Literature DB >> 24790599

Gene expression profiling of the paracrine effects of uterine natural killer cells on human endometrial epithelial cells.

Xin Gong1, Zhenzhen Chen2, Yanxia Liu1, Qiudan Lu1, Zhe Jin1.   

Abstract

The endometrium contains a population of immune cells that undergo changes during implantation and pregnancy. The majority of these cells are uterine natural killer (uNK) cells; however, it is unclear how these cells interact with endometrial epithelial cells. Therefore, we investigated the paracrine effects of the uNK cell-secretion medium on the gene expression profile of endometrial epithelial cells in vitro through microarray analysis. Our results, which were verified by qRT-PCR and western blot, revealed that soluble factors from uNK cells alter the gene expression profiles of epithelial cells. The upregulated genes included interleukin-15 (IL-15) and interleukin-15 receptor alpha (IL-15RA), which result in a loop that stimulates uNK cell proliferation. In addition, vascular endothelial growth factor C (VEGF-C) and chemokine (C-X-C motif) ligand 10 (CXCL-10) were also determined to be upregulated in epithelial cells, which suggests that uNK cells work synergistically with epithelial cells to support implantation and pregnancy. In addition, oriental herbal medicines have been used to treat infertility since ancient times; however, we failed to find that Zi Dan Yin can regulate these endometrial paracrine effects.

Entities:  

Year:  2014        PMID: 24790599      PMCID: PMC3984803          DOI: 10.1155/2014/393707

Source DB:  PubMed          Journal:  Int J Endocrinol        ISSN: 1687-8337            Impact factor:   3.257


1. Introduction

In the human endometrium, uterine leucocytes undergo cyclic changes during the menstrual cycle. Uterine adaptation to pregnancy includes highly regulated immune cell trafficking [1]. According to recent studies, uterine natural killer (uNK) cells are an in vivo factor that contributes to the pathological elongation of the window of endometrial receptivity [2]. The genetic deficiency of uNK cells results in a lack of remodeling of the uterine vasculature, leading to hypertrophied vascular media, swollen endothelial cells, and narrow vessel lumens [3]. Abnormal activation and numbers of uNK cells have been implicated in pregnancy complications [4]. uNK cells are the most abundant leucocytes during the implantation window and early pregnancy [5]. This sharp increase is likely due to the proliferation of existing uNK cells [6-8]. Hormonal effects may control this proliferation. However, to date, progesterone receptors have not been localized on these cells [9]; therefore, it has been proposed that progesterone may exert its effects on uNK cells indirectly via cytokines, such as interleukin-15 (IL-15), and other soluble factors [8, 10]. A previous study indicated that the paracrine communication between uterine leucocytes (>85% uNK) and uterine stromal cells can upregulate IL-15 and interleukin-15 receptor alpha (IL-15RA) to induce the proliferation of uNK cells and contributes to the support of trophoblast migration during implantation [11]. uNK cells are resident throughout the endometrium at the time of conception and throughout early pregnancy. Although uNK cells predominantly localize to the uterine stroma and the surrounding areas of the spiral arteries, Matrigel-supported cocultures of endothelial cells and uNK cells have shown that vascular endothelial growth factor C (VEGFC) producing uNK cells induce transporter 1 (TAP-1) expression in endothelial cells [12]. Furthermore, the endometrium undergoes precisely defined morphological and biochemical changes during implantation and early pregnancy; thus, there is no doubt that the preparation of epithelial cells is directed towards these process. We hypothesize that there similar paracrine communications occur between uNK cells and uterine epithelial cells. Our results revealed that soluble factors from uNK cells have substantial effects on endometrial epithelial gene expression. uNK cells were found to upregulate transcript levels in epithelial cells that are known to promote uNK cell proliferation, and these upregulated transcripts may contribute to the preparation for implantation and trophoblast migration and invasion. In China, oriental herbal medicines have been used to treat infertility since ancient times [13]. Zi Dan Yin (ZDY), a compound of nine herbs (Table 1), was found to improve the morphology of the endometrium in mice [14]. Although the treatment effects of ZDY on mice have been confirmed, it is unclear whether ZDY contributes to the local immune responses. However, our results do not support the hypothesis that ZDY can improve the paracrine effects between uNK and endometrial epithelial cells.
Table 1

Composition of Zi Dan Yin (ZDY).

ComponentsRatio
(1) Sheng Di (Rehmannia glutinosa (Gaertn.) Libosch., root) 15
(2) Dan Shen (Salviae Miltiorrhizae Bge., root)10
(3) Dang gui (Angelica sinensis (Oliv.) Diels., root)12
(4) Chuan Duan (Dipsacus asperoides C. Y. Cheng et T.M. Ai., root)15
(5) Du Zhong (Eucommia ulmoides Oliv., cortex)12
(6) Shan Yao (Dioscorea opposita Thunb., rhizome)15
(7) Mei Gui-hua (Rosa rugosa Thunb., flower)6
(8) Chuan Xiong (Ligusticum Chuanxiong Hort., rhizome)6
(9) Yi Yi-ren (Coix lacryma-jobi L. var. ma-yuen (Roman.) Stapf., seed)12

2. Materials and Methods

2.1. Ethics Statement

All of the subjects understood and signed the informed consent form before participation. The experimental protocols were approved by the Ethics Committee of the Dongfang Hospital Human Ethics Committee (no. 2011090201).

2.2. Collection of Material

Decidual tissues were obtained from healthy women undergoing elective termination of a normal pregnancy between 7 and 8 weeks of gestation. The endometrial tissues were collected from endometrial biopsies taken during the proliferative phase of the cycle from women undergoing laparoscopy (Dongfang Hospital of Beijing University of Chinese Medicine, China) for benign disease. The average age was 30 ± 1.3 years, and the body mass index (BMI) was 22.1 ± 0.8 kg/m2. All of the nine women were Chinese of Han ethnicity. The exclusion criteria were hormonal stimulation, cancerous lesions, and irregular menstrual bleeding.

