Literature DB >> 24799162

In utero exposure to the endocrine disruptor di-(2-ethylhexyl) phthalate promotes local adipose and systemic inflammation in adult male offspring.

E Campioli1, D B Martinez-Arguelles1, V Papadopoulos2.   

Abstract

BACKGROUND: Di-(2-ethylhexyl) phthalate (DEHP) is a plasticizer used to increase the flexibility of polyvinyl chloride. DEHP and its active metabolite mono-(2-ethylhexyl) phthalate are detected in many biological fluids during fetal and postnatal life. In rodent models, in utero DEHP exposure has been shown to alter sexual organ development, decrease testosterone and aldosterone production, increase body and epididymal adipose tissue weight, and raise serum lipids and glucose levels in male offspring.
OBJECTIVES: The objective of this study is to characterize the effects of in utero DEHP exposure on adipose tissue development and function in male offspring.
METHODS: Sprague-Dawley pregnant dams were gavaged 1, 20, 50 or 300 mg DEHP per kg per day from gestational day 14 until birth.
RESULTS: Global gene expression analyses of postnatal day 60 male offspring that were exposed in utero to 300 mg DEHP per kg per day revealed increased expression of immune response and inflammation markers, and increased expression of differentiation pathway genes in the epididymal whole-adipose tissue and isolated stromal vascular fraction. C-reactive protein and tumor necrosis factor (TNF) serum levels were increased in the 300 mg DEHP in utero-exposed offspring. TNF levels in adipose tissue homogenates were increased in the 50 and 300 mg DEHP in utero-exposed offspring. Immunofluorescence studies revealed focal macrophage infiltration in whole-adipose tissue confirmed by increased CD163 tissue content.
CONCLUSIONS: In utero DEHP exposure promotes local adipose tissue inflammation and chronic low-grade systemic inflammation. Moreover, evidence is presented, suggesting that DEHP increases the differentiation capacity of the pre-adipocytes of male offspring without affecting total body weight.

Entities:  

Year:  2014        PMID: 24799162      PMCID: PMC4042311          DOI: 10.1038/nutd.2014.13

Source DB:  PubMed          Journal:  Nutr Diabetes        ISSN: 2044-4052            Impact factor:   5.097


Introduction

The use of phthalates as plasticizers began in 1933[1] and production in recent years has reached five million tons,[2] resulting in continuous and widespread exposure to the population.[2] Phthalates are used in industry to increase polyvinyl chloride polymer flexibility, pliability and elasticity. They are found in industrial plastic, household items, paints, children's toys, personal care products and medical devices.[1] Di-(2-ethylhexyl) phthalate (DEHP) is among the most-produced phthalates each year, with an estimated two million tons.[1] As DEHP is not a part of the polyvinyl chloride polymer,[1, 2] it is released into the environment[1] and is absorbed mainly through dermal contact and ingestion.[3] Parenteral exposure from medical devices and nutritional exposure account for the highest recorded exposures.[1, 2] DEHP and its metabolites have endocrine-disrupting properties and are found in many biological fluids from fetuses and adults, raising human health concerns.[4, 5, 6, 7, 8] Mono-(2-ethylhexyl) phthalate (MEHP) is the active metabolite of DEHP and has been shown to activate the peroxisome proliferator-activated receptor (PPAR) system, which is involved in lipid and glucose metabolism, adipocyte differentiation and development.[9, 10] In men, there is an inverse correlation between levels of DEHP metabolites in urine and circulating androgen levels.[11] In utero DEHP exposure exerts short- and long-term effects that are longer lasting when exposure occurs during fetal life.[10, 12] In utero DEHP exposure alters sexual organ development in male rats and decreases fetal testosterone production.[13, 14] We previously reported that in utero DEHP exposure reduced circulating testosterone and aldosterone levels in adult male offspring.[13, 15, 16] Reduced testosterone levels (primary hypogonadism) have been linked to obesity,[17] osteoporosis[18] and cardiovascular diseases.[19] The effect of phthalates on pre-adipocyte differentiation is well documented in vitro and in vivo. We previously reported that MEHP increases differentiation of the human pre-adipocyte SW872 cell line.[20] MEHP was also shown to activate PPAR-γ and promote adipogenesis in murine 3T3-L1 cells[21] and human primary pre-adipocytes.[22] Similar effects were found in vivo when perinatal exposure to DEHP or MEHP increased body and epididymal adipose tissue weight, serum lipids and glucose levels in postnatal day (PND) 60 offspring.[23, 24] A recent study demonstrated that intraperitoneal injection of DEHP increased levels of the differentiation markers Pparg, Ap2 and Fas in 6-week-old C57BL/6J male mice.[24] Based on these observations, we hypothesized that in utero DEHP exposure affects the development and function of the adipose tissue. We report herein that in utero DEHP exposure increases the differentiation capacity of pre-adipocytes and promotes local adipose tissue inflammation and chronic low-grade systemic inflammation.

