Literature DB >> 24734091

The IFN-λ Genetic Polymorphism Association With the Viral Clearance Induced by Hepatitis C Virus Treatment in Pakistani Patients.

Imran Tipu1, Fiona Marriage2, Zia-Ur-Rahman Farooqi3, Hazel Platt4, Muhammad Amin Athar5, Philip John Day2, Andrea Short4.   

Abstract

BACKGROUND: Polymorphisms in the interferon λ (INF λ) genes on chromosome 19 have been associated with clearance of hepatitis C virus (HCV) induced by interferon and ribavirin therapy however there is no such data available for Pakistani patients with HCV infection.
OBJECTIVES: In this study, the effects of single nucleotide polymorphisms (SNPs) have been investigated in response to treatment with interferon-α and ribavirin in a cohort of 75 HCV genotype 3a patients. PATIENTS AND METHODS: A total number of 50 SNPs from the Interferon λ region on chromosome 19 were genotyped to investigate allelic associations with the treatment response in HCV type 3a patients. Thirteen SNPs were associated with HCV clearance, with the most significant alleles being RS8109886 (Fisher's P = 0.0001), RS8113007 (Fisher's P = 0.0001) and RS12979860 (Fisher's P = 0.0002).
RESULTS: These SNPs were found to be the most suitable SNPs for predicting treatment response in the present study. These findings support those reported previously. This could be used to improve HCV treatment strategies and suggest that Pakistani patients should be genotyped for the relevant SNPs to identify the patients who are more likely to respond to interferon and ribavirin therapy.
CONCLUSIONS: This therapy is costly and can be accompanied by several adverse side-effects, hence pre-treatment prediction of patients who are most likely to benefit would have both economic and patient benefits in the long term.

Entities:  

Keywords:  Antiviral Agents; Hepacivirus; Interferons; Polymorphism, Genetic; Polymorphism, Single Nucleotide; Ribavirin

Year:  2014        PMID: 24734091      PMCID: PMC3984471          DOI: 10.5812/hepatmon.15076

Source DB:  PubMed          Journal:  Hepat Mon        ISSN: 1735-143X            Impact factor:   0.660


1. Background

Hepatitis C virus (HCV) infection is one of the leading causes of chronic liver disease and has emerged as a global concern of public health, affecting about 3% of the world’s population. Pakistan is the sixth most populated country in the world and has a HCV prevalence rate of 5.9% (1). While there are different subtypes of HCV, genotype 3a is the most common form in patients from Pakistan, with frequency ranging from 28.6% (2) to 89% (3) depending on the province (4). The clinical outcome of HCV infection is determined by the interplay between viral, environmental and host related factors (5). The host’s immune system is the most important factor in viral persistence and innate immunity is the first line of defense, intervening with interferons and natural killer cells (6). This immune response is influenced by genetic polymorphisms in cytokines, their receptors (7) and the polymorphic genetic makeup of human populations. Genetic variations and T-cell responses are responsible for the outcome of HCV treatment (8). The most common type of genetic variations are single nucleotide polymorphisms (SNPs) which occur approximately every 300 nucleotides in the human genome and can be used as biological markers for diseases or conditions. The majority of SNPs have no effect on health, but if SNPs are located within a gene or regulatory region, they can be functional in disease susceptibility and/or treatment response. Studies have found that infected individuals with same HCV genotype differ in ability to spontaneously resolve infection, even if they have the same ethnic background with similar demographic features and are taking the same IFN-α/ribavirin therapy (9). The host genetics have been identified as key factors in the natural clearance of HCV and host SNPs have been already identified as associated factors in a number of studies in patients from different genetic backgrounds (Table 1). In particular, SNP RS12979860, present 3Kb upstream of the Interleukin 28B gene on chromosome 19, has been associated with a three-fold change in response to treatment against HCV infection in African-American and European cohorts (7). Another SNP from this region of chromosome 19, RS8099917, has been associated with HCV clearance in Australian (10) and Asian populations (11) (Table 1) and is located 8Kb upstream of the IFNL3 gene. In humans, four functional type III IFN λ (IFNL) genes are clustered around this region of chromosome 19encoding cytokines IL29 (IFNL1) , IL28A (IFNL2), IL28B (IFNL3) (12) and IFNL4 (13) and have a number of roles in controlling HCV infection including increasing the antiviral efficacy as a result of increased sub-saturating levels of IFN-α (14). IFN-λ binds to the heterodimeric receptors IFN-λR1 and IL10R2 forming interferon stimulated genes (ISGs) complex and initiating a signal transduction cascade (15) leading to up-regulation of several ISGs with antiviral effects (16). The IFN-λ receptors are present on the plasmacytoid dendritic cells, peripheral B cells, hepatocytes and epithelial cells only so they can be used to target specific cell responses and can also help in avoiding adverse events of INF-α therapy (17). The role of SNPs present in the IFNL3 and IFNL4 genes in the spontaneous clearance of HCV was investigated, in addition to the associative role of SNPs present in the up-and down-stream regions of genes encoding IFN-λ. This data could be of value for predicting the response to interferon and ribavirin therapy in Pakistani patients and though would be of economic and patient benefit in the long term.
Table 1.

Previous Studies Which Have Reported SNP Allelic Associations

AuthorRegionHCV genotypeRS12979860RS8099917RS12980275 RS4803219RS8103142RS8105790RS10853728RS7248668RS4823221RS28416813RS4803217RS11881222
Ge et al. (7) USA1
Suppiah et al. (10) Australia
Tanaka et al. (11) Japan1
Rauch et al. (18) Switzerland1, 4
Abe et al. (19) Japan
Mangia et al. (20) Italy2, 3
McCarthy et al. (21) USA
Thompson et al. (22) USA
Bochud et al. (23) Switzerland
Smith et al. (24) Europe
Yu.M.Lin et al. (25) Taiwan
Chen et al. (26) Taiwan
Scherzer et al. (27) Austria
Ridruejo et al. (28) Argentine1
Yu et al. (25) Taiwan2
Jun-qiang et al. (29) China
Pedergnana et al. (30) Egypt4
Shi et al. (31) China
de Castellarnau et al. (32) Spain
Grandi et al. (33) Brazil1
Prokunina-Olsson et al. (13) USA
Stenkvist et al. (34) Sweden
Gelinas et al. (35) France
Ezzikouri et al. (36) Morocco
Jung et al. (37) Korea

2. Objectives

In this study, the effects of SNPs have been investigated in response to treatment with interferon-α and ribavirin in a cohort of 75 patients with genotype 3a HCV.