2.3. Isolation of the Uterine NK (uNK) Cells

The uNK cells were isolated as previously described [15, 16]. Briefly, the decidual tissues were extensively washed with Ca2+- and Mg2+-free Hank's balanced salt solution (HBSS) containing antibiotics, minced thoroughly between two scalpels into fragments of 1-2 mm3, and digested for 1 h at 37°C with gentle agitation in HBSS with 0.1% (w/v) collagenase I (Gibco, USA). The cell suspensions were layered over Ficoll-Hypaque medium (General Electric, USA) and centrifuged at 800 ×g and room temperature for 25 min. The cells at the interface were washed twice with Roswell Park Memorial Institute (RPMI)-1640 media with 10% fetal calf serum (FCS) and antibiotics. After incubation for 20 min at 4°C with anti-CD56 microbeads (Miltenyi Biotec, Ltd., Germany), the cells were washed with washing buffer (PBS, 2 mM EDTA, and 0.5%BSA (w/v)) and then loaded onto a MiniMACS Separator (MS) column in a MiniMACS magnet (Miltenyi Biotec, Ltd., Germany). After flushing the MS column three times, the CD56+ cells were flushed as indicated by the manufacturer. The purity of the uNK cells was >90% CD56+CD3− according to the flow cytometric analysis. The uNK cells were cultured in RPMI 1640 media with 1% FCS and IL-15 (10 ng/mL) (R&D systems, USA), in which to maintain the viability of the purified uNK cells [17].

2.4. Production of uNK Cell-Secretion Medium

The uNK cell-secretion medium was prepared using 200 μL of RPMI 1640 media with 1% FCS and IL-15 (10 ng/mL) containing 5 × 105 of the purified uNK cells. The cell suspension was placed in the upper chamber of a 0.4 μm pore hanging cell culture insert (Millipore, USA) in a 24-well tissue plate, and 1300 μL of the same media without cells was placed in the lower chamber. As a result, only the soluble molecules from the uNK cells can pass through the filter into the lower chamber. The control medium was 1500 μL of the RPMI 1640 media with 1% FCS and IL-15 (10 ng/mL), and this control medium was also used in the subsequent experiments. After incubation for 24 h at 37°C, the uNK cell-secretion medium (in the lower chamber) and the control medium were collected and frozen at −80°C. The cells in the upper chamber were collected, and the cell viability was measured using a live/dead viability kit (Invitrogen, USA). Only the conditional medium from uNK populations with less than 35% dead cells after overnight incubation was used in the subsequent experiments.

2.5. Human Endometrial Epithelial Cell Culture

Human endometrial tissue was cut using scissors and dissociated into single-cell suspensions using 0.1% (w/v) collagenase I for 50–60 min. Every 15 min, the digests were pipetted, and their dissociation was monitored by microscopy. The cell suspensions were filtered using a 40-mesh screen to separate the single cells from undigested tissue. To remove the erythrocytes, the cells were resuspended in 4 mL of Dulbecco's modified Eagle's medium and Ham's nutrient F12 (DMEM/F12) with 1% FCS, layered over Ficoll-Paque PLUS, and centrifuged for 25 min at 800 ×g. The leukocytes were removed with CD45-coated Dynabeads (Dynal Biotech, USA). The purified epithelial cell suspensions were then obtained through a further round of magnetic bead sorting using Collection Epithelial Dynabeads (Dynal Biotech, USA). The epithelial cell preparations were >95% pure. The endometrial epithelial cells were cultured in serum-free bronchial epithelial growth medium (BEGM, Clonetics Crop) containing 2 mL of bovine pituitary extract (BPE), 0.5 mL of insulin, 0.5 mL of hydrocortisone (HC), 0.5 mL of gentamicin sulfate and amphotericin-B (GA-1000), 0.5 mL of retinoic acid, 0.5 mL of transferrin, 0.5 mL of triiodothyronine, 0.5 mL of epinephrine, and 0.5 mL of recombinant human epidermal growth factor (hEGF) (all supplied by Clonetics Corp., USA). The media was changed every five days. After two weeks, the epithelial cells were passed from six-well plates into 25 cm2 cell culture flasks.

2.6. ZDY Preparation

All of the crude drugs of ZDY were obtained from the Pharmacy Department of Dongfang Hospital of Beijing University of Chinese Medicine (Beijing Province, China). The quality of the raw herbs was controlled according to the requirement of the Pharmacopoeia of China. The aqueous extract of ZDY was prepared as follows. In brief, nine medicinal materials were mixed at the appropriate proportion, macerated for 1 h with eight volumes of distilled water and then decocted for 2 h. The cooled extract was then filtered. This extraction procedure was repeated twice. The extracts were then combined and concentrated by boiling to a final volume of 100 mL (10.3 g/mL). The ZDY extract concentration of 2 mg/mL was further diluted with the epithelial cell culture medium and passed through 0.2 μm sterilization filters for use in subsequent studies. The ZDY extract was stored at 2–8°C until further use. The concentration of ZDY was used according to previous analyses using a cell counting kit-8 (CCK-8).

2.7. Treatment of Epithelial Cells with uNK Cell-Secretion Medium

The endometrial epithelial cells were allocated into three groups: control, uNK, and ZDY groups. The cells in the control and uNK groups were treated with DMEM medium with 10% FBS for 24 h, and the cells in the ZDY group were treated with 2 mg/mL ZDY for 24 h. All of the cells were then washed twice with PBS and placed in serum-free DMEM for 24 h prior to the subsequent experiments. The uNK cell-secretion medium was pooled from different batches to decrease the variability. The DMEM in the ZDY and uNK groups was then replaced with 80% uNK cell-secretion medium and 20% serum-free DMEM. The control group was treated with 80% control medium and 20% serum-free DMEM. After 6 h of incubation, the cells from the three groups were collected.

