BACKGROUND: The large amounts of data generated by genomics, transcriptomics and proteomics have increased our understanding of the biology of Anaplasma marginale. However, these data have also led to new assumptions that require testing, ideally through classical genetic mutation. One example is the definition of genes associated with virulence. Here we describe the molecular characterization of a red fluorescent and spectinomycin and streptomycin resistant A. marginale mutant generated by Himar1 transposon mutagenesis. RESULTS: High throughput genome sequencing to determine the Himar1-A. marginale genome junctions established that the transposon sequences were integrated within the coding region of the omp10 gene. This gene is arranged within an operon with AM1225 at the 5' end and with omp9, omp8, omp7 and omp6 arranged in tandem at the 3' end. RNA analysis to determine the effects of the transposon insertion on the expression of omp10 and downstream genes revealed that the Himar1 insertion not only reduced the expression of omp10 but also that of downstream genes. Transcript expression from omp9, and omp8 dropped by more than 90% in comparison with their counterparts in wild-type A. marginale. Immunoblot analysis showed a reduction in the production of Omp9 protein in these mutants compared to wild-type A. marginale. CONCLUSIONS: These results demonstrate that transposon mutagenesis in A. marginale is possible and that this technology can be used for the creation of insertional gene knockouts that can be evaluated in natural host-vector systems.
BACKGROUND: The large amounts of data generated by genomics, transcriptomics and proteomics have increased our understanding of the biology of Anaplasma marginale. However, these data have also led to new assumptions that require testing, ideally through classical genetic mutation. One example is the definition of genes associated with virulence. Here we describe the molecular characterization of a red fluorescent and spectinomycin and streptomycin resistant A. marginale mutant generated by Himar1 transposon mutagenesis. RESULTS: High throughput genome sequencing to determine the Himar1-A. marginale genome junctions established that the transposon sequences were integrated within the coding region of the omp10 gene. This gene is arranged within an operon with AM1225 at the 5' end and with omp9, omp8, omp7 and omp6 arranged in tandem at the 3' end. RNA analysis to determine the effects of the transposon insertion on the expression of omp10 and downstream genes revealed that the Himar1 insertion not only reduced the expression of omp10 but also that of downstream genes. Transcript expression from omp9, and omp8 dropped by more than 90% in comparison with their counterparts in wild-type A. marginale. Immunoblot analysis showed a reduction in the production of Omp9 protein in these mutants compared to wild-type A. marginale. CONCLUSIONS: These results demonstrate that transposon mutagenesis in A. marginale is possible and that this technology can be used for the creation of insertional gene knockouts that can be evaluated in natural host-vector systems.
Anaplasma marginale is a tick-borne and obligate intracellular bacterium that causes bovine anaplasmosis, a disease that has gained particular attention due to the considerable economic losses for the cattle industry [1-4]. Onset of clinical disease is mainly characterized by a severe hemolytic anemia [1,2]. Cattle that survive acute infection become carriers of A. marginale and organisms can be transmitted to susceptible cattle mechanically or by tick bite [2]. A. marginale persists in carrier cattle because of its capability to subvert the immune system using antigenic variation in which different variants of outer membrane proteins such as Msp2 and Msp3 are expressed [5-8].Work on the development of a preventive vaccine against this disease began in the early 1900’s with the isolation of A. marginale subsp. centrale[9,10]. This less virulent strain, originally from South Africa, is used for immunization of cattle in Africa, Australia, South America and the Middle East and remains the most widely-used and practical vaccine against bovine anaplasmosis [9-11]. This vaccine is not approved in the United States because of the risk of transmitting contaminant blood-borne pathogens that will infect cattle [1]. Recently, comparative genomic studies demonstrated that proteins that are conserved in US strains were not conserved in A. marginale subsp. centrale[10-12].Different vaccination methods have been developed for the control of bovine anaplasmosis that range from attenuated live or killed organisms, to DNA and recombinant protein vaccines [9]. But A. marginale derived from cell culture, killed organisms and DNA vaccines induce only partial protection [13-15]. Immunization trials using