3. Patients and Methods

3.1. Selection and Description of Participants

Following ethical approval from the Institutional Review Board (University of Punjab, Pakistan) written informed consent for genetic testing including IFN-λ SNPs was obtained from each patient participating in the study. Patients were recruited from different areas of Punjab who visited National Genetics Laboratory, Lahore during March 2010 to May 2011. Patients displaying HCV like symptoms of infection (n = 150) were screened for HCV RNA using an in-house PCR detection technique, of the 150 patients screened, 100 were positive for HCV RNA and 75 were classified as genotype 3a. Each patient was interviewed and a structured questionnaire was completed to figure out the demographic data.

3.2. Technical Information

3.2.1. HCV Detection

HCV viral RNA was extracted from the patient’s serum using a QIAamp viral RNA extraction kit (Qiagen). The HCV RNA was detected in 100 individuals using sequence specific primers designed to target the highly conserved 5’ UTR sequence in HCV (Table 2). The viral genotype was detected by nested PCR using unique antisense primers which amplify the 5’ conserved sequence of HCV within the genotype and their poor homology with the sequence derived from other genotypes (Appendix 1). Only 75 patients identified with the HCV genotype 3a were selected for further study, this comprised 75% of the patients screened and thus the study avoided the effect of HCV genotypes on therapy response.
Table 2.

Significantly Associated SNPs (P < 0.05) With Sustained Virological Response to Interferon and Ribavirin Therapy [a]

SNPsMAFResponder MAF (n = 47)Non-Responder MAF (n = 28)OR (95% CI)P Value
RS8109886 0.410.320.443.6 (1.9-6.5)0.0001
RS8113007 0.250.190.333.6 (1.9-6.5)0.0001
RS12979860 0.30.230.413.1 (1.7-5.3)0.0002
RS11665818 0.380.290.52.9 (1.6-5.3)0.0003
RS955155 0.330.260.382.9 (1.6-5.1)0.0004
RS688187 0.310.270.382.7( 1.5-4.7)0.0011
RS4803217 0.30.250.382.7 (1.5-4.7)0.0011
RS8105790 0.190.160.252.6 (1.4-4.6)0.0022
RS4803221 0.220.160.272.6 (1.4-4.6)0.0022
RS8099917 0.190.160.252.6 (1.4-4.6)0.0022
RS7248668 0.190.160.252.6(1.4-4.6)0.0022
RS12972991 0.220.170.32.5(1.4-4.5)0.0024
RS11671087 0.410.320.52.2 (1.2-3.9)0.0130

a Abbreviations: CI, confidence interval; MAF, minor allele frequency; OR: odds ratio.

Appendix 1.

The Details of Single Nucleotide Polymorphisms (SNPs) Present in the up- and Down- Stream Region of IFNL-λ Genes. The Annotation of SNPs According to Their Position is Listed With Their Hardy-Weinberg Equilibrium P Values (HW p)

SNP RS No.SNP PositionRole of SNPAllelesHW p
RS11083519 chr19:39719263IFNL3 DownstreamA:T0.820
RS955155 chr19:39729479IFNL3 DownstreamC:T0.304
RS35790907 chr19:39730755IFNL3 DownstreamA:T0.551
RS12972991 chr19:39731747IFNL3 DownstreamA:C0.831
RS12980275 chr19:39731783IFNL3 DownstreamA:G0.551
RS12982533 chr19:39731904IFNL3 DownstreamT:C0.551
RS8105790 chr19:39732501IFNL3 DownstreamT:C0.906
RS688187 chr19:39732752IFNL3 DownstreamG:A0.394
RS4803217 chr19:39734220IFNL4 ExonC:A0.919
RS12979860 chr19:39738787IFNL4 IntronC:T0.173
RS4803221 chr19:39739129IFNL3 PromoterC:G1.000
RS1549928 chr19:39739709IFNL3 PromoterA:G0.625
RS10853727 chr19:39740463IFNL3 PromoterT:C0.118
RS8109886 chr19:39742762IFNL3 PromoterC:A0.339
RS8113007 chr19:39743103IFNL3 PromoterA:T0.225
RS8099917 chr19:39743165IFNL3 PromoterT:G0.906
RS7248668 chr19:39743821IFNL3 PromoterG:A0.906
RS16973285 chr19:39744696IFNL3 PromoterC:T0.081
RS10853728 chr19:39745146IFNL3 PromoterG:C0.387
RS12980602 chr19:39752820IFNL2 PromoterT:C0.041
RS4803224 chr19:39753014IFNL2 PromoterG:C0.976
RS11671087 chr19:39761790IFNL2 DownstreamT:C0.122
RS11665818 chr19:39768216IFNL2 DownstreamG:A0.039
RS7248931 chr19:39781583IFNL1 PromoterA:G0.812
a Abbreviations: CI, confidence interval; MAF, minor allele frequency; OR: odds ratio.

3.2.2. Treatment

All patients received three million IU of IFN-α three times a week subcutaneously and ribavirin (10 mg/day/kg body weight) for a total period of six months. Doses of IFN-α were adjusted according to platelet and white blood cell counts of patients. Ribavirin dose varied according to the haemoglobin (Hb) levels and weight of individual patients. The therapy response was monitored by alanine aminotransferase (ALT) and HCV RNA levels at the beginning and end of treatment. The HCV RNA quantification was performed by the Artus HCV RT-PCR (Qiagen) kit using a Rotor-Gene 3000 (Corbett Robotics, Australia) instrument.

3.2.3. DNA Extraction

Human genomic DNA was extracted from peripheral blood mononuclear cells using a QIAamp blood DNA mini kit (Qiagen). DNA was quantified using a Nanodrop-ND1000 spectrophotometer (lab technologies) and concentrations were normalized to 15 ng/µL.