2.8. Microarray Experiments

The total RNA from endometrial epithelial cells from the control, uNK, and ZDY groups was extracted using Trizol (Invitrogen, USA). The RNA was purified using the RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer's instructions, quantified by spectrophotometry. The microarray analysis was performed using the GeneChip 3′ IVT Express Kit (Affymetrix). Briefly, the total RNA was subjected to reverse transcription, first-strand cDNA synthesis, double-strand DNA, in vitro transcription, and fragmentation. The samples were hybridized onto the GeneChip PrimeView Human Gene Expression Array (Affymetrix, USA), which covers more than 36,000 transcripts and variants. After 16 h of hybridization at 45°C, the arrays were washed on a Fluidics Station 450 (Affymetrix, USA) and then scanned with a Scanner 3000 (Affymetrix, USA) to obtain the quantitative gene expression levels. The endometrial epithelial cells from the control, uNK, and ZDY groups were processed simultaneously throughout the experimental process, and three chips were used for each group.

2.9. Quantitative Real-Time PCR (qRT-PCR) Analysis

To verify the results obtained from the microarray experiments, qRT-PCR verification was performed for five genes: chemokine (C-X-C motif) ligand 10 (CXCL-10), interleukin-15 (IL-15), intercellular adhesion molecule 1 (ICAM-1), NLR family CARD domain containing 5 (NLRC-5), and interferon regulatory factor 1 (IRF-1). The cells from the control, uNK, and ZDY groups were washed twice with PBS, and the total RNA was then extracted using Trizol. The RNA was quantified by spectrophotometry. Reverse transcription was performed with 8 μL of total RNA in a 20 µL reaction volume using a standard cDNA Synthesis Kit (Takara BIO, Japan). The qRT-PCR primer sequences for the target genes were self-designed, and the PCR primers were ordered from Invitrogen. The primer sequences for target genes are shown in Table 2.
Table 2

Sequences of primers used in the quantitative real-time PCR analysis.

GeneForward primerReverse primerAmplicon
CXCL-10CTTTCTGACTCTAAGTGGCATTCCACCCTTCTTTTTCATTGTAGCAA176 bp
IL-15TGGCTGCTGGAAACCCCACAAGTAGCACTGGATGGAAAT123 bp
ICAM-1GAGGAAGGAGCAAGACTCAAAGCATACCCAATAGGCAGCAAG141 bp
NLRC-5AAACTTGATGACTCCTCCCTTACTTTTAGACCTGGCTTTGTCCCTTAC120 bp
IRF-1CCAGAAAAGCATAACACCAATCCCCACTTTCCTTCACATTTCACTG144 bp
GAPDHGAGCCAAAAGGGTCATCATCTAGGGGCCATCCACAGTCTTC231 bp
For each qRT-PCR reaction, the typical thermal cycling conditions included an initial activation step of 95°C for 5 min and 45 cycles of 95°C each for 30 sec, 65°C for 35 sec, and 72°C for 5 min. The PCR reactions were performed on an ABI Prism 7700 Sequence Detection System (Applied Biosystems, USA). For comparison of the target mRNA levels, the cDNA concentration was normalized with that of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) PCR product. The target mRNA expression was analyzed using the 2-ΔΔCt algorithm.

2.10. Western Blot Analysis of ICAM-1

The cells from the control, uNK, and ZDY groups were lysed with RIPA lysis buffer (Applygen, China) supplemented with a protease inhibitor cocktail (Applygen, China). The protein concentrations were quantified using bicinchoninic acid (BCA; Applygen, China). The proteins were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose. The blots were blocked overnight in Tris-buffered-saline with Tween (TBST) containing 5% dried milk, washed three times for 5 min each in TBST, and then incubated overnight in a rocker at 4°C with a cocktail containing ICAM-1 (Abcam, UK; at a dilution of 1 : 1000) and 2% dried milk in TBST. The blots were then washed three times for 10 min each in TBST and incubated with the secondary antibody (Applygen, China; at a dilution of 1 : 10000) for 1 h at room temperature in a rocker. The blots were washed three times for 10 min each in TBST and then visualized with the Super ECL Plus Detection Reagent (Applygen, China). The ECL signals were detected with the Quantity One software (Bio-Rad, USA). GAPDH (Abcam, UK) was used as the internal control to validate the amount of protein.

2.11. Statistical Analysis

All of the variables were tested in three different culture experiments. The data were analyzed by ANOVA. In the microarray experiments, the significance level was determined by ANOVA with Benjamini-Hochberg correction (P < 0.001). We selected the up- and downregulated genes that showed a median fold change greater than 2 and a P < 0.001. The data from the qRT-PCR and western blot analyses are presented as means ± SEM after normalization with the average value of the housekeeping gene obtained for each group, and the significance level was P < 0.01. The graphs of the data were produced using the Microsoft Excel software.

3. Results

3.1. Microarray Experiments

Gene expression profiling using a microarray was used to compare the transcript expression levels in epithelial cells treated with control medium, uNK cell-secretion medium, and ZDY+ uNK cell-secretion medium. This analysis identified 169 transcripts that exhibited a statistically significant change in their median expression level (either upregulated or downregulated) in response to uNK cell-secretion medium compared with their control level. These transcripts are listed in Table 3. A total of 40 genes were found upregulated, and 129 genes were downregulated. The largest group of upregulated genes included immunomodulatory gene regulators, cytokines, such as interleukin-15 (IL-15), chemokine (C-X-C motif) ligand 10 (CXCL-10), and vascular endothelial growth factor C (VEGF-C), and cytokine receptors, such as interleukin-15 receptor alpha (IL-15RA). Additionally, the upregulated transcripts encode proteins associated with transport, structuration, and transcription. The level of adhesion molecule intercellular adhesion molecule 1 (ICAM-1) was also altered. ICAM-1 binds to the leucocyte integrins LFA-1 and Mac-1 [18, 19], which are expressed on uNK cells. Thus, this change in the level of ICAM-1 should increase the localized interactions between uNK cells and epithelial cells. A number of transcripts regulating enzyme activity, such as the deltex 3-like (Drosophila) (DYX3L) and the proteasome (prosome, macropain) subunit beta type 9 (large multifunctional peptidase 2) (PSMB9), and several transcripts regulating nucleotide metabolism genes, such as guanylate binding protein 5 (GBP5) and guanylate binding protein 1 interferon-inducible (GBP1), were also upregulated. In addition, genes with various functions, such as the icon binding complement component 1S subcomponent (C1S), SP110 nuclear body protein (SP110), tryptophan metabolism indoleamine 2,3-dioxygenase 1 (IDO1), and tryptophanyl-tRNA synthetase (WARS), and several genes with unknown function were found to be upregulated. The largest group of downregulated genes encodes transcription factors, such as B double prime 1 subunit of RNA polymerase III transcription initiation factor IIIB (BDP1) and thyroid hormone receptor interactor 11 (TRIP11). The levels of immunomodulatory gene regulators, including interleukin-36 gamma (IL-36G) and interleukin-33 (IL-33), were also altered. The levels of transcripts encoding molecules responsible for signaling, transport, structuration, and cell-cell adhesion were also downregulated. In addition, genes with various functions, such as ion binding, kinase, enzyme activity, and nucleotide metabolism, were found to be downregulated.
Table 3