outer membrane proteins or a complex of linked or unlinked outer membrane proteins of A. marginale derived from erythrocytes have demonstrated good protection against high bacteremia, anemia and homologous strain challenge [16-20]. However, to promote long lasting protection, several immunization boosts may be required and in addition to this, production and purification of these components is time-consuming and expensive.The increased use of molecular approaches such as whole genome, RNA sequencing, proteomics and comparative genomics of A. marginale has identified potential virulence-associated targets that can be altered or removed by reverse genetics techniques [12,21-25]. This could allow the creation of attenuated organisms that have reduced pathogenicity but still elicit cellular and antibody responses that stimulate immunity without causing disease. Consequently the development of genetic tools to transform A. marginale and generate in-vitro gene knockouts, or insertional mutants that can be tested for attenuation in their in-vivo environment is of great significance.One way to create insertional mutations in pathogenic bacteria is via transposon mutagenesis, in which a library of recombinant bacteria containing different transposon insertions can be created, allowing for the screening of mutant strains with diverse phenotypes [26,27]. The Himar1 transposon is a non-replicative class II DNA transposon that is a member of the Tc1/mariner family and is often used for the creation of insertional mutants. Since these types of transposons are horizontally transferred between species, they do not have host restricted functions, making them suitable for use in a wide-range of eukaryotic and prokaryotic hosts [27,28]. In addition to this, the Himar1 transposon does not have DNA target specificity since it is integrated randomly in TA dinucleotide sites [28-30]. Because of these advantages, transposon mutagenesis using this system has been successfully developed in other tick-borne pathogens such as Rickettsia rickettsii, Coxiella burnetii, Borrelia burgdorferi, Francisella tularensis, Ehrlichia chaffeensis and Anaplasma phagocytophilum[31-40]. These previous results suggest that this system could be useful for the transformation of A. marginale.Nevertheless, previous attempts to transform A. marginale by transposon mutagenesis were not successful. Previously, the Himar1 transposon and transposase were delivered in two separate vectors into A. marginale which resulted in the isolation of green fluorescent and antibiotic resistant bacteria. However molecular characterization of these recombinant organisms established that the entire plasmid carrying the transposon sequences was integrated into the A. marginale chromosome by a single crossover homologous recombination mechanism instead of the classical cut and paste mechanism of transposition [41]. Therefore, we wanted to evaluate first, if classical transposon mutagenesis using the Himar1 transposon system is achievable in A. marginale, and second, if transposon mutagenesis using this system, is useful for the creation of insertional knockout mutations.
Results
Transformation of Anaplasma marginale by transposon mutagenesis
Attempts to transform A. marginale by transposon mutagenesis using the Himar1 transposon/transposase system delivered in two separate plasmids were not successful. The probability that two plasmids are introduced at once into A. marginale organisms could be very low, especially when viability in the extracellular environment might be highly compromised, resulting in a low fraction of cells competent to take up DNA.Therefore in order to promote transposon mutagenesis in these bacteria, the transposase was provided in cis with the Himar1 transposon sequences (R. F. Felsheim unpublished data). The pHimarcisA7mCherry-SS contains the hyperreactive allele A7 transposase and the Himar1 TIR flanking the mCherry reporter gene and the aadA gene, which confers resistance against spectinomycin and streptomycin. Expression of the transposase and the reporter and antibiotic selection genes is driven by the A. marginale tr promoter [41,42] (Figure 1A). Antibiotic selection pressure of electroporated bacteria with this construct resulted in the isolation of red fluorescent and antibiotic resistant bacteria (Figure 1B).
Figure 1
Red fluorescent . A. Plasmid map of pHimarcisA7mCherry-SS used for the electroporation of A. marginale str. Virginia. B. Fluorescent (left) and phase contrast/fluorescence merged (right) images, of transformed A. marginale replicating in ISE6 tick cells.
Red fluorescent . A. Plasmid map of pHimarcisA7mCherry-SS used for the electroporation of A. marginale str. Virginia. B. Fluorescent (left) and phase contrast/fluorescence merged (right) images, of transformed A. marginale replicating in ISE6 tick cells.