3.2.4. SNP Selection and Genotyping

In total, 50 SNPs were genotyped. Twenty five were from the coding region of the IL28B gene, 23 SNPs covered the 3’ and 5’ UTR’s of all four IFN-λ genes and the remaining two SNPs were from the newly discovered IFNL-4 gene. The details of SNPs are given in supplementary data (Appendix 2 and 3). Genotyping was performed using the iPLEX assay on a SEQUENOM MassARRAY® platform. The primers were designed using the assay designing suite v1.0.1 (SEQUENOM) (Appendix 4). An initial PCR amplified a 50-60 bp region flanking the polymorphic site. The product was treated with 1 U/µL of shrimp alkaline phosphatase at 37˚C for 40 minutes to dephosphorylate any unincorporated dNTPs. The iPLEX reaction product was desalted using a cationic resin, pre-treated with acidic reagents, for optimizing mass spectrophotometric analysis. The desalted iPLEX product was spotted on the SpectroCHIP using a Nano spotter (Sequenom) and loaded on to the mass spectrometer. Each spot was then subjected to a laser under vacuum by the matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) method. Assays were designed to SNPs on chromosome 19q13.13 covering the region encoding the IFN-λ genes. After genotyping, SNPs and samples were quality checked.
Appendix 2

. The Details of SNPs Located in IL28B Gene (IFNL-3) Listed According to Amino Acid Position. The Amino Acid Present in Normal (amino acid: context) and Change of Amino Acid Due to Allele Change (amino acid: SNP) Are Listed Accordingly

SNP rs No.Amino Acid Position.SNP PositionAmino Acid: ContextAmino Acid: SNPAllele Change
RS200289435 1chr19:39735606MethionineThreonineATG→ACG
RS143935261 1chr19:39735607MethionineValineATG→GTG
RS202126177 2chr19:39735603ThreonineSerineACC→ATC
RS630388 2chr19:39735602ThreonineThreonineACC→ACT
RS150569967 3chr19:39735601GlycineArginineGGG→AGG
RS199952257 57chr19:39735438LysineArginineAAA→AGA
RS202143862 72chr19:39735101ArginineCysteineCGC→TGC
RS145428712 101chr19:39734754ThreonineMethionineACG→ATG
RS200889156 104chr19:39734744ValineValineGTT→GTC
RS148543092 108chr19:39734734ThreonineAlanineACC→GCC
RS202101632 108chr19:39734732ThreonineThreonineACC→ACT
RS201376760 114chr19:39734716AlanineThreonineGCC→ACC
RS199801376 116chr19:39734708GlycineGlycineGGG→GGA
RS200058568 123chr19:39734687LeucineLeucineCTT→CTC
RS201605224 126chr19:39734678LeucineLeucineCTG→CTT
RS199655870 132 chr19:39734662 Glutamine Stop Codon CAG→TAG
RS149832972 133chr19:39734659LeucinePhenylalanineCTC→TTC
RS139176035 134chr19:39734656ArginineTryptophanCGG→TGG
RS201566097 138 chr19:39734544 Glutamine Stop Codon CAG→TAG
RS145946971 164chr19:39734465LysineThreonineAAG→ACG
RS143748522 179chr19:39734328PhenylalanineValineTTC→GTC
RS150748693 180chr19:39734325ArginineCysteineCGC→TGC
RS201746548 183chr19:39734314ThreonineThreonineACG→ACA
RS200180353 191chr19:39734290SerineSerineAGC→AGT
RS201888594 194chr19:39734282LeucineProlineCTG→CCG
Appendix 3.

The Primers Used for Detection and Genotyping of HCV. (HCF1: HCV Outer Forward Primer, HCR1: HCV Outer Reverse Primer, HCF2: HCV Internal Forward Primer, HCR2: HCV Internal Reverse Primer, HCGF1: HCV Genotype Outer Forward Primer, HCGR1: HCV Outer Reverse Primer, HCGF2: HCV Internal Forward Primer, Rest All Are Specific for Every HCV Genotype With Their Amplified Product Size Using Same Internal Primer

Primer Name5’-3’ SequenceProduct Size (bp)
HCF1 CCCTGTGAGGAACTACTGTCTTCACGC270
HCR1 ACTCGCAAGCACCCTATCAGGCAGTAC
HCF2 AAAGCGTCTAGCCATGGCG210
HCR2 CACAAGGCCTTTCGCGACC
HCGF1 TTGTGGTACTGCCTGATAGGG470
HCGR1 GGATGTACCCCATGAGGATCG
HCGF2 GTGCCCCGGGAGGTCTCGTAG
G1a ACTCCACCAACGATCTGACC129
G1b AGCCTTGGGGATAGGTTGTC233
G1c CTTACCCAAATTGCGTGACC391
G2a CTCCGAAGTCTTCCTTGTCG190
G2b AGCAAGTAAACTCCGCCAAC178
G2c ACCGTTCGGAAGTTTTCCTC202
G3a ACTCCACCAACGATCTGTCC258
G3b AGCCTTGGGGATAAGGTGAC232
G3c GTGACCGCTCGGAAGTCTTA197
G4a CCGTAAAGAGGCCATGGATA288
G5a AATCCGCACGTTAGGGTATG417
G6a CAGCCTTCGCTTCCATAAAG300
Appendix 4.

The Primers and Probes Used During the iPLEX Assay on SEQUENOM are Given in Detail With Each SNP Corresponding to the Sequence of Forward and Reverse Primer With the Mass (Daltons) of PCR Product After First PCR. The Extended Product and Mass Represents the Change of Mass With the Different Incorporation of Base and Thus Explaining the Principal Behind the iPLEX Assay. (PCR Mass: Mass of Initial PCR Product. Ext.1 and 2 Products: The Extended Base Which is Complementary to one Present in Initial PCR Product. Ext.1 and 2 Mass: The Masses of Final Products)