Transcripts that were altered by more than twofold in endometrial epithelial cells by stimulation with the uNK cell-secretion medium (P < 0.001). The transcript levels were obtained using a GeneChip PrimeView Human Gene Expression Array.

Gene symbolFold changeGene IDDescription
Upregulated genes: 40 transcripts
Cytokines/membrane proteins/immunological factors
 NLRC514.184166NLR family, CARD domain containing 5
 IL155.83600Interleukin-15
 IFIT35.83437Interferon-induced protein with tetratricopeptide repeats 3
 CXCL103.13627Chemokine (C-X-C motif) ligand 10
 IFIH12.964135Interferon induced with helicase C domain 1
 IFIT52.824138Interferon-induced protein with tetratricopeptide repeats 5
 IL-15RA2.73601Interleukin-15 receptor, alpha
 VEGFC2.57424Vascular endothelial growth factor C
 PDCD1LG22.580380Programmed cell death 1 ligand 2
Transporters
 TAP13.46890Transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
 TAP22.66891Transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
 APOL32.180833Apolipoprotein L, 3
 VLDLR2.17436Very low density lipoprotein receptor
 APOL22.123780Apolipoprotein L, 2
Structural factors
 LMNB14.34001Lamin B1
Transcription
 IRF1113659Interferon regulatory factor 1
 IRF94.910379Interferon regulatory factor 9
 STAT14.56772Signal transducer and activator of transcription 1, 91 kda
 TAF152.18148TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68 kda
Cell-cell adhesion
 ICAM15.13383Intercellular adhesion molecule 1
Ion binding
 C1S3.2716Complement component 1, s subcomponent
 SP1102.93431SP110 nuclear body protein
 PARP122.364761Poly (ADP-ribose) polymerase family, member 12
 ZC3HAV12.356829Zinc finger CCCH-type, antiviral 1
Tryptophan metabolism
 IDO16.23620Indoleamine 2,3-dioxygenase 1
 WARS4.27453Tryptophanyl-trna synthetase
Enzyme activity
 DTX3L4.6151636Deltex 3-like (Drosophila)
 PSMB93.35698Proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2)
 MSRB12.551734Methionine sulfoxide reductase B1
 CTSZ2.21522Cathepsin Z
Nucleotide metabolism
 GBP510.5115362Guanylate binding protein 5
 GBP15.82633Guanylate binding protein 1, interferon-inducible
 PARP145.254625Poly (ADP-ribose) polymerase family, member 14
 GBP23.22634Guanylate binding protein 2, interferon-inducible
 MX12.54599Myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
 RAD23B2.35887RAD23 homolog B (S. Cerevisiae)
 GBP72388646Guanylate binding protein 7
Others
 FAM117B3.6150864Family with sequence similarity 117, member B
 C19orf662.655337Chromosome 19 open reading frame 66
 NUB12.551667Negative regulator of ubiquitin-like proteins 1

