland; Daniel P Canniffe; Andrew Hitchcock
Journal:  R Soc Open Sci       Date:  2022-05-04       Impact factor: 3.653

6.  A Single Nucleotide Substitution of GSAM Gene Causes Massive Accumulation of Glutamate 1-Semialdehyde and Yellow Leaf Phenotype in Rice.

Authors:  Qian Wang; Baiyang Zhu; Congping Chen; Zhaodi Yuan; Jia Guo; Xiaorong Yang; San Wang; Yan Lv; Qingsong Liu; Bin Yang; Changhui Sun; Pingrong Wang; Xiaojian Deng
Journal:  Rice (N Y)       Date:  2021-06-05       Impact factor: 4.783

7.  The xantha Marker Trait Is Associated with Altered Tetrapyrrole Biosynthesis and Deregulated Transcription of PhANGs in Rice.

Authors:  Rui-Qing Li; Meng Jiang; Yan-Hua Liu; Yun-Chao Zheng; Jian-Zhong Huang; Jian-Min Wu; Qing-Yao Shu
Journal:  Front Plant Sci       Date:  2017-05-31       Impact factor: 5.753

8.  Accumulation of geranylgeranylated chlorophylls in the pigment-protein complexes of Arabidopsis thaliana acclimated to green light: effects on the organization of light-harvesting complex II and photosystem II functions.

Authors:  Václav Karlický; Zuzana Kmecová Materová; Irena Kurasová; Jakub Nezval; Michal Štroch; Győző Garab; Vladimír Špunda
Journal:  Photosynth Res       Date:  2021-05-04       Impact factor: 3.573

9.  Functional Inactivation of Putative Photosynthetic Electron Acceptor Ferredoxin C2 (FdC2) Induces Delayed Heading Date and Decreased Photosynthetic Rate in Rice.

Authors:  Juan Zhao; Zhennan Qiu; Banpu Ruan; Shujing Kang; Lei He; Sen Zhang; Guojun Dong; Jiang Hu; Dali Zeng; Guangheng Zhang; Zhenyu Gao; Deyong Ren; Xingming Hu; Guang Chen; Longbiao Guo; Qian Qian; Li Zhu
Journal:  PLoS One       Date:  2015-11-24       Impact factor: 3.240

10.  Identification of OsGGR2, a second geranylgeranyl reductase involved in α-tocopherol synthesis in rice.

Authors:  Eiichi Kimura; Takumi Abe; Kazumasa Murata; Toshiyuki Kimura; Yurika Otoki; Taiji Yoshida; Teruo Miyazawa; Kiyotaka Nakagawa
Journal:  Sci Rep       Date:  2018-01-30       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.