SNP IDForward PrimerReverse PrimerPCR Mass ProbeExt. 1 ProductExt.1 MassExt.2 ProductExt.2 Mass
RS12979860 ACGTTGGATGTCGTGCCTGTCGTGTACTGAACGTTGGATGAGCGCGGAGTGCAATTCAAC4563AGCTCCCCGAAGGCGC4810.2T4890.1
RS143748522 ACGTTGGATGTCCTCCCTACAGGAGTCCCACGTTGGATGCAACACAATTCAGGTCTCGC4752.1TGTCACCTTCAACCTCC5039.3A5079.2
RS201566097 ACGTTGGATGTGAGCAGCGTCCTTCCCCTGACGTTGGATGGTCCTGGGCCCTGCCGTG5115.3GACTCTGCCCACAGATCG5362.5A5442.4
RS148543092 ACGTTGGATGTGGTCCAAGACATCCCCCAGACGTTGGATGCCTGACGCTGAAGGTTCTG5242.4CTGGTCAGTGTCAGCGGC5489.6T5569.5
RS11881222 ACGTTGGATGCACACCTGCTACCCCTTCCACGTTGGATGGGAACAAGTGAAGGTGACAG5282.4ACCCCTTCCCTCTGCTCCG5529.6A5609.5
RS8105790 ACGTTGGATGCTTCCTGACATCACTCCAATACGTTGGATGGTCAGCATCATTAGCGGAAG5394.5CATCACTCCAATGTCCTGC5641.7T5721.6
RS202126177 ACGTTGGATGGCTCCCTTTCTCTCTGTGACACGTTGGATGACAGGAACTGCTCCAGTCAC5796.8CTCTGTGACACAGACATGAG6044C6084
RS150748693 ACGTTGGATGAGGCCTCTGTCACCTTCAACACGTTGGATGTTGCATGACTGGCGGAAGG5938.9CTGTCACCTTCAACCTCTTCG6186.1A6266
RS11665818 ACGTTGGATGAAGAAAGACCTCCACCATGCACGTTGGATGAGTCACCCCTATTTCCTAGC5947.9TTATCATCTGCCCCCAACTCA6219.1G6235.1
RS4803221 ACGTTGGATGTCCTGTGCACGGTGATCGCACGTTGGATGTCCCTCAGCGCCTTGGCAG6319.1CCCAAGGCGCTGCCTGCTCTCG6566.3C6606.3
RS199801376 ACGTTGGATGATATGGTGCAGGGTGTGAAGACGTTGGATGCCTGACGCTGAAGGTTCTG6456.2ACGGGGCTGGTCCAAGACATCC6703.4T6783.3
RS12980602 ACGTTGGATGTACTTTATTAAGTGGTAAACACGTTGGATGCTCTGGTTTTTGTTCATCTG6505.3GAACAATATGAAAGCCAGAGAC6752.5T6832.4
RS1549928 ACGTTGGATGTGCCCTCCAACACTCGGTTTACGTTGGATGCGAAGATAAAGACAACCAGG6643.3GCCTAATTGTCTCTGTCCCTGTG6890.5A6970.4
RS688187 ACGTTGGATGTCTAGCACGAATCCATTACACGTTGGATGCTTTTGGTAACAGTCACAAG6651.4GCACATGCAGCAACACACCACAA6922.6G6938.6
RS12980275 ACGTTGGATGTTCCTATTAACCCCTCCCGCACGTTGGATGATGAGGTGCTGAGAGAAGTC7016.6ACCGGCAAATATTTAGACACGTCG7263.8A7343.7
RS11671087 ACGTTGGATGAAGCTCCTTTGCCGAGTAACACGTTGGATGGAAGATGCCACCCCAAAGTC7056.6CCTGTGCCGAGTAACATAAGATAC7303.8T7383.7
RS139176035 ACGTTGGATGTTCACACCCTGCACCATATCACGTTGGATGTGCTCAGAGCTCACAGACCT7168.7CTGAACCATATCCTCTCCCAGCTCG7415.9A7495.8
RS4803217 ACGTTGGATGATAAATAGCGACTGGGTGACACGTTGGATGCCAGTCATGCAACCTGAGAT7449.9GCGACTGGGTGACAATAAATTAAGC7697.1A7721.1
RS7248668 ACGTTGGATGGAGTGGCGATTGTGCCACTAACGTTGGATGCTTTTGCAGAGCAGAGGTTG7552.9CCCAGATTGTGCCACTACTATGCTCG7800.1A7880
RS16973285 ACGTTGGATGTGCACGTTTCATTTGTTTAACGTTGGATGCCCCACCCATCTTAAGCATC7593.9CACGTTTCATTTGTTTATTGATTTCC7841.1T7921
RS12982533 ACGTTGGATGAAGAGAGTTCTGGAGATTGCACGTTGGATGTTACAGGTCTGGTCCTAGTG7762GGGTGAGATTGCTTGCCGAACAATGC8009.2T8089.1
RS8113007 ACGTTGGATGACAAAAGGAGGAACAGTGACACGTTGGATGGGAGAGTTAAAGTAAGTCTTG7960.2TGACAAATTGTTAAAAAATATTTACCT8231.4A8287.3
RS201605224 ACGTTGGATGATGTCTTGGACCAGCCCCTTACGTTGGATGGGCCCTGACGACTCACACA8132.3TGTCGTGGACCAGCCCCTTCACACCCTC8419.5A8459.4
RS7248931 ACGTTGGATGCTCATCATCTCAAGAACTAGGACGTTGGATGGTTGGCATCTATTGATTGGC8333.5GATATCAAGAACTAGGAAAATCTCAAGG8580.7A8660.6
RS200058568 ACGTTGGATGCTGACACTGACCCAGCCCTACGTTGGATGGGCCCTGACGACTCACACA4488.9CTTGGACCAGCCCCTG4736.1A4816
RS202101632 ACGTTGGATGCCTGACGCTGAAGGTTCTGACGTTGGATGTGGTCCAAGACATCCCCCAG4609GGTTCTGGAGGCCACG4856.2A4936.1
RS145946971 ACGTTGGATGCCGCCTCCACCATTGGCTGACGTTGGATGAGACCTCAGTCCCTCTCTTC4893.2CAGGAGGCCCCAAAAAG5140.4T5164.4
RS202143862 ACGTTGGATGTCTCACCTGCAGCTGCCTCAACGTTGGATGCCTTTGCTGTCTAGGAAGAG5036.3TGGAAGAGGCGGGAGCA5307.5G5323.5
RS201376760 ACGTTGGATGCCTGACGCTGAAGGTTCTGACGTTGGATGAAGGGGCTGGTCCAAGACAT5100.3CCGCTGACACTGACCCAT5371.5C5387.5
RS630388 ACGTTGGATGGCTCCCTTTCTCTCTGTGACACGTTGGATGACAGGAACTGCTCCAGTCAC5203.4TGTGACACAGACATGACG5450.6A5530.5
RS955155 ACGTTGGATGAACTATGGGCCAACACTGTCACGTTGGATGACTGGTATGTCAGCTCCTCG5211.4TGTGCACTGAGGGCCCAT5482.6C5498.6
RS10853728 ACGTTGGATGAGACAGACTCTCATCCTCACACGTTGGATGTCCATTTCCATTCTGTCTCG5676.7CCATCCTCACCAAAGCTTAG5923.9C5963.9
RS201746548 ACGTTGGATGAGGTTGCATGACTGGCGGAAACGTTGGATGCCTCTGTCACCTTCAACCTC5756.8CAACACAATTCAGGTCTCGC6004T6083.9
RS199952257 ACGTTGGATGATGGTGACCCTTGGAGTGCACGTTGGATGAGGAGCTGCAGGCCTTTAAG5787.8TGGACTCACTAAGGCATCTC6035T6114.9
RS35790907 ACGTTGGATGACATGTCTGAGAGCCGAATCACGTTGGATGTCTTCTGCCAGGTTAGAAGC5885.9GCTGTACAGGTGAGAACAAA6157.1T6212.9
RS200180353 ACGTTGGATGTCTCAGGTTGCATGACTGGCACGTTGGATGCTCACGCGAGACCTGAATTG6336.1CTTGCAGACACACAGGTCCCCA6607.3G6623.3
RS8099917 ACGTTGGATGCAATTTGTCACTGTTCCTCCACGTTGGATGACTGTATACAGCATGGTTCC6368.1TTTTTCCTTTCTGTGAGCAATG6655.4T6695.2
RS11083519 ACGTTGGATGCAAAGCCAACTCAATTGAGGACGTTGGATGTTGTGATCCACTTTTCTGCC6460.2TTGAGGAAGAATAGCCTTTTCA6731.4T6787.3
RS10853727 ACGTTGGATGACGCTCACCATTTGCTGAACACGTTGGATGATGTAAGCATGCGCAGAGAG6825.5GAAGACATCATATGAAGAGGCAC7072.7T7152.6
RS4803224 ACGTTGGATGTAGTCCCTAAGCAGCTGGAGACGTTGGATGAACAGAGTGAGACCCCCATC6994.5GCTTGAGCTGCAGGCACCCACCAG7241.7C7281.8
RS200889156 ACGTTGGATGCCGTGGCTTTGGAGGCTGAACGTTGGATGTGGTCCAAGACATCCCCCAG4593CCTGACGCTGAAGGTG4840.2A4920.1
RS8109886 ACGTTGGATGTTCCTGTCTCTGTCTCTGGCACGTTGGATGTTGATTGAGACAGACAGAGC4810.2TCCAACAAGCATCCTGC5057.3A5081.4
RS200289435 ACGTTGGATGGCTCCCTTTCTCTCTGTGACACGTTGGATGACAGGAACTGCTCCAGTCAC5154.4TCTCTGTGACACAGACAG5401.6A5481.5
RS201888594 ACGTTGGATGATCTCAGGTTGCATGACTGGACGTTGGATGGCGAGACCTGAATTGTGTTG5253.4GGAAGGGTCAGACACACA5524.6G5540.6
RS199655870 ACGTTGGATGATGTCTTGGACCAGCCCCTTACGTTGGATGGGCCCTGACGACTCACACA5355.5CGGCACCATATCCTCTCCG5602.7T5626.7
RS12972991 ACGTTGGATGGGAATTTGACTTCTCTCAGCACGTTGGATGCAGTGAAATAAGCCAGTCTC5435.5GGCTCTCAGCACCTCATGC5722.7A5762.6
RS149832972 ACGTTGGATGGGCCCTGACGACTCACACAACGTTGGATGATGTCTTGGACCAGCCCCTT4547TCACACAGGCCCGGAA4818.2G4834.2
RS143935261 ACGTTGGATGGCTCCCTTTCTCTCTGTGACACGTTGGATGACAGGAACTGCTCCAGTCAC5130.4CTCTCTGTGACACAGACT5401.6C5417.6
RS145428712 ACGTTGGATGAAGGGGCTGGTCCAAGACATACGTTGGATGCCGTGGCTTTGGAGGCTGA4786.1CTCCAGAACCTTCAGCA5057.3G5073.3
RS150569967 ACGTTGGATGTTTCTCTCTGTGACACAGACACGTTGGATGACAGGAACTGCTCCAGTCAC4859.2TGACACAGACATGACCT5130.4C5146.4