Downregulated genes: 129 transcripts
Cytokines/membrane proteins/immunological factors
 IL36G−3.456300Interleukin-36, gamma
 IL33−3.090865Interleukin-33
 IL1RN−2.53557Interleukin-1 receptor antagonist
 DNAJB14−2.579982Dnaj (Hsp40) homolog, subfamily B, member 14
 KITLG−2.34254KIT ligand
 LARP4−2.3113251La ribonucleoprotein domain family, member 4
 CLDN4−2.21364Claudin 4
 CUL5−2.28065Cullin 5
Intracellular/signalling factors
 ITGB8−3.53696Integrin, beta 8
 RICTOR−2.8253260RPTOR independent companion of MTOR, complex 2
 IL6ST−2.63572Interleukin-6 signal transducer (gp130, oncostatin M receptor)
 SOCS4−2.5122809Suppressor of cytokine signaling 4
 NRIP1−2.58204Nuclear receptor interacting protein 1
 SEMA3A−2.510371Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
 PLCB4−2.25332Phospholipase C, beta 4
 COPS2−2.29318COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
 BMPR2−2659Bone morphogenetic protein receptor, type II (serine/threonine kinase)
Transporters
 TPR−3.47175Translocated promoter region, nuclear basket protein
 KIAA1033−2.523325Kiaa1033
 BAZ2B−2.529994Bromodomain adjacent to zinc finger domain, 2B
 TMED5−2.250999Transmembrane emp24 protein transport domain containing 5
 SLC4A7−29497Solute carrier family 4, sodium bicarbonate cotransporter, member 7
Structural factors
 ROCK2−2.99475Rho-associated, coiled-coil containing protein kinase 2
Transcription
 BDP1−3.655814B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
 TRIP11−3.49321Thyroid hormone receptor interactor 11
 ZNF644−3.384146Zinc finger protein 644
 CHD9−3.280205Chromodomain helicase DNA binding protein 9
 ZNF480−3.1147657Zinc finger protein 480
 ZNF292−323036Zinc finger protein 292
 ZNF148−2.87707Zinc finger protein 148
 ZNF267−2.810308Zinc finger protein 267
 ZBTB20−2.726137Zinc finger and BTB domain containing 20
 CREB1−2.71385Camp responsive element binding protein 1
 ZNF638−2.627332Zinc finger protein 638
 ZNF518A−2.69849Zinc finger protein 518A
 ESF1−2.651575ESF1, nucleolar pre-rrna processing protein, homolog (S. Cerevisiae)
 FAR1−2.684188Fatty acyl coa reductase 1
 ZNF91−2.57644Zinc finger protein 91
 CENPF−2.51063Centromere protein F, 350/400 kda (mitosin)
 FOXN2−2.43344Forkhead box N2
 DNTTIP2−2.230836Deoxynucleotidyl transferase, terminal, interacting protein 2
 TMF1−2.27110TATA element modulatory factor 1
 BCLAF1−2.29774BCL2-associated transcription factor 1
 CEBPZ−2.210153CCAAT/enhancer binding protein (C/EBP), zeta
 ZNF146−2.17705Zinc finger protein 146
 HIF1A−23091Hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Cell-cell adhesion
 DST−2.9667Dystonin
Ion binding
 ATRX−4.6546Alpha thalassemia/mental retardation syndrome X-linked
 EEA1−3.48411Early endosome antigen 1
 RSF1−2.651773Remodeling and spacing factor 1
 NIN−2.651199Ninein (GSK3B interacting protein)
 SCAF11−2.59169SR-related CTD-associated factor 11
 MIB1−257534Mind bomb E3 ubiquitin protein ligase 1
 TRMT13−254482Trna methyltransferase 13 homolog (S. Cerevisiae)
Kinase
 CCDC88A−3.155704Coiled-coil domain containing 88A
 FER−3.12241Fer (fps/fes related) tyrosine kinase
 KTN1−33895Kinectin 1 (kinesin receptor)
 SCYL2−2.655681SCY1-like 2 (S. Cerevisiae)
 AKAP11−2.511215A kinase (PRKA) anchor protein 11
 PIK3C2A−2.55286Phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
 CDK6−2.31021Cyclin-dependent kinase 6
 NEK1−2.34750NIMA (never in mitosis gene a)-related kinase 1
 SLK−2.29748STE20-like kinase
 UTRN−2.27402Utrophin
 RB1CC1−29821RB1-inducible coiled-coil 1
 YES1−27525V-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
Enzyme activity
 RANBP2−2.95903RAN binding protein 2
 JMJD1C−2.7221037Jumonji domain containing 1C
 RNF6−2.76049Ring finger protein (C3H2C3 type) 6
 LTN1−2.626046Listerin E3 ubiquitin protein ligase 1
 RBBP6−2.55930Retinoblastoma binding protein 6
 PPIG−2.59360Peptidylprolyl isomerase G (cyclophilin G)
 PTAR1−2.4375743Protein prenyltransferase alpha subunit repeat containing 1
 PYROXD1−2.379912Pyridine nucleotide-disulphide oxidoreductase domain 1
 LIG4−2.33981Ligase IV, DNA, ATP-dependent
 RAD50−2.110111RAD50 homolog (S. Cerevisiae)
 DBF4−210926DBF4 homolog (S. Cerevisiae)
Nucleotide metabolism
 CHD1−2.61105Chromodomain helicase DNA binding protein 1
 CHML−2.51122Choroideremia-like (Rab escort protein 2)
 ELMOD2−2.1255520ELMO/CED-12 domain containing 2
 NAA15−280155N(alpha)-acetyltransferase 15, nata auxiliary subunit
 KIF20B−29585Kinesin family member 20B
Others
 GOLGA4−3.92803Golgin A4
 ASPM−3.4259266Asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
 CEP350−3.39857Centrosomal protein 350 kda
 C10orf118−3.255088Chromosome 10 open reading frame 118
 GALNT5−3.211227UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (galnac-T5)
 BOD1L1−3.1259282Biorientation of chromosomes in cell division 1-like 1
 ANKRD12−3.123253Ankyrin repeat domain 12
 RIF1−355183RAP1 interacting factor homolog (yeast)
 KIAA2026−3158358Kiaa2026
 FAM111B−2.9374393Family with sequence similarity 111, member B
 EIF5B−2.89669Eukaryotic translation initiation factor 5B
 OSBPL8−2.8114882Oxysterol binding protein-like 8
 GOLGB1−2.82804Golgin B1
 MALAT1−2.7378938Metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)
 PRPF40A−2.755660PRP40 pre-mrna processing factor 40 homolog A (S. Cerevisiae)
 QSER1−2.679832Glutamine and serine rich 1
 THOC2−2.657187THO complex 2
 RASSF6−2.6166824Ras association (ralgds/AF-6) domain family member 6
 STAG2−2.610735Stromal antigen 2
 NUFIP2−2.557532Nuclear fragile X mental retardation protein interacting protein 2
 SMC2−2.510592Structural maintenance of chromosomes 2
 SLC30A1−2.57779Solute carrier family 30 (zinc transporter), member 1
 ZNF268−2.410795Zinc finger protein 268
 KIAA1109−2.484162Kiaa1109
 NIPBL−2.425836Nipped-B homolog (Drosophila)
 ANKRD30BP2−2.4149992Ankyrin repeat domain 30B pseudogene 2
 KIF5B−2.43799Kinesin family member 5B
 SMC4−2.310051Structural maintenance of chromosomes 4
 SMC5−2.323137Structural maintenance of chromosomes 5
 NEMF−2.39147Nuclear export mediator factor
 GCC2−2.39648GRIP and coiled-coil domain containing 2
 EXOC5−2.310640Exocyst complex component 5
 FCHO2−2.3115548FCH domain only 2
 SMC6−2.379677Structural maintenance of chromosomes 6
 HOOK3−2.284376Hook homolog 3 (Drosophila)
 LGALSL−2.129094Lectin, galactoside-binding-like
 SEMA3C−2.110512Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
 TMEM106B−2.154664Transmembrane protein 106B
 PCM1−2.15108Pericentriolar material 1
 KRTAP2-3−2.1730755Keratin associated protein 2-3
 MACC1−2.1346389Metastasis associated in colon cancer 1
 CCDC82−2.179780Coiled-coil domain containing 82
 TTC37−2.19652Tetratricopeptide repeat domain 37
 UACA−2.155075Uveal autoantigen with coiled-coil domains and ankyrin repeats
 CEP290−280184Centrosomal protein 290 kda
 USP53−254532Ubiquitin specific peptidase 53
 METRNL−2284207Meteorin, glial cell differentiation regulator-like
The microarray analysis identified 51 transcripts in epithelial cells that exhibited a statistically significant change in their median expression level (either upregulated or downregulated) in response to pretreatment with ZDY and treatment with the uNK cell-secretion medium compared with their level in response to treatment with uNK cell-secretion medium (Table 4). Of these genes, 33 were downregulated, and 18 were upregulated. The largest group of upregulated genes includes the following: enzyme asparagine synthetase (glutamine-hydrolyzing) (ASNS) and aldo-keto reductase family 1 member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) (AKR1C1). The transcripts encoding molecules responsible for signal transduction, namely, aldo-keto reductase family 1 member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III) (AKR1C2) and structuration, such as talin 1 (TLN 1) and keratin 75 (KRT75), were also upregulated. The levels of transcripts encoding proteins that regulate transcription and ion binding, such as nuclear protein transcriptional regulator 1 (NUPR1) and S100 calcium binding protein A8 (S100A8), were also altered, and several genes with unknown function were found to be upregulated. The downregulated transcripts included only two genes of known function that were downregulated by more than 4fold: lamin B1 (LMNB1, a structural factor) and tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 (TNKS2, an enzyme activator). The genes that were downregulated by more than 2fold included the genes encoding the cytokines chemokine (C-X-C motif) ligand 3 (CXCL3) and caprin family member 2 (CAPRIN2), the transporter component of the oligomeric golgi complex 5 (COG5), and various genes associated with transcription, kinase, ion binding, and nucleotide metabolism.
Table 4