Mapping of transposon insertion within the A. marginale chromosome
We used Roche/454 and Illumina high-throughput genome sequencing to determine: 1) the location of plasmid sequences within the A. marginale chromosome, 2) the recombination mechanism that allowed the segregation of mutant bacteria and 3) if these recombinant organisms correspond to a population containing insertions in different genomic locations or in a single genome site.Mutations produced by the integration of the Himar1 transposon into the A. marginale chromosome will generate new junction sequences that are absent in the wild-type. These new sequences should include the Himar1 terminal inverted repeats (TIR) followed by the sequence of the regions in which the transposon is integrated. Based on this, the strategy that we used to map the Himar1 insertion site involved alignment of the sequencing reads obtained by Roche/454 and Illumina methods to two reference sequences, the A. marginale str. St Maries genome sequence (CP000030) and the Himar1 TIR sequence. The Himar1 TIR-A. marginale genome junctions were identified by extracting reads that aligned to the A. marginale genome at one end and to the Himar1 TIR at the other end.Analysis using Illumina reads mapped the Himar1 TIR-A. marginale genome junctions into a region of omp6 and omp10 genes. Interestingly these reads contained the same mutated sequence. The omp6 and omp10 genes share a large stretch of identity 456 nt/459 nt (99%) [43]. The short, 100 nt length of the Illumina reads, made it difficult to differentiate which gene contained the Himar1 transposon. Additional analysis using longer reads obtained on the Roche/454 platform revealed that the Himar1 transposon was integrated within the omp10 gene. These reads contained a region of omp10 that is not shared with omp6. Based on this sequencing analysis the genomic location of the Himar1 transposon in the chromosome of the transformed A. marginale, is at position 245 considering 1 as the first base of the omp10 start codon (Figure 2A).
Figure 2
Mapping of transposon insertion site. A. Location of primer pairs (AB1553-AB1554) and (AB1561-AB1562) designed to target the omp6 and omp10 genes respectively, in wild-type (WT) and transformed A. marginale. Based on sequencing results the Himar1 sequences are integrated in the chromosome of transformed A. marginale at nucleotide 245 after the first base of the omp10 start codon (arrows) and mCherry and aadA (Str/Spc resistant) genes are in the opposite orientation to omp10. B. Agarose Gel electrophoresis. gDNA isolated from ISE6 tick cells infected with wild-type (WT) and transformed A. marginale, was used as template for PCR amplification with primers shown in A. (Lane 1) 100 bp/1Kb DNA ladder, omp6 amplicons in transformed (lane 2) and WT (lane3) A. marginale were of the same size 492 bp. The omp10 amplicon in transformed A. marginale (lane 4) was 2805 bp, while in wild type was 969 bp (lane 5).
Mapping of transposon insertion site. A. Location of primer pairs (AB1553-AB1554) and (AB1561-AB1562) designed to target the omp6 and omp10 genes respectively, in wild-type (WT) and transformed A. marginale. Based on sequencing results the Himar1 sequences are integrated in the chromosome of transformed A. marginale at nucleotide 245 after the first base of the omp10 start codon (arrows) and mCherry and aadA (Str/Spc resistant) genes are in the opposite orientation to omp10. B. Agarose Gel electrophoresis. gDNA isolated from ISE6 tick cells infected with wild-type (WT) and transformed A. marginale, was used as template for PCR amplification with primers shown in A. (Lane 1) 100 bp/1Kb DNA ladder, omp6 amplicons in transformed (lane 2) and WT (lane3) A. marginale were of the same size 492 bp. The omp10 amplicon in transformed A. marginale (lane 4) was 2805 bp, while in wild type was 969 bp (lane 5).These results were verified by PCR amplification of gDNA from ISE6 cells infected with wild-type and transformed A. marginale using omp6 and omp10 specific primers (Figure 2A-B). The size of omp6 amplicons (492 bp) in wild-type and transformed A. marginale was the same. However the size of the omp10 amplicon in transformed A. marginale was increased by 1836 bp when compared to the wild-type (969 bp), indicating that the transposon was integrated within the omp10 gene.The genome sequence of A. marginale str. Virginia is available only as unannotated contigs with gaps. Therefore for our analysis we used the A. marginale str. St Maries genome as reference. For this reason we wanted to confirm that the transposon location in the mutated Virginia strain was the same as the one mapped in the reference genome. For this, combined Roche/454 and Illumina reads were assembled and a contig of 21,324 nucleotides identified. Alignment of this contig with the A. marginale str. St Maries genome showed that this sequence contained part of omp10 and upstream genes (99% identity) (Figure 3) and that the transposon insertion site in the A. marginale str. Virginia matches the same region mapped using the reference genome.