3.2.5. SNP Quality Controlled

SNPs were excluded from the analyses if the call rate < 90%, Minor Allele Frequencies < 0.05 and the cohort (responders + non-responders) was not in Hardy-Weinberg equilibrium (HWE, P < 0.05). Samples were excluded if the call rate was less than 90%. Call rate, Hardy-Weinberg equilibrium, minor allele frequencies, allelic and haplotypic associations and linkage disequilibrium (LD) were performed using BC|GENE version 3.5-087 software (Biocomputing Platforms, Sweden) whilst Microsoft Excel was used for the determination of means and averages.

3.3. Statistics

3.3.1. Association Analyses

Association of the genetic variants and spontaneous HCV clearance, was determined using logistic regression. The major alleles (as RS12979860 C) were compared with minor alleles (rs12979860 T) in statistical analyses to determine odds ratios (OR) and 95% confidence intervals (CI 95%).

3.3.2. Linkage Disequilibrium and Haplotypic Analysis

Linkage disequilibrium between marker loci was assessed and haplotypic blocks were constructed using BC|GENE version 3.5-087 software (Biocomputing platforms, Sweden) and Haploview 4.2 (http://www.broadinstitute.org/haploview/haploview).

3.3.3. Treatment Response

The effectiveness of IFN-λ loci SNPs was estimated for predicting the treatment response by comparing the sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) for minor allele homozygotes. The most clinically useful parameter to investigate the treatment failure is PPV.

4. Results

4.1. Demographics

Out of 75 patients with genotype 3a HCV enrolled into the study, 46 were male and 29 were female. The virological response was monitored by quantification of HCV RNA at the beginning and at the end of the six months period of the therapy revealing that 63% of subjects (47) showed Sustained Virological Response (SVR) and 37% (28) patients were HCV RNA positive at the end of therapy. It also emerged that 75% of the patients were infected with HCV genotype 3a. These results were consistent with a recent review (4) showing the predominance of genotype 3a in the Pakistani population. The base line demographic, virological and clinical features of patients are shown in Table 3.
Table 3.

Demographic and Clinical Characteristics of the Responders and Non-responders to Interferon and Ribavirin Therapy Against HCV Infection [a]

RespondersRangeNon ResponderRange
Number of Patients, No. (%) 47 (63)28 (37)
Average Age, y 43(21-60)48(28-63)
Gender
Male3016
Female1712
Laboratory parameters
Hb, g/dL12.7(8.2-16.4)12.8(7.1-17.1)
WBC, 10×9/L5.64(2.8-11)5.84(3.3-9.4)
PLT, 10×9/L232(93-402)165(67-287)
ALT, IU/L63(15-224)93(38-235)
HCV-RNA, KIU/mL, Initial1200(125-9900)1034(146-5000)
HCV-RNA, KIU/mL, End of treatment below thresholdbelow threshold2647(120-9800)

a Abbreviations: ALT, alanine transaminase; Hb, Haemoglobin; PLT: platelets; WBC: white blood cells.

a Abbreviations: ALT, alanine transaminase; Hb, Haemoglobin; PLT: platelets; WBC: white blood cells.

4.2. Sample and SNP Quality Control

We analyzed the region of ~ 62.4 kb (Chr 19, nucleotide positions, 39719200-39781600; build GRCh37.p10) containing 50 SNPs (Tables 2 and 4) present in the IFN-λ loci. Out of 50 SNPs, one failed the quality control (QC) criteria and was excluded from the analyses (SNP RS11881222 call rate = 80%); all other samples satisfied the inclusion criteria (> 90% call rate, HWE > 0.05). Twenty four SNPs present in the coding region of the IL28B gene were monomorphic in the studied Pakistani population and were therefore excluded from allelic association and haplotype analysis.
Table 4.