Transcripts that were altered by more than twofold in endometrial epithelial cells by stimulation with ZDY and uNK cell-secretion medium (P < 0.001). The transcript levels were obtained using a GeneChip PrimeView Human Gene Expression Array.

Gene symbolFold changeGene IDDescription
Upregulated genes: 18 transcripts
Intracellular/signalling factors
 AKR1C22.71646Aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)
Structural factors
 TLN12.77094Talin 1
 KRT752.09119Keratin 75
Transcription
 NUPR12.626471Nuclear protein, transcriptional regulator, 1
Ion binding
 S100A82.16279S100 calcium binding protein A8
Enzyme activity
 ASNS5.2440Asparagine synthetase (glutamine-hydrolyzing)
 AKR1C13.31645Aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)
 NQO12.91728NAD(P)H dehydrogenase, quinone 1
 CBS2.5875Cystathionine-beta-synthase
 AKR1C32.38644Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)
 PSAT12.229968Phosphoserine aminotransferase 1
 HMOX12.23162Heme oxygenase (decycling) 1
 GPX22.22877Glutathione peroxidase 2 (gastrointestinal)
 DHRS32.19249Dehydrogenase/reductase (SDR family) member 3
 H1FX2.18971H1 histone family, member X
Others
 SLC7A113.123657Solute carrier family 7 (anionic amino acid transporter light chain, xc-system), member 11
 CTH2.41491Cystathionase (cystathionine gamma-lyase)
 HSPB82.226353Heat shock 22 kda protein 8

Downregulated genes: 33 transcripts
Cytokines/membrane proteins/signalling factors
 CXCL3−2.12921Chemokine (C-X-C motif) ligand 3
 CAPRIN2−2.065981Caprin family member 2
Transporters
 COG5−2.010466Component of oligomeric golgi complex 5
Structural factors
 LMNB1−5.54001Lamin B1
 PNN−2.95411Pinin, desmosome associated protein
 MFAP5−2.28076Microfibrillar associated protein 5
 RPL37A−2.26168Ribosomal protein l37a
Transcription
 HIRA−3.67290HIR histone cell cycle regulation defective homolog A (S. Cerevisiae)
 YAP1−2.410413Yes-associated protein 1
 ZNF226−2.47769Zinc finger protein 226
 TAF15−2.18148TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68 kda
 NFKBIZ−2.164332Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Ion binding
 ZDHHC11−2.279844Zinc finger, DHHC-type containing 11
 RNF145−2.1153830Ring finger protein 145
Kinase
 AHSA2−2.0130872AHA1, activator of heat shock 90 kda protein atpase homolog 2 (yeast)
Enzyme activity
 TNKS2−7.780351Tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Nucleotide metabolism
 RAD23B−2.05887RAD23 homolog B (S. Cerevisiae)
 RCC1−2.01104Regulator of chromosome condensation 1
Others
 GOLGA8A−5.423015Golgin A8 family, member A
 LUC7L3−3.851747LUC7-like 3 (S. Cerevisiae)
 HNRNPA2B1−2.93181Heterogeneous nuclear ribonucleoprotein A2/B1
 XIST−2.87503X (inactive)-specific transcript (non-protein coding)
 SNORA33−2.6594839Small nucleolar RNA, H/ACA box 33
 SNHG12−2.585028Small nucleolar RNA host gene 12 (non-protein coding)
 C20orf197−2.4284756Chromosome 20 open reading frame 197
 EML2−2.424139Echinoderm microtubule associated protein like 2
 PNISR−2.325957PNN-interacting serine/arginine-rich protein
 KIAA0020−2.39933Kiaa0020
 HMMR−2.23161Hyaluronan-mediated motility receptor (RHAMM)
 NOP58−2.251602NOP58 ribonucleoprotein homolog (yeast)
 PILRB−229990Paired immunoglobin-like type 2 receptor beta
 NCAPG−264151Non-SMC condensin I complex, subunit G
 PICALM−28301Phosphatidylinositol binding clathrin assembly protein

3.2. Quantitative Real-Time RT-PCR (qRT-PCR)

To verify these changes, the transcript levels of the following genes were measured by qRT-PCR: CXCL-10, IL-15, ICAM-1, NLRC-5, and IRF-1 (Figure 1). The qRT-PCR results confirmed the substantial and significant changes in expression observed in the microarray analysis. Epithelial cells treated with the uNK cell-secretion medium showed increased expression levels of CXCL-10 (18.4-fold), IL-15 (11.7-fold), ICAM-1 (12.5-fold), NLRC-5 (31.5-fold), and IRF-1 (15.6-fold) (all P < 0.001) compared with the control group.
Figure 1

Transcription levels of (a) CXCL-10, (b) IL-15, (c) ICAM-1, (d) NLRC-5, and (e) IRF-1 determined by qRT-PCR. The relative fold changes are shown in Section 3. The qRT-PCR results were consistent with the microarray analysis. The data are expressed as means ± SEM. a P < 0.001 for the comparison between the uNK and control groups; b P < 0.001 for the comparison between the ZDY and control groups.