Materials and methods

Animals and treatment

Timed pregnant Sprague–Dawley rats were purchased from Charles River Laboratories (Saint-Constant, QC, Canada) and gavaged daily with corn oil or 1, 20, 50 or 300 mg DEHP per kg per day (Sigma-Aldrich Canada Ltd, Oakville, ON, Canada) from gestational day 14 until parturition (corresponding to PND0). Pregnant dams were weighed every 2 days and doses were adjusted accordingly. Male offspring were killed at PND60 and epididymal adipose tissue was snap-frozen in liquid nitrogen or fixed in 4% paraformaldehyde (MJS BioLynx Inc., Brockville, ON, Canada). Animals were handled according to protocols approved by the McGill University Animal Care and Use Committee. The doses of DEHP in our rat studies were calculated to correspond to human equivalent doses according to the formula proposed by Reagan-Shaw et al.[25] Briefly, the dose translation from HED to mg kg−1 per day exposure in the rat is not based on a simple conversion from human to rodent body weight, but it relies on the concept of the body surface area. The body surface area factor is a unitless number, equivalent to the no-observed-adverse-effect-level on an mg m−2 basis.[26] The use of the body surface area factor is preferable because it correlates better several biological parameters across mammalian species.[25] Thus, humans are exposed to DEHP doses corresponding to 0.18–62.5 mg kg−1 per day rat exposures. Rodent data indicate a no-observed-adverse-effect-level for DEHP of 5 mg kg−1 per day, and lowest-observed-adverse-effect-level for developmental effects of 10 mg kg−1 per day.[2] We chose DEHP doses (1–300 mg kg−1 per day) that include environmentally relevant doses for humans.

Stromal vascular fraction isolation

Epididymal adipose tissue was washed with 1 × phosphate buffer saline (Life Technologies Inc., Burlington, ON, Canada) and visible blood vessels were removed from the fat pads. The minced tissues were digested for 1 h at 37 °C with type II collagenase solution (1.2 mg ml−1; Sigma-Aldrich Canada Ltd) and 2% bovine serum albumin fraction V (Roche Applied Science, Laval, QC, Canada) in phosphate buffer saline (pH 7.4) in an orbital shaking oven. Cell suspensions were centrifuged in polyethylene centrifuge tubes (Dow Corning Corporation, Midland, MI, USA) for 5 min at 250 × g and the floating layer composed of adipocytes was discarded. The pellet was resuspended in 5 ml erythrocyte lysis buffer (8.26 g NH4Cl, 1 g KHCO3 and 0.037 g EDTA in 1 liter water, pH 7.3; Sigma-Aldrich Canada Ltd) at room temperature for 5 min, followed by the addition of phosphate buffer saline (pH 7.4) to stop the lysis reaction. Cells were initially filtered through 100-μm nylon strainer and, subsequently, a 40-μm nylon strainer (BD Canada, Mississauga, ON, Canada). Finally, cell suspensions were centrifuged at 350 × g for 5 min at 4 °C and the pellet was stored at −80 °C until RNA extraction.

RNA extraction and global gene expression analyses

Total RNA from the adipose tissue, stromal vascular fraction (SVF) and the liver were extracted using RNeasy Lipid Tissue Mini Kit (Qiagen Inc., Toronto, ON, Canada) according to the manufacturer's instructions. RNA concentration and purity were determined using the NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., Mississauga, ON, Canada). Adipose tissue and SVF mRNAs were fluorescently tagged, reverse transcribed and hybridized to a Rat Genome 230 2.0 Array (Affymetrix, Santa Clara, CA, USA) at the McGill University and Genome Quebec Innovation Centre facilities. Data were normalized using the PLIER algorithm and the consecutive sampling method was used to ascertain differential expression. Three microarrays were hybridized for PND60 males exposed in utero to corn oil (vehicle) and 300 mg DEHP per kg per day, each from one pregnant dam. Pathway analyses and gene clustering of significantly changed genes were performed using the DAVID bioinformatics database.

mRNA quantification using quantitative reverse transcription-PCR

cDNA synthesis and quantitative reverse transcription-PCR were performed as previously described.[20] Table 1 shows the sequences and annealing temperatures for each primer pair. β-actin mRNA (Actb) was used as an internal reference gene.
Table 1

Primer sequences used in qRT-PCR analyses

GeneForward primer (5′–3′)Reverse primer (5′–3′)AnnealingGene ID
ActbCGCAGACACTTTCTACAATGAGCTGCGACGGTTGGCCTTAGGGTTCAG61 °C81822
Ccr1CCGTGCGTCTGATATTTGCGTCAGATTGTAGGGGGTCCA60 °C57301
CebpaCGGTAAAGAACAGCAACGAGTACCGGCGCTGTTTGGCTTTATCTCG61 °C24252
Cma1GGATGAATCTCCATGCTCTGTCGATGATCTCCCCAGCTTT60 °C25627
Cpa3AAACCGTTCCAAGAACCCAAATCGATGTGGAAGAGTCCCATGAGACATCG61 °C54242
CrpGGACAAATGCAAGCATCATCAGACTGATTCGCGTCAAAGC60 °C25419
Cxcr4CGTCTATGTGGGTGTCTGGAGCGAAGATGATGTCAGGGATA60 °C60628
Fabp4CGAAGTAACTCGTCTCCAGTGAGAACTTCGCCATACCGGCCACTTTCCTG61 °C79451
Lgals3bpCGACTCAATGCACAGGGAACGAGTCGGTCCTTCTCATGCCCGCAGT61 °C245955
Mcpt8AACCCAGGTCATCGCTGTTGCGGTTGGAGCATGATGTCATTAAACCG61 °C29269
Mcpt9CGTGATCTAAAGGCCAAACCTCACGTTGAGCTTTGCGTTCCAACTTC61 °C54272
Mcpt10GGCCATCCTACCAGTCAACACTCGGCTATGAATGCCATGTAGGGCCG61 °C54269
RT1-BbGACAGATTTCTACCCAGCCCAGACGTGTCTTCCTAATAAGCTGTGTGGACACG61 °C309622
RT1-EC16AGGGCAAGTGCTTGGAGTCCCTTTGGGGGATCTGAGC60 °C414819
TnfCCCTGGTACTAACTCCCAGAAATGTATGAGAGGGACGGAACC60 °C24835