Haplotypes With Odds Ratios [a], [b]

HaplotypeFrequency, %Responders, %Non-responders, %OR (95% CI)P Value
AAATTGCCCATCATG 58.366.044.72.37 (1.34-4.20)0.0028
TCGCCAATGATATGA 14.012.817.90.68 (0.31-1.48)0.3286
AAATTGCCCATAATA 9.607.4014.00.46 (0.18-1.2)0.106
TCGCTAATCGCATTG 8.004.2012.50.28 (0.09-0.89)0.022
TAGCCAATGGTATGA 5.303.207.100.41 (0.10-1.64)0.194
AAATTGCTCATAATA 2.003.201.901.52 (0.25-9.27)0.650

a The odds ratio has been calculated as carrying of haplotype vs. not carrying the haplotype.

b The frequency of six haplotypes in responders and non-responders for a haplotype block covering 13 Kb IFN-λ. The SNP order is RS35790907, RS12972991, RS12980275, RS12982533, RS8105790, RS688187, RS4803217, RS12979860, RS4803221, RS1549928, RS10853727, RS8109886, RS8113007, RS8099917 and RS7248668.

a The odds ratio has been calculated as carrying of haplotype vs. not carrying the haplotype. b The frequency of six haplotypes in responders and non-responders for a haplotype block covering 13 Kb IFN-λ. The SNP order is RS35790907, RS12972991, RS12980275, RS12982533, RS8105790, RS688187, RS4803217, RS12979860, RS4803221, RS1549928, RS10853727, RS8109886, RS8113007, RS8099917 and RS7248668.

4.3. Allelic Association

The allelic association revealed that a region of ~ 39 Kb (Chr 19, nucleotide positions, 39729450-39768250; build GRCh37.p10) containing 13 polymorphic SNPs in Pakistani population is strongly associated (Fisher’s P value = 0.0003-0.0130) with spontaneous clearance and for all of these SNPs, spontaneous HCV clearance was more common with the major alleles. The most significant results were obtained with RS8109886 (Odds ratio of presenting HCV clearance [OR] for C vs. A = 3.6 [95% CI: 1.9-6.5] Fisher’s P = 0.0001), RS8113007 (A vs. T OR = 3.6 [1.9-6.5]; Fisher’s P = 0.0001) and RS12979860 (C vs. T OR = 3.1 [1.7-5.3]; Fisher’s P = 0.0002). Among individuals, taking RS12979860 as an example, the proportion of HCV clearance was much higher in samples with major allele (80% SVR) as compared to minor T allele (34% SVR). The association analysis of response to treatment by IFN-λ SNPs is described in Table 2.

4.4. Linkage Disequilibrium

Estimation of linkage disequilibrium was performed between 23 polymorphic IFN-λ region SNPs, which revealed three haplotypic blocks: haplotype block I, of eight Kb, included eight SNPs (RS35790907, RS12972991, RS12980275, RS12982533, RS8105790, RS688187, RS4803217 and RS12979860) in strong linkage disequilibrium (r2 ≥ 0.85) haplotype block II, of 4Kb included seven SNPs (RS4803221, RS1549928, RS10853727, RS109886, RS8113007, RS8099917, RS7248668) in strong linkage disequilibrium (r2 ≥ 0.95) and block III contained just two SNPs (RS1671087 and RS11665818) lying approximately 6 kb apart from each other and in strong linkage disequilibrium (r2 ≥ 0.85%)(Figure 1).
Figure 1.

Analysis of Pairwise Linkage Disequilibrium (LD) Plot of IFN-λ Region

The linkage disequilibrium between the 17 SNPs in three LD blocks is shown. The red coloured squares represent r2 = 1.0 and blue coloured squares represent r2 ≤ 0.01.

Analysis of Pairwise Linkage Disequilibrium (LD) Plot of IFN-λ Region

The linkage disequilibrium between the 17 SNPs in three LD blocks is shown. The red coloured squares represent r2 = 1.0 and blue coloured squares represent r2 ≤ 0.01.

4.5. Haplotype Analysis

A total number of 6 haplotypes were investigated comprising of 15 SNPs using the Haploview (MIT/Harvard/Brod Institute), among which haplotype one (AAATTGCCCATCATG) comprising of major alleles of 14 SNPs (RS35790907, RS12972991, RS12980275, RS12982533, RS8105790, RS688187, RS4803217, RS12979860, RS4803221, RS1549928, RS10853727, RS8109886, RS8113007, RS8099917 and RS7248668) had most significant association (OR = 2.37, 95% CI = 1.34-4.20, P = 2.8x10-3) with therapy response in comparison with other detected haplotypes. The minor allele frequencies of each haplotype in responders and non-responders to the therapy with their odd ratios are shown in Table 1.

4.6. Treatment Response

The three highly associated SNPs with the treatment response; RS8109886 (PPV of 89%, 95 % CI = 81.17-94.37), RS8113007 (PPV of 74%, 95 % CI = 64.27-82.26) and RS12979860 (PPV of 74%, 95 % CI = 64.27-82.26) are also best indicators for predicting the treatment response. The sensitivity, specificity, prevalence, NPV and PPV of the IFN-λ loci SNPs has been shown in Supplementary Appendix 5.
Appendix 5.

Prediction of Response to Therapy With Homozygous Responder IFN-λ Region SNPs [a]