We also confirmed that epithelial cells pretreated with ZDY and then treated with the uNK cell-secretion medium exhibited downregulated expression levels of CXCL-10 (0.9-fold; 0.01 < P < 0.05) and NLRC-5 (1.0-fold;0.01 < P < 0.05) and upregulated levels of IL-15 (1.1-fold; 0.01 < P < 0.05), ICAM-1(1.1-fold; P > 0.05), and IRF-1 (1.1-fold; P > 0.05) compared with epithelial cells treated with the uNK cell-secretion medium. However, none of these changes were significant.

3.3. Western Blot

To confirm these effects at the protein level, the amount of ICAM-1 was analyzed by western blot (Figure 2). Epithelial cells treated with the uNK cell-secretion medium showed a 2.1-fold (P < 0.01) increase in the expression of ICAM-1. However, the epithelial cells treated with ZDY and the uNK cell-secretion medium showed a 1.4-fold increase (0.01 < P < 0.05) in the expression of ICAM-1 compared with the epithelial cells treated with the uNK cell-secretion medium. Thus, there was no significant difference between the uNK and ZDY groups.
Figure 2

(a) Expression of endometrial ICAM-1 protein in endometrial epithelial cells. The GAPDH band was used as the internal loading control in each lane. (b) Comparison of the normalized expression intensity of endometrial ICAM-1 protein in the control, uNK, and ZDY groups. The data are expressed as means ± SEM. a P < 0.01 for the comparison between the uNK and control groups; b P < 0.01 for the comparison between the ZDY and control groups.

4. Discussion

Progesterone plays a central role in reproduction and is involved in implantation and pregnancy. When pregnancy occurs, high progesterone levels are critical not only for facilitating implantation but also for maintaining pregnancy by stimulating uterine growth [20, 21]. Several observations suggest that uNK cells also play an important role in reproduction: (a) these cells are hormonally regulated because they increase in number during the luteal phase when implantation occurs [7], (b) these cells are present in early gestation at the time placental cells invade the maternal arteries [22], and (c) these cells are particularly abundant around trophoblast cells [23]. The proliferation of uNK cells is the foundation of their reproductive function. One of the mechanisms underlying the increase in uNK cell numbers is the stimulation of the proliferation of existing uNK cells by progesterone. In mouse uterine tissues, the significant upregulation in the decidual NK population is regulated by progesterone [24]. Because there are no progesterone receptors on uNK cells, it is hypothesized that the paracrine communication between uNK and epithelial cells participates in this process. In this study, we used the uNK cell-secretion medium to stimulate epithelial cells in an attempt to find the interaction and/or paracrine effects between these cells. The data obtained in the present study demonstrate that uNK cells have a significant effect on the gene expression in epithelial cells in the nonpregnant state, and these paracrine effects also have a profound effect on uNK proliferation. The largest group of upregulated genes induced in epithelial cells by the soluble factors derived from uNK cells induced cytokines and immunological factors, including IL-15 and IL-15RA. IL-15 is critical for NK cell differentiation in mice and human lymphoid tissue [25, 26]. IL-15 acts on precursor and immature NK cells. In humans, IL-15 transcription is more abundant during the secretory compared with the proliferative cycle phase, is maintained in early pregnancy, and localizes to the endothelium and decidual spiral arteries [27]. The correlative time strongly suggests that IL-15 participates in uNK cell proliferation and that IL-15 may also contribute to the localization of uNK cells. Our results show that uNK cells exhibit upregulated levels of both IL-15 and IL-15RA. This may activate a powerful proliferation loop because IL-15 is presented by IL-15RA on epithelial cells to promote uNK proliferation. There are temporal and quantitative features associated with the activities of uNK cells and trophoblast cells in uterine spiral artery maturation. There is evidence that IL-15 upregulates the level of VEGF-C mRNA expression, which suggests that uNK cells may play an important role in endometrial angiogenesis and regeneration [28]. In addition, CXCL-10 is involved in uNK cell production, directs the migration and invasion of CXCR1+, CXCR3+, CXCR4+, and CCR3+ trophoblast [12], and promotes angiogenesis in the placental bed [29]. Furthermore, in the absence of uNK cells, spiral artery extension is delayed, and the tunica media remain intact [30], and these studies are consistent with an angiogenic/vascular remodeling role for uNK cells [4, 12, 31]. We found some evidence that uNK cells promote changes in endometrial epithelial cells in the nonpregnant state. The level of VEGF-C, which is upregulated in epithelial cells by the uNK cell-secretion medium, increases markedly during implantation and early pregnancy [32]. Our data suggest that uNK may prime some of the decidualization changes that occur in epithelial cells prior to the onset of full decidualization. The exact function of uNK cells has not yet been unequivocally determined, but it is known that these cells express a different cytokine profile compared with peripheral NK cells. For example, these cells express colony-stimulating factor (CSF), macrophage colony-stimulating factor (M-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor alpha (TNF-α), interferon-γ (IFN-γ), and leukemia inhibitory (LIF) [33, 34]. During human pregnancy, these cells are found in close proximity to the implantation site and in close contact with the infiltrating extravillous trophoblasts. Furthermore, uNK cells increase their numbers in early pregnancy due to hormonal dependence and exhibit close proximity to trophoblasts. Taken together, these data support the conclusion that uNK cells play an important role in the regulation for the maternal immune response for the control of implantation and trophoblast invasion during human pregnancy. The summary of the paracrine effects of uNK cells on the epithelial cells is shown in Figure 3.
Figure 3

Model of the proliferation and function of uNK cells. During implantation and early pregnancy, the uNK paracrine signals stimulate endometrial epithelial cells to produce IL-15, VEGF, and other unidentified factors that may regulate uNK cell proliferation. The immune paracrine communication between uNK and endometrial epithelial cells may support implantation and trophoblast development.