Figure 3
transposon insertion site in the str. Virginia genome. ACT (Artemis Comparison Tool) window showing alignment between the A. marginale genome (CP000030) used as reference, the A. marginale str. Virginia omp10::himar1 contig formed by Roche/454 and Illumina sequencing reads and the Himar1 transposon sequences. Alignment between the A. marginale str St Maries and the omp10::himar1 mutant shows that sequences flanking the transposon insertion site are highly similar sharing an identity of 99% (matching red band). This demonstrates that the transposon insertion site (yellow boxes) occurred at nucleotide 245 after the first base of the omp10 start codon (black dotted line) in the reference strain. Alignment with the Himar1 transposon sequences clearly show the insertion of these sequences in the omp10::himar1 mutant which are not present in the A. marginale str. St Maries (absence of matching band).
transposon insertion site in the str. Virginia genome. ACT (Artemis Comparison Tool) window showing alignment between the A. marginale genome (CP000030) used as reference, the A. marginale str. Virginia omp10::himar1 contig formed by Roche/454 and Illumina sequencing reads and the Himar1 transposon sequences. Alignment between the A. marginale str St Maries and the omp10::himar1 mutant shows that sequences flanking the transposon insertion site are highly similar sharing an identity of 99% (matching red band). This demonstrates that the transposon insertion site (yellow boxes) occurred at nucleotide 245 after the first base of the omp10 start codon (black dotted line) in the reference strain. Alignment with the Himar1 transposon sequences clearly show the insertion of these sequences in the omp10::himar1 mutant which are not present in the A. marginale str. St Maries (absence of matching band).Further analysis of sequencing reads determined that there is only one transposon insertion in the chromosome of recombinant A. marginale. The reads containing the Himar1 TIR-A. marginale junctions aligned to a single genome site. Although these transformed organisms were not cloned, data suggest that they are isogenic for the transposon insertion site within the omp10 gene.The mobilization of the Himar1 transposon from one locus to another is mediated by a transposase using a cut and paste mechanism [27,30]. It has been shown previously in other organisms that the Himar1 transposon integrates preferentially into a TA site and leads to duplication of this dinucleotide upon integration into the target site [30]. This was found to be true also for A. marginale. Sequencing analysis revealed that the Himar1 transposon targeted a TA dinucleotide in omp10 (Figure 4A) and upon integration it is flanked by a TA dinucleotide sequence (Figure 4B). Thus, the mobilization of the Himar1 transposon into the omp10 gene of A. marginale was mediated by means of the A7 transposase in a cut and paste mechanism. This transformant of A. marginale will be referred to as omp10::himar1 mutant.
Figure 4
Characterization of transposon insertion site. A. Artemis (genome browser and annotation tool) window showing the A. marginale genome (CP000030) used as a reference for the location of the omp10 gene (AM1223, 1092273–1093555), and the TA dinucleotide (1093290–1093291) at the Himar1 tn insertion site (arrow) determined by high throughput genome sequencing analysis. B. Himar1 tn insertion into the omp10 gene was mediated by the A7 transposase in a cut and paste mechanism leading to the duplication of TA dinucleotide sequences. A. marginale genome (underlined uppercase text, TA dinucleotide duplications (enhanced uppercase text) flanking the tn elements (bold lowercase).
Characterization of transposon insertion site. A. Artemis (genome browser and annotation tool) window showing the A. marginale genome (CP000030) used as a reference for the location of the omp10 gene (AM1223, 1092273–1093555), and the TA dinucleotide (1093290–1093291) at the Himar1 tn insertion site (arrow) determined by high throughput genome sequencing analysis. B. Himar1 tn insertion into the omp10 gene was mediated by the A7 transposase in a cut and paste mechanism leading to the duplication of TA dinucleotide sequences. A. marginale genome (underlined uppercase text, TA dinucleotide duplications (enhanced uppercase text) flanking the tn elements (bold lowercase).
Evidence for expression