SNPSensitivity, % (95% CI)Specificity, % (95%CI)Prevalence, % (95%CI)PPV, % (95%CI)NPV, % (95%CI)
RS955155 51.39 (42.92-59.79)53.57 (39.75-67.01)72.00 (65.23-78.10)74.00 (64.27-82.26)30.00 (21.24-39.98)
RS12972991 59.35 (50.12-68.11)64.94 (53.21-75.46)61.50 (54.38-68.28)73.00 (63.20-81.39)50.00 (39.83-60.17)
RS8105790 57.14 (48.28-65.68)64.18 (51.53-75.53)66.50 (59.50-73.00)76.00 (66.43-83.97)43.00 (33.14-53.29)
RS688187 52.48 (43.91-60.95)55.93 (42.40-68.84)70.50 (63.66-76.72)74.00 (64.27-82.26)33.00 (23.92-82.26)
RS4803217 52.48 (43.91-60.95)55.93 (42.40-68.84)70.50 (63.66-76.72)74.00 (64.27-82.26)33.00 (23.92-82.26)
RS12979860 56.92 (47.95-65.57)62.86 (50.48-74.11)65 (57.95-71.59)74.00 (64.27-82.26)44.00 (34.08-54.28)
RS4803221 51.23 (42.80-60.04)53.23 (40.12- 66.01)69.00 (62.09-75.33)71.00 (61.07-79.64)33.00 (23.92-43.12)
RS8109886 60.09 (52.55-68.92)79.63 (66.47-89.35)73.00 (66.28-79.02)89.00 (81.17-94.37)43.00 (33.14-53.29)
RS8113007 52.48 (43.91-60.95)55.93 (42.40-68.84)70.05 (63.66-76.72)74.00 (64.27-82.26)33.00 (23.92-43.12)
RS8099917 42.01 (34.47-49.83)6.45 (0.98-21.26)84.50 (78.73-89.22)71.00 (61.07-79.64)2.00 (0.30-7.05)
RS7248668 42.01 (34.47-49.83)6.45 (0.98-21.26)84.50 (78.73-89.22)71.00 (61.07-79.64)2.00 (0.30-7.05)
RS11671087 59.35 (50.12-68.11)64.94 (53.21-75.46)61.50 (54.38-68.28)73.00 (63.20-81.39)50.00 (39.20-81.39)
RS11665818 62.30 (53.07-70.91)69.23 (57.76-79.19)61.00 (53.87-67.80)76.00 (66.43-83.97)54.00 (43.74-64.01)

a Abbreviations: 95% CI, 95% confidence interval; PPV, Positive predictive value; NPV, Negative predictive value

5. Discussion

The treatment of patients with HCV is based on clinical, demographic and virological characteristics of the disease, which are helpful from a population perspective but these baseline parameters are not suitable for predicting the treatment response in HCV patients infected with the most common genotype, 3a. Two SNPs have been most frequently associated with viral clearance across all HCV genotypes in different populations of the world: RS8099917 and RS12979860 (Table 1) and efforts have been largely directed at determining which of them is most likely to be more suitable for establishing the most useful diagnostic test for predicting treatment. Genotype 3a is the most common genotype of HCV infections in Pakistan (4, 38). In a new cohort of 75 type 3a Pakistani patients SNPs in the up-and down-stream regions of IFN-λ and SNPs from IFNL3 and IFNL4 with known association to HCV clearance in other patient populations, were genotyped (Table 1). The allelic associations of four SNPs that have been reported previously in a number of populations were confirmed here (RS8105790, RS12979860, RS8099917 and RS7248668, Table 1) and a novel associations in Pakistani patients was identified (Table 2). The most significant SNPs (RS8109886 and RS8113007) detected by the present this in addition to six other SNPs have not been reported previously to have any association with HCV clearance in other populations and could be relevant to patients of Pakistani origin, although this requires follow-up studies to be fully confirmed. Five SNPs reported in the literature were excluded from this study (RS4803219, RS8103142, RS4823221, RS28416813 and RS11881222). SNP RS11881222 failed our QC and was excluded for a low call rate (< 80%) but the other five SNPs were not included because the Sequenom primer design software was unable to design suitable primers and probes for them. Excluding these SNPs from our study could represent missed associations in Pakistani patients and constitute additional analyses in this cohort and in future studies to determine whether they have any role in HCV clearance in Pakistani patients as well as the ones reported in patients from Taiwan, Spain, China and Europe (Table 1). None of the SNPs associated with HCV clearance in this study were in coding regions; but were located in regions up-or down-stream of genes or in the 3’ or 5’UTR. This suggests that they have a regulatory function rather than directly affecting protein structure. The 13 SNPs associated with HCV clearance in this study formed 6 haplotypes, of which the major alleles of SNPs RS8109886, RS8113007, RS12979860 and RS8099917 were all present on haplotype I, the haplotype with the highest Odds Ratio for predicting the treatment response (Table 4). The role of these SNPs has been established as having effects on the binding of different transcription factors and alterations of methylation sites resulting in reduced expression of IL28B, and up-regulation of ISGs in the responder haplotypes in response to IFN-α stimulation therapy (24) while IL28B non-responders have high ISG expression in infected hepatocytes, and that high ISG levels independently predicts poor response to the therapy (39). HCV clearance is a complex process, dependent on the type of HCV infection and the host’s immunity-related genetic factors. Some SNPs associated with HCV clearance in Pakistani patients are the same as those that have been detected to have associations in other cohorts too (Table 1) and suggest a common genetic background across multiple populations for HCV clearance. However, number of alleles identified in this study were unique to the present study which could suggest Pakistani-specific factors for HCV clearance, particularly for type 3a. It is important to consider, however, that this data comprised a small sample size and that repeating this study in a larger cohort could affect the findings and alter the outcome of some markers. For this reason, the data presented here should be interpreted with caution until it can be further verified. These findings, however, do support results widely reported from other populations were host genotype has been a proven factor in HCV clearance and treatment response (Table 1). Restricting this analysis to type 3a patients introduced a selection bias meaning if genotyping were to be introduced as a screening strategy, patients would require screening for HCV type prior to genotyping for treatment response. This selection strategy was chosen because type 3a is the most common form of HCV in Pakistan and so represents the largest treatment group. Confirming the association of these SNPs and HCV clearance, in other HCV types requires further investigation. Tailoring treatments to target potential responders, as opposed to generalized, universal treatment strategies, will be of economic benefit but, more importantly, will have substantial benefits for patients, as they would recover quicker and be less likely to require multiple ‘trial-and-error’ treatments. Data from the present study support the associations of SNPs (Table 2) present in the IFN-λ genes with HCV clearance after interferon and ribavirins combined therapy in Pakistani individuals infected with genotype 3a and provide preliminary evidence to suggest patients should be genotyped for the relevant SNPs in order to predict drug response before starting therapy.
  38 in total

1.  IL-28, IL-29 and their class II cytokine receptor IL-28R.

Authors:  Paul Sheppard; Wayne Kindsvogel; Wenfeng Xu; Katherine Henderson; Stacy Schlutsmeyer; Theodore E Whitmore; Rolf Kuestner; Ursula Garrigues; Carl Birks; Jenny Roraback; Craig Ostrander; Dennis Dong; Jinu Shin; Scott Presnell; Brian Fox; Betty Haldeman; Emily Cooper; David Taft; Teresa Gilbert; Francis J Grant; Monica Tackett; William Krivan; Gary McKnight; Chris Clegg; Don Foster; Kevin M Klucher
Journal:  Nat Immunol       Date:  2002-12-02       Impact factor: 25.606

2.  Hepatic ISG expression is associated with genetic variation in interleukin 28B and the outcome of IFN therapy for chronic hepatitis C.