Abbreviations: Actb, β-actin; Ccr1, chemokine (C–C motif) receptor 1; Cebpa, CCAAT/enhancer-binding protein α Cma1, chymase 1; Cpa3, carboxypeptidase A3; Crp, C-reactive protein; Cxcr4, C-X-C chemokine receptor type 4; Fabp4, fatty-acid-binding protein 4; Lgals3bp, galactoside-binding, soluble, 3 binding protein; Mcpt8, mast cell protease 8; Mcpt9, mast cell protease 9; Mcpt10, mast cell protease 10; qRT-PCR, quantitative reverse transcription-PCR; RT1-Bb, RT1 class II, locus Bb; RT1-EC16, RT1 class I locus EC16; Tnf, tumor necrosis factor.

Serum enzyme-linked immunosorbent assay

Blood was collected by cardiac puncture. Serum was separated and enzyme-linked immunosorbent assays were used to quantify adiponectin (R&D Systems Inc., Minneapolis, MN, USA), CD163 (Cusabio Biotech, Cedarlane Laboratories Ltd, Burlington, ON, Canada), C-reactive protein (CRP; EMD Millipore Corporation, Billerica, MA, Canada), interleukin 6 (IL-6; R&D Systems Inc.), leptin (Life Technologies Inc.), plasminogen activator inhibitor-1 (Oxford Biomedical Research, Cedarlane Laboratories Ltd), resistin (Bertin Pharma, Cayman Chemical Company, Ann Arbor, MI, USA) and tumor necrosis factor (TNF; R&D Systems Inc.) according to the manufacturer's instructions. Absorbance was read at 450 nm in a VICTOR X5 Multilabel Plate Reader (PerkinElmer Inc., Waltham, MA, USA).

Adipose tissue protein extraction

Proteins were extracted according to previously reported method.[27] In brief, 100 mg adipose tissue was homogenized with 1 ml extraction buffer containing 50 mM MgCl2 (Sigma-Aldrich Canada Ltd), 0.05% bovine serum albumin (Roche Applied Science), 3% fetal bovine serum (Life Technologies Inc.) and 25 mM PIPES sodium salt (Sigma-Aldrich Canada Ltd) in phosphate buffer saline. The homogenate was centrifuged at 1000 × g for 10 min at 4 °C and the supernatant was collected and assayed for CD163, CRP, IL-6 and TNF as described above.

Immunohistochemistry

Immunohistochemistry was performed in 5-μm paraffin sections of epididymal adipose tissue fixed in 4% paraformaldehyde as previously described.[15] Tissue slides were incubated overnight in primary mouse IgG1 anti-CD163 monoclonal antibody solution (1:100 dilution; Acris Antibodies Inc., San Diego, CA, USA). Alexa Fluor 488 goat anti-mouse IgG was used as secondary antibody (1:300 dilution; Life Technologies Inc.). DAPI (4',6-diamidino-2-phenylindole) was used for nuclear staining. Negative control slides were prepared by incubating with the corresponding secondary antibody. Three pieces from different locations of the fat pad were analyzed for each sample (n=3).

Glucose and C-peptide

Blood was collected by cardiac puncture after a 12-h overnight fast. Glucose levels were immediately measured using Bayer's CONTOUR NEXT meter (Bayer Inc., Toronto, ON, Canada). Serum was used to quantify by enzyme-linked immunosorbent assay the levels of C-peptide (Mercordia Inc., Uppsala, Sweden).

Statistical analyses

Data are expressed as the mean±s.e.m. and were analyzed using one-way analysis of variance followed by Dunnett's post hoc tests or t-tests using the GraphPad Prism program (GraphPad Software Inc., La Jolla, CA, USA). P<0.05 (*, #), P<0.01 (**), and P<0.001 (***) were used as indicators of the level of significance. For all experiments, the experimental unit was the pregnant dam and in the event that more siblings were available, the individual values were averaged to obtain a unique value per dam.

Results

Whole-adipose tissue and SVF gene expression

To gain insight into the long-term effects of in utero DEHP exposure in whole-adipose tissue and SVF, we performed global gene expression studies. Epididymal whole-adipose tissue from male offspring exposed in utero to control or 300 mg DEHP per kg per day was collected at PND60. We observed 65 up- and 71 downregulated genes in whole-adipose tissue, whereas SVF had 181 up- and 1265 downregulated genes (Figure 1, Supplementary Tables S1 and S2). We analyzed the top 10 pathways, GO-term classifications and keywords associated with the significantly changing genes from whole-adipose and SVF samples, using the bioinformatics website DAVID. In whole-adipose tissue, DEHP primarily targeted the antigen-processing and -presenting pathway, characterized by upregulation of major histocompatibility complex class I and II molecules located in the chr20p12 locus (RT1-EC2, RT1-S3, RT1-CE5, RT1-A1, RT1-Db1, RT1-EC2 and RT1-Bb). The effects of DEHP on the SVF were more pronounced and were characterized by a sharp downregulation of genes associated with metabolic pathways. DEHP affected the PPAR pathway in the SVF (Olr1 and Aqp7 were upregulated, whereas Apoc3, Fads2, Gk, Acsl1, Slc27a2, Ehhadh and Scd were downregulated). The renin angiotensin (AT) system (RAS) was also targeted by DEHP and characterized by downregulation of Ang, Ctsg, Agtr2 and Agtr1 in the SVF and upregulation of Ctsg, Cma1 and Cpa3 in whole-adipose tissue.
Figure 1