In addition, this study provides the first demonstration of the paracrine communication between uNK and endometrial epithelial cells. Because our previous study showed that ZDY can improve the morphology of the endometrium in mice, we attempted to identify a relationship between the paracrine communication (uNK/epithelial cells) and the mechanism of action of ZDY. However, the majority of the up- and downregulated genes induced in the ZDY pretreated epithelial cells were of unknown function. To the best of our knowledge, there are no published studies on the effects of traditional Chinese medicine on the human endometrial paracrine communication. Our results suggest that ZDY may not regulate this process in vitro. ZDY may improve the morphology of the uterus through another mechanism.

5. Conclusions

Overall, this study provides the first detailed demonstration of the paracrine interaction between immune cells and epithelial cells in the endometrial environment. The findings indicate that these paracrine signals may contribute to uNK cell proliferation during implantation and early pregnancy. In addition, we failed to find evidence indicating that ZDY regulates the paracrine effects between uNK cells and epithelial cells in vitro. Hierarchical Clustering of microarray experiments. SP-ZY represented the ZDY group; SP-uNK represented the uNK group and SP-K represented the control group. Three chips were used for each group. Click here for additional data file.
  30 in total

Review 1.  Withered Yang: a review of traditional Chinese medical treatment of male infertility and erectile dysfunction.

Authors:  A S Crimmel; C S Conner; M Monga
Journal:  J Androl       Date:  2001 Mar-Apr

Review 2.  Progestin regulation of cellular proliferation.

Authors:  C L Clarke; R L Sutherland
Journal:  Endocr Rev       Date:  1990-05       Impact factor: 19.871

3.  Paracrine effects of uterine leucocytes on gene expression of human uterine stromal fibroblasts.

Authors:  Ariane Germeyer; Andrew Mark Sharkey; Mirari Prasadajudio; Robert Sherwin; Ashley Moffett; Karen Bieback; Susanne Clausmeyer; Leanne Masters; Roxana Maria Popovici; Alexandra Petra Hess; Thomas Strowitzki; Michael von Wolff
Journal:  Mol Hum Reprod       Date:  2008-12-16       Impact factor: 4.025

Review 4.  Physiological action of progesterone in target tissues.

Authors:  J D Graham; C L Clarke
Journal:  Endocr Rev       Date:  1997-08       Impact factor: 19.871

5.  Decidual NK cells regulate key developmental processes at the human fetal-maternal interface.

Authors:  Jacob Hanna; Debra Goldman-Wohl; Yaron Hamani; Inbal Avraham; Caryn Greenfield; Shira Natanson-Yaron; Diana Prus; Leonor Cohen-Daniel; Tal I Arnon; Irit Manaster; Roi Gazit; Vladimir Yutkin; Daniel Benharroch; Angel Porgador; Eli Keshet; Simcha Yagel; Ofer Mandelboim
Journal:  Nat Med       Date:  2006-08-06       Impact factor: 53.440

6.  Purified intercellular adhesion molecule-1 (ICAM-1) is a ligand for lymphocyte function-associated antigen 1 (LFA-1).

Authors:  S D Marlin; T A Springer
Journal:  Cell       Date:  1987-12-04       Impact factor: 41.582

7.  IL-15 expression at human endometrium and decidua.

Authors:  K Kitaya; J Yasuda; I Yagi; Y Tada; S Fushiki; H Honjo
Journal:  Biol Reprod       Date:  2000-09       Impact factor: 4.285

8.  Interleukin-10 is produced by human uterine natural killer cells but does not affect their production of interferon-gamma.

Authors:  P Viganò; B Gaffuri; E Somigliana; M Infantino; M Vignali; A M Di Blasio
Journal:  Mol Hum Reprod       Date:  2001-10       Impact factor: 4.025

9.  Embryonic modulation of basic fibroblast growth factor in the rat uterus.

Authors:  D L Carlone; V Rider
Journal:  Biol Reprod       Date:  1993-10       Impact factor: 4.285

10.  ICAM-1 (CD54): a counter-receptor for Mac-1 (CD11b/CD18).

Authors:  M S Diamond; D E Staunton; A R de Fougerolles; S A Stacker; J Garcia-Aguilar; M L Hibbs; T A Springer
Journal:  J Cell Biol       Date:  1990-12       Impact factor: 10.539

View more
  4 in total

Review 1.  Gasotransmitters in pregnancy: from conception to uterine involution.

Authors:  Damian D Guerra; K Joseph Hurt
Journal:  Biol Reprod       Date:  2019-07-01       Impact factor: 4.285

2.  Insights into the paracrine effects of uterine natural killer cells.

Authors:  Xin Gong; Yanxia Liu; Zhenzhen Chen; Cai Xu; Qiudan Lu; Zhe Jin
Journal:  Mol Med Rep       Date:  2014-10-13       Impact factor: 2.952

3.  CXCL10 and IL-6: Markers of two different forms of intra-amniotic inflammation in preterm labor.

Authors:  Roberto Romero; Piya Chaemsaithong; Noppadol Chaiyasit; Nikolina Docheva; Zhong Dong; Chong Jai Kim; Yeon Mee Kim; Jung-Sun Kim; Faisal Qureshi; Suzanne M Jacques; Bo Hyun Yoon; Tinnakorn Chaiworapongsa; Lami Yeo; Sonia S Hassan; Offer Erez; Steven J Korzeniewski
Journal:  Am J Reprod Immunol       Date:  2017-05-19       Impact factor: 3.886

Review 4.  The Enigmatic Role of Serum & Glucocorticoid Inducible Kinase 1 in the Endometrium.

Authors:  Florian Lang; Janet Rajaxavier; Yogesh Singh; Sara Y Brucker; Madhuri S Salker
Journal:  Front Cell Dev Biol       Date:  2020-10-21
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.