Authors:  Masao Honda; Akito Sakai; Tatsuya Yamashita; Yasunari Nakamoto; Eishiro Mizukoshi; Yoshio Sakai; Taro Yamashita; Mikiko Nakamura; Takayoshi Shirasaki; Katsuhisa Horimoto; Yasuhito Tanaka; Katsushi Tokunaga; Masashi Mizokami; Shuichi Kaneko
Journal:  Gastroenterology       Date:  2010-04-29       Impact factor: 22.682

3.  Interleukin-28B polymorphism improves viral kinetics and is the strongest pretreatment predictor of sustained virologic response in genotype 1 hepatitis C virus.

Authors:  Alexander J Thompson; Andrew J Muir; Mark S Sulkowski; Dongliang Ge; Jacques Fellay; Kevin V Shianna; Thomas Urban; Nezam H Afdhal; Ira M Jacobson; Rafael Esteban; Fred Poordad; Eric J Lawitz; Jonathan McCone; Mitchell L Shiffman; Greg W Galler; William M Lee; Robert Reindollar; John W King; Paul Y Kwo; Reem H Ghalib; Bradley Freilich; Lisa M Nyberg; Stefan Zeuzem; Thierry Poynard; David M Vock; Karen S Pieper; Keyur Patel; Hans L Tillmann; Stephanie Noviello; Kenneth Koury; Lisa D Pedicone; Clifford A Brass; Janice K Albrecht; David B Goldstein; John G McHutchison
Journal:  Gastroenterology       Date:  2010-04-24       Impact factor: 22.682

4.  Hepatitis C virus genotype 3a with phylogenetically distinct origin is circulating in Pakistan.

Authors:  Irshad-Ur Rehman; Muhammad Idrees; Muhammad Ali; Liaqat Ali; Sadia Butt; Abrar Hussain; Haji Akbar; Samia Afzal
Journal:  Genet Vaccines Ther       Date:  2011-01-06

5.  HCV RNA decline in chronic HCV genotype 2 and 3 during standard of care treatment according to IL28B polymorphism.

Authors:  J Stenkvist; A Sönnerborg; O Weiland
Journal:  J Viral Hepat       Date:  2012-08-21       Impact factor: 3.728

6.  Relationship between the genetic variation in interleukin 28B and response to antiviral therapy in patients with chronic hepatitis C.

Authors:  Jun-Qiang Xie; Xiao-Yan Guo; Xiao-Hong Zhang; Bing-Liang Lin; Dong-Ying Xie; Zhi-Liang Gao; Gen-Shu Wang; Zhi-Xin Zhao
Journal:  Chin Med J (Engl)       Date:  2012-07       Impact factor: 2.628

7.  IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy.

Authors:  Vijayaprakash Suppiah; Max Moldovan; Golo Ahlenstiel; Thomas Berg; Martin Weltman; Maria Lorena Abate; Margaret Bassendine; Ulrich Spengler; Gregory J Dore; Elizabeth Powell; Stephen Riordan; David Sheridan; Antonina Smedile; Vincenzo Fragomeli; Tobias Müller; Melanie Bahlo; Graeme J Stewart; David R Booth; Jacob George
Journal:  Nat Genet       Date:  2009-09-13       Impact factor: 38.330

8.  Molecular epidemiology of hepatitis C virus genotypes in different geographical regions of Punjab Province in Pakistan and a phylogenetic analysis.

Authors:  Hafsa Aziz; Abida Raza; Shahnaz Murtaza; Yasir Waheed; Ali Khalid; Javaid Irfan; Zahoor Samra; Muhammad Amin Athar
Journal:  Int J Infect Dis       Date:  2012-11-22       Impact factor: 3.623

9.  Analysis of IL28B variants in an Egyptian population defines the 20 kilobases minimal region involved in spontaneous clearance of hepatitis C virus.

Authors:  Vincent Pedergnana; Mohamed Abdel-Hamid; Julien Guergnon; Amira Mohsen; Lénaïg Le Fouler; Ioannis Theodorou; Mostafa Kamal Mohamed; Arnaud Fontanet; Sabine Plancoulaine; Laurent Abel
Journal:  PLoS One       Date:  2012-06-14       Impact factor: 3.240

10.  IL28B SNP screening and distribution in the French Canadian population using a rapid PCR-based test.

Authors:  Jean-François Gélinas; Thomas Fabre; Philippe Willems; Reynold C Leung; Jacob George; Bernard Willems; Julie Bruneau; Naglaa H Shoukry
Journal:  Immunogenetics       Date:  2013-03-03       Impact factor: 2.846

View more
  5 in total

1.  Interleukin 28A.rs12980602 and interleukin 28B.rs8103142 genotypes could be protective against HCV infection among Egyptians.

Authors:  Zainab A Zakaria; Susanne Knapp; Mohamed Hashem; Hassan Zaghla; Mark Thursz; Imam Waked; Sayed Abdelwahab
Journal:  Immunol Res       Date:  2019-02       Impact factor: 2.829

2.  Pretreatment Predictors of Response to PegIFN-RBV Therapy in Egyptian Patients with HCV Genotype 4.

Authors:  Hanan H Rizk; Nadia M Hamdy; Nadia L Al-Ansari; Hala O El-Mesallamy
Journal:  PLoS One       Date:  2016-04-21       Impact factor: 3.240

3.  Prevalence of IFNL3 rs4803217 single nucleotide polymorphism and clinical course of chronic hepatitis C.

Authors:  Bogna Świątek-Kościelna; Ewelina Kałużna; Ewa Strauss; Jerzy Nowak; Iwona Bereszyńska; Ewelina Gowin; Jacek Wysocki; Jolanta Rembowska; Dominika Barcińska; Iwona Mozer-Lisewska; Danuta Januszkiewicz-Lewandowska
Journal:  World J Gastroenterol       Date:  2017-06-07       Impact factor: 5.742

Review 4.  A systematic review of treatment response rates in Pakistani hepatitis C virus patients; current prospects and future challenges.

Authors:  Muhammad Ali; Samia Afzal; Asad Zia; Ahmed Hassan; Ali Talha Khalil; Muhammad Ovais; Zabta Khan Shinwari; Muhammad Idrees
Journal:  Medicine (Baltimore)       Date:  2016-12       Impact factor: 1.889

5.  Interferon-λ Genetic Variations and Hepatitis C: Yet to be Discovered.

Authors:  Maryam Keshvari; Heidar Sharafi
Journal:  Hepat Mon       Date:  2014-05-10       Impact factor: 0.660

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.