Global gene expression changes of the SVF and whole-adipose tissue in DEHP-exposed offspring. The Venn diagram shows the genes significantly changed by DEHP in the SVP and whole-adipose tissue. Tables show the top 10 pathways, GO terms, keywords and cytobands affected by in utero DEHP exposure.

Inflammatory markers gene expression

We confirmed the gene expression changes observed in the global gene expression results from PND60 male offspring whole-adipose tissue and SVF using quantitative reverse transcription-PCR . Exposure to 300 mg DEHP per kg per day induced RT1-Bb (1.7-fold, P<0.05), RT1-E16 (17.4-fold, P<0.001), Cma1 (2.4-fold, P<0.05), Cpa3 (3.1-fold, P<0.001) and Mcpt10 (3.4-fold, P<0.01) in whole-adipose tissue (Figure 2a). RT1-Bb showed a 1.6-fold increase (P<0.01) when animals were exposed to 50 mg DEHP per kg per day (Figure 2a). Gene expression from the SVF showed that animals exposed to 300 mg DEHP per kg per day induced Ccr1 (2.9-fold, P<0.01), Cxcr4 (1.5-fold, P<0.05), Tnf (2.1-fold, P<0.01), Cebpa (2.3-fold, P<0.05) and Fabp4 mRNA levels (1.7-fold, P<0.05, t-test; Figure 2b). At 50 mg DEHP per kg per day, only Cebpa expression was increased by 2.1-fold (P<0.05, t-test; Figure 2b). There were no changes observed in Crp, Il6 and Tnf mRNA levels in whole-adipose tissue (Figure 4a) or Crp expression in the liver (Figure 4b) from male offspring exposed to 300 mg DEHP per kg per day.
Figure 2

Effect of in utero DEHP exposure on gene expression in male offspring. (a) Total adipose tissue quantitative reverse transcription-PCR (qRT-PCR) products of RT1-Bb, RT1-EC16, Lgals3bp, Cma1, Cpa3, Mcpt8, Mcpt9 and Mcpt10 normalized to Actb. Data are presented as fold over control (n=7). (b) SVF qRT-PCR products of Ccr1, Cxcr4, Tnf, Cebpa and Fabp4 normalized to Actb. Data are presented as fold over control (n=3). Results are expressed as the mean±s.e.m. One-way analysis of variance (ANOVA) followed by Dunnett's post hoc tests (*) or t-tests (#) was used to calculate statistical significance compared with control; #,*P<0.05, ##,**P<0.01, ***P<0.001. Bars indicate doses significant by ANOVA; *P<0.05.

Serum adipokine levels

To determine whether exposure to DEHP induced systemic inflammation or altered adipocyte endocrine function, we quantified circulating levels of inflammatory cytokines and adipokines. Male offspring exposed in utero to 300 mg DEHP per kg per day showed increased serum levels of CRP (664.20±16.54 μg ml−1, n=4, P<0.05) compared with controls (592.60±16.53 μg ml−1, n=8). TNF was also increased in the 300 mg DEHP per kg per day exposed offspring (139.00±27.56 pg ml−1, n=4, P<0.05) compared with controls (40.59±6.70 pg ml−1, n=8; Figure 3). Serum adiponectin levels followed a polynomial cubic trend (F-test, P=0.0105) and DEHP-induced changes were significant by analysis of variance (P<0.05); nonetheless, no specific DEHP dose reached the significance using Dunnett's post hoc test. IL-6 was undetectable in the samples; leptin, plasminogen activator inhibitor-1 and resistin were not affected by DEHP.
Figure 3

Effect of in utero DEHP exposure on male offspring serum adipokine concentration. Serum levels of CRP, TNF, plasminogen activator inhibitor (PAI-1), resistin, leptin and adiponectin are shown. Results are expressed as the mean±s.e.m. (n=4 except for control group where n=8). One-way analysis of variance (ANOVA) followed by Dunnett's post hoc tests was used to calculate statistical significance compared with control; *P<0.05. Bars indicate doses significant by ANOVA; *P<0.05.

Epididymal adipose tissue adipokine production

To evaluate whether whole-adipose tissue was a source for the increased serum cytokines, we quantified whole-adipose CRP, IL-6 and TNF levels. Offspring exposed to 50 or 300 mg DEHP per kg per day showed a significant increase in local levels of TNF (6.50±1.55 pg per 100 mg tissue, n=5, and 6.01±1.05 pg per 100 mg tissue, n=7, P<0.05, respectively) compared with the control group (3.10±0.57 pg per 100 mg tissue, n=7; Figure 4c). Local CRP and IL-6 levels did not significantly change. Similarly, mRNA expression of Crp, Il6 and Tnf were not affected in whole-adipose tissue.
Figure 4

Effect of in utero DEHP exposure on male offspring hepatic and adipose tissue inflammatory marker expression and adipose tissue macrophage infiltration. (a) Total adipose tissue quantitative reverse transcription-PCR (qRT-PCR) products of Crp, Il6 and Tnf normalized to Actb. Data are presented as fold over control (n=7). (b) Liver qRT-PCR products of Crp normalized to Actb and presented as fold over control (n=7). (c) Epididymal adipose tissue content of CRP, IL-6 and TNF as determined using enzyme-linked immunosorbent assay (ELISA; n=7, except the 50 mg DEHP group where n=5). (d) Representative histological sections of adipose tissue controls and treated with 300 mg DEHP per kg per day stained for CD163 (green) and DAPI (blue). Objective × 20. (e) Adipose tissue content of CD163 as determined by ELISA (n=5 except 300 mg DEHP group where n=6). (f) Retroperitoneal adipose tissue content of IL-6 as determined by ELISA (n=8, except the 1 mg DEHP group where n=4). Results are expressed as the mean±s.e.m., one-way analysis of variance (ANOVA) followed by Dunnett's post hoc tests (*) or t-tests (#) were used to calculate statistical significance compared with control; #, *P<0.05. Bars indicate doses significant by ANOVA; *P<0.05.

Adipose tissue macrophage infiltration/activation

To evaluate the presence of macrophage infiltration and/or activation in whole-adipose tissue, we analyzed the monocyte/macrophage marker CD163 by immunofluorescence. CD163 along with mannose and integrin αvβ5 receptors were found in human adipose tissue macrophages and identified as macrophage type 2-like cells with excessive pro-inflammatory mediator production.[28] There was macrophage infiltration in animals exposed to 300 mg DEHP per kg per day compared with controls (Figure 4d). The macrophage infiltration was not homogenous, but rather was in foci within the adipose tissue. To confirm the focal infiltration, adipose tissue lysates were quantified for CD163 levels. Offspring exposed to 1, 50 or 300 mg DEHP per kg per day showed a significant increase in CD163 levels (76.15±14.78 ng per 100 mg tissue, n=5; 80.41±9.94 ng per 100 mg tissue, n=5; and 70.94±15.20 ng per 100 mg tissue, n=6, P<0.05, respectively) compared with the control group (26.15±5.24 ng per 100 mg tissue, n=5; Figure 4e).

Retroperitoneal adipose tissue adipokine production

To evaluate whether the inflammation pathway was activated in a different type of adipose tissue, we quantified the retroperitoneal expression levels of IL-6. Offspring exposed to 1 mg DEHP per kg per day showed a significant increase in local levels of IL-6 (28.79±2.58 pg per 100 mg tissue, n=4, P<0.05) compared with the control group (18.61±1.11 pg per 100 mg tissue, n=8; Figure 4f). The increased inflammatory response was then confirmed by measuring TNF levels by enzyme-linked immunosorbent assay in the 1 mg DEHP per kg per day group (12.61±2.28 pg per 100 mg tissue, n=4, P<0.05) compared with the control group (9.749±1.39 pg per 100 mg tissue, n=6).

Metabolic profile

To evaluate the metabolic effects of in utero exposure to DEHP, we measured total and epididimal adipose tissue weight, glucose and insulin levels (C-peptide). There were no significant changes in total body or epididymal adipose tissue weight (Figure 5). C-peptide blood levels followed a polynomial quadratic trend (F-test, P= 0.0400) and the doses were significant by analysis of variance (P<0.05); however, no specific dose of DEHP reached significance using Dunnett's post hoc test. There were no significant changes in blood glucose. Of note, there was a decrease trend in glucose levels in the 300 mg DEHP per kg per day (P=0.0668; Figure 5).
Figure 5

Effect of in utero DEHP exposure on male offspring total weight, epididymal adipose tissue pad weight, blood glucose and serum C-peptide. Results are expressed as the mean±s.e.m., N=6; one-way analysis of variance (ANOVA) followed by Dunnett's post hoc tests. Bars indicate doses significant by ANOVA; *P<0.05.

Discussion

The incidence of the metabolic syndrome has dramatically increased over the past 25 years. Criteria for a clinical diagnosis of metabolic syndrome consist of an increase in waist circumference, triglycerides, blood pressure, fasting glucose and reduced high-density lipoprotein levels.[29] Increased abdominal obesity and sedentary lifestyles are considered major risk factors.[29] Many factors may be responsible for increased obesity, including exposure to endocrine disruptors, which are now considered obesogenic compounds.[30] Indeed, it was suggested that these chemicals might be defined as metabolic disruptors because they affect metabolic signaling.[31] Numerous mechanisms may underlie endocrine disruptor effects on non-developmental obesity (including PPAR pathway activation and perturbation of thyroid function) and in utero exposure.[30] It has been proposed that exposure to endocrine disruptors during fetal life causes permanent metabolic alterations,[32, 33] possibly through epigenetic mechanisms,[34] which result in development of obesity later in life.[32, 33] Evidence supporting this hypothesis was observed by Schmidt et al.[33] in their findings that exposing mice to a diet containing low doses (0.05 and 5 mg DEHP per kg per day, corresponding to a daily intake of 0.00102 and 0.108 DEHP per kg per day) of DEHP in utero and during lactation resulted in increased visceral fat and body weight in adult offspring. In agreement with previous work in rats,[13, 35] we did not observe changes in total body weight. It remains to be determined whether a differential fat distribution is induced by DEHP without modifying the total weight of the animals and whether more drastic changes would develop later in time during senescence. Using the DAVID bioinformatics portal, we observed that DEHP targeted the PPAR pathway and several metabolic pathways in the SVF and immune-related pathways in whole-adipose tissue. The PPAR pathway changes were downstream of the three known PPARs and associated with fatty acid metabolism, bile acid biosynthesis, synthesis and degradation of ketone bodies, glycerophospholipid metabolism and gluconeogenesis. MEHP is known to activate PPARα and PPARγ nuclear receptors.[36] We report increased gene expression of RT1-Bb and RT1-EC16 in whole-adipose tissue and of Ccr1, Cxcr4 and Tnf in the SVF. These markers are associated with antigen processing and presentation and cytokine–cytokine receptor interaction in immune cells. Similar increases in inflammatory marker expression have been reported after DEHP and MEHP treatment in different monocyte/macrophage models, such as the macrophage RAW264.7 cell line,[37] human acute monocytic leukemia THP-1 cell line[38] and rat alveolar macrophages.[39] Moreover, MEHP increases IL-5 and IL-10 levels in cultures of local lymph node cells, suggesting that phthalates activate the adaptive immune system.[40] Taken together, these data suggest that in utero DEHP exposure induces an inflammatory state in the adult adipose tissue of male offspring. We observed increased serum TNF levels in animals exposed to 300 mg DEHP per kg per day, suggesting chronic low-grade inflammation caused by in utero DEHP exposure. We localized TNF production to the SVF, where Tnf mRNA was upregulated. Quantification of TNF levels in whole-adipose lyses showed increased local TNF production starting at the 50 mg kg−1 per day in utero exposure dose, which correlates to the increased serum TNF levels, although not significant. TNF is a cytokine involved in inflammation and host-defense responses,[41] and is primarily produced by macrophages and monocytes, which are abundant in the SVF.[42] Other low-level sources of TNF include cardiac myocytes, keratinocytes[41] and adipocytes.[43] Further histological analyses showed focal adipose macrophage presence that correlates with the increased serum TNF levels. Interestingly, exposure to 1 mg DEHP per kg per day was sufficient to increase the monocyte/macrophage marker CD163, thus revealing the monocyte/macrophages as a sensitive target of DEHP. The increased TNF and CD163 expression on the contrary was not seen at 20 mg DEHP per kg per day; this could be due to the phenomenon of hormesis,[44] that is, small and large concentrations of a substance, including the phthalates,[45] have opposite effects on a cell and tissue function, and subsequent outcomes. Although the 300 mg DEHP per kg per day dose was the one with significant effects, for several parameters such as some adipose and SVF genes, and the aforementioned adipose tissue TNF and CD163 levels, there was an apparent dose–response effect. Finally, it is interesting to notice that also the TNF serum levels showed an increasing dose–response trend, although we did not reach significance. All these data together suggest that the observed phenotype might really be a direct effect of DEHP on the offspring organogenesis and physiology. The role of TNF in metabolism has been observed in knockout models, where TNF reduction improves insulin sensitivity by increasing peripheral glucose uptake.[43, 46] These results suggest that fetal exposure to low doses of DEHP induces macrophage infiltration in the adult adipose tissue, which increases local production of TNF and thus increases serum TNF levels. A main function of TNF is to induce liver production of CRP via the IL-6/IL-1 pathway.[41] CRP is an acute phase inflammation protein whose levels sharply increase (up to 1000-fold) during the inflammatory process.[41] We observed a significant increase in serum CRP levels in animals exposed to 300 mg DEHP per kg per day. Interestingly, neither liver and adipose Crp mRNA levels nor adipose tissue lysate CRP levels were affected by DEHP, suggesting another source accounts for this increase. Additional CRP production has been reported in many organs such as adipose tissue,[47] kidney[48] and pancreas.[49] These data suggest that DEHP targeted an unidentified tissue resulting in increased CRP levels that, together with TNF, contributed to a low-grade inflammatory state. Low-grade inflammation is believed to have a role in the development of obesity and metabolic syndrome.[41] In our study, IL-6 was not increased in the epididymal adipose tissue but it was significantly modified in retroperitoneal tissue at the dose of 1 mg DEHP per kg per day. Increased retroperitoneal tissue levels of TNF were seen, suggesting a differential tissue-specific response to DEHP. It remains to be examined whether DEHP-induced TNF and IL-6 is associated with CRP levels or is a consequence of the effects of DEHP in other target tissues. CRP, TNF and IL-6 have been positively correlated with visceral adiposity.[50] In addition to our data showing changes at 1 mg DEHP per kg per day in epididymal and retroperitoneal adipose tissue, we also reported that DEHP targeted the PPAR pathway in the adrenal gland starting at 1 mg DEHP per kg per day.[51] Taken all together, the data suggest that DEHP promotes multi-organ changes in gene expression and inflammatory markers at doses relevant for human exposure. Pathway analyses also identified RAS components that were up- and downregulated by DEHP in whole-adipose tissue and the SVF. The pathway studies revealed that DEHP upregulated enzymes associated with conversion of AT I to the more active ATII in whole-adipose tissue. In the SVF, angiotensinogen and the ATII receptors were downregulated, suggesting that a feedback loop was triggered in response to the local AII increase. Human adipose tissue expresses all components of the RAS pathway[52] and its deregulation has been associated with obesity.[53] A link between RAS and inflammation has also been established using transgenic mice overexpressing angiotensinogen in adipose tissue, which increased TNF, IL-6 and IL-1β mRNA levels.[54] Moreover, TNF was shown to modulate adipose RAS function by increasing ATII production in isolated subcutaneous adipocytes.[55] Mice that overexpress angiotensinogen in adipose tissue have increased circulating angiotensinogen levels and body mass, and are hypertensive.[56] Our previous study showed that DEHP targeted AT1 and AT2 receptors in the adrenal gland without increasing angiotensinogen mRNA levels in the liver or circulating levels of AT II.[16] These observations, together with the finding of decreased blood pressure in elderly rats exposed in utero to DEHP,[57] suggest that DEHP targets the local adipose RAS pathway without affecting systemic RAS. In humans, similar correlations between RAS and obesity have been found. Increases in the mRNA expression of renin, AT-converting enzyme and ATR1 in adipose tissue have been reported in an obese and hypertensive cohort.[58] The relationship between RAS and obesity appears to be dynamic because 5% reductions of body weight in postmenopausal woman decreased components of the RAS pathway in plasma and adipose tissue.[59] We identified five different fatty acid-binding proteins that were upregulated by DEHP in global gene expression analyses, but only Fabp4 was significantly upregulated using quantitative reverse transcription-PCR . Fatty acid-binding proteins are a family of highly expressed intracellular lipid-binding proteins that traffic fatty acids and their derivatives throughout cellular compartments (for example, peroxisomes, mitochondria and lipid droplets).[60] Ten different genes encoding fatty acid-binding protein isoforms have been identified in mammals.[60] Fatty acid-binding protein-4 (AP2) is highly expressed in monocytes and macrophages, and is found in white and brown adipose tissue, where it serves as a differentiation marker for adipogenesis. Increased expression of Fabp4, together with increased expression of the differentiation marker Cebpa,[61] suggests that DEHP may increase the rate or capacity of pre-adipocyte differentiation. We hypothesize that epigenetic modifications that occur during in utero DEHP exposure are driving the changes observed in the adult offspring. Pre-adipocyte development initiates around gestational day 15[62] and coincides with the window of DEHP treatment, which might result in faulty pre-adipocyte development. However, the trigger that initiates adipose tissue macrophage infiltration and increased CRP serum levels remains to be determined. In conclusion, in utero DEHP exposure promotes local inflammation in adipose tissue and low-grade chronic systemic inflammation in the adult offspring. We identified macrophages as a sensitive target of DEHP and the likely source of TNF production. We report evidence suggesting that DEHP affects pre-adipocyte development causing metabolically hindered pre-adipocytes, which ultimately leads to deregulation of the local RAS system. We hypothesize that disruption of pre-adipocyte development due to in utero DEHP exposure is a significant risk factor for the development of metabolic syndrome in adult offspring.
  60 in total

1.  Mono-2-ethylhexylphthalate (MEHP) induces TNF-α release and macrophage differentiation through different signalling pathways in RAW264.7 cells.

Authors:  Anette Kocbach Bølling; Johan Ovrevik; Jan Tore Samuelsen; Jørn A Holme; Kirsten E Rakkestad; Gro H Mathisen; Ragnhild E Paulsen; Mónica Suárez Korsnes; Rune Becher
Journal:  Toxicol Lett       Date:  2011-11-26       Impact factor: 4.372

Review 2.  Impact of endocrine-disrupting compounds (EDCs) on female reproductive health.

Authors:  Paul A Fowler; Michelle Bellingham; Kevin D Sinclair; Neil P Evans; Paola Pocar; Bernd Fischer; Kristina Schaedlich; Juliane-Susanne Schmidt; Maria R Amezaga; Siladitya Bhattacharya; Stewart M Rhind; Peter J O'Shaughnessy
Journal:  Mol Cell Endocrinol       Date:  2011-10-28       Impact factor: 4.102

3.  Adjuvant effects of inhaled mono-2-ethylhexyl phthalate in BALB/cJ mice.

Authors:  Jitka Stilund Hansen; Søren Thor Larsen; Lars K Poulsen; Gunnar Damgård Nielsen
Journal:  Toxicology       Date:  2006-12-17       Impact factor: 4.221

4.  Maternal in utero exposure to the endocrine disruptor di-(2-ethylhexyl) phthalate affects the blood pressure of adult male offspring.

Authors:  D B Martinez-Arguelles; M McIntosh; C V Rohlicek; M Culty; B R Zirkin; V Papadopoulos
Journal:  Toxicol Appl Pharmacol       Date:  2012-11-08       Impact factor: 4.219

5.  [Substance monograph for phthalates - New and updated reference and oxidized monoester metabolites in urine of children-and adults. Opinion of the Commission "Human-Biomonitoring" by the Federal Environment Agency].

Authors: 
Journal:  Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz       Date:  2011-06       Impact factor: 1.513

6.  Adipose angiotensinogen is involved in adipose tissue growth and blood pressure regulation.

Authors:  F Massiéra; M Bloch-Faure; D Ceiler; K Murakami; A Fukamizu; J M Gasc; A Quignard-Boulange; R Negrel; G Ailhaud; J Seydoux; P Meneton; M Teboul
Journal:  FASEB J       Date:  2001-10-15       Impact factor: 5.191

7.  Mono(2-ethylhexyl) phthalate induces both pro- and anti-inflammatory responses in rat alveolar macrophages through crosstalk between p38, the lipoxygenase pathway and PPARalpha.

Authors:  Kirsten E Rakkestad; Jørn A Holme; Ragnhild E Paulsen; Per E Schwarze; Rune Becher
Journal:  Inhal Toxicol       Date:  2010-02       Impact factor: 2.724

8.  Phthalate exposure and human semen parameters.

Authors:  Susan M Duty; Manori J Silva; Dana B Barr; John W Brock; Louise Ryan; Zuying Chen; Robert F Herrick; David C Christiani; Russ Hauser
Journal:  Epidemiology       Date:  2003-05       Impact factor: 4.822

9.  Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance.

Authors:  G S Hotamisligil; N S Shargill; B M Spiegelman
Journal:  Science       Date:  1993-01-01       Impact factor: 47.728

10.  In utero exposure to di-(2-ethylhexyl) phthalate exerts both short-term and long-lasting suppressive effects on testosterone production in the rat.

Authors:  Martine Culty; Raphael Thuillier; Wenping Li; Yan Wang; Daniel B Martinez-Arguelles; Carolina Gesteira Benjamin; Kostantinos M Triantafilou; Barry R Zirkin; Vassilios Papadopoulos
Journal:  Biol Reprod       Date:  2008-03-05       Impact factor: 4.285

View more
  27 in total

1.  Phthalate esters affect maturation and function of primate testis tissue ectopically grafted in mice.

Authors:  Jose R Rodriguez-Sosa; Alla Bondareva; Lin Tang; Gleide F Avelar; Krysta M Coyle; Mark Modelski; Whitney Alpaugh; Alan Conley; Katherine Wynne-Edwards; Luiz R França; Stuart Meyers; Ina Dobrinski
Journal:  Mol Cell Endocrinol       Date:  2014-10-27       Impact factor: 4.102

Review 2.  Adipose Tissue as a Site of Toxin Accumulation.

Authors:  Erin Jackson; Robin Shoemaker; Nika Larian; Lisa Cassis
Journal:  Compr Physiol       Date:  2017-09-12       Impact factor: 9.090

3.  Longitudinal Metabolic Impacts of Perinatal Exposure to Phthalates and Phthalate Mixtures in Mice.

Authors:  Kari Neier; Drew Cheatham; Leah D Bedrosian; Brigid E Gregg; Peter X K Song; Dana C Dolinoy
Journal:  Endocrinology       Date:  2019-07-01       Impact factor: 4.736

4.  In utero growth restriction and catch-up adipogenesis after developmental di (2-ethylhexyl) phthalate exposure cause glucose intolerance in adult male rats following a high-fat dietary challenge.

Authors:  Rita S Strakovsky; Stéphane Lezmi; Ielyzaveta Shkoda; Jodi A Flaws; William G Helferich; Yuan-Xiang Pan
Journal:  J Nutr Biochem       Date:  2015-06-20       Impact factor: 6.048

5.  Serum PFAS and Urinary Phthalate Biomarker Concentrations and Bone Mineral Density in 12-19 Year Olds: 2011-2016 NHANES.

Authors:  Jenny L Carwile; Shravanthi M Seshasayee; Katherine A Ahrens; Russ Hauser; Jeffrey B Driban; Clifford J Rosen; Catherine M Gordon; Abby F Fleisch
Journal:  J Clin Endocrinol Metab       Date:  2022-07-14       Impact factor: 6.134

Review 6.  Polluted Pathways: Mechanisms of Metabolic Disruption by Endocrine Disrupting Chemicals.

Authors:  Mizuho S Mimoto; Angel Nadal; Robert M Sargis
Journal:  Curr Environ Health Rep       Date:  2017-06

7.  Prenatal Phthalate Exposures and Body Mass Index Among 4- to 7-Year-old Children: A Pooled Analysis.

Authors:  Jessie P Buckley; Stephanie M Engel; Joseph M Braun; Robin M Whyatt; Julie L Daniels; Michelle A Mendez; David B Richardson; Yingying Xu; Antonia M Calafat; Mary S Wolff; Bruce P Lanphear; Amy H Herring; Andrew G Rundle
Journal:  Epidemiology       Date:  2016-05       Impact factor: 4.822

Review 8.  Phthalate exposure as a risk factor for hypertension.

Authors:  Xueling Lu; Xijin Xu; Yucong Lin; Yu Zhang; Xia Huo
Journal:  Environ Sci Pollut Res Int       Date:  2018-06-03       Impact factor: 4.223

9.  Associations of Phthalate Metabolites and Bisphenol A Levels with Obesity in Children: The Korean National Environmental Health Survey (KoNEHS) 2015 to 2017.

Authors:  Moon Young Seo; Shinje Moon; Shin-Hye Kim; Mi Jung Park
Journal:  Endocrinol Metab (Seoul)       Date:  2022-04-07

Review 10.  Endocrine disrupting chemicals: Friend or foe to brown and beige adipose tissue?

Authors:  Cynthia E Francis; Logan Allee; Helen Nguyen; Rachel D Grindstaff; Colette N Miller; Srujana Rayalam
Journal:  Toxicology       Date:  2021-10-02       Impact factor: 4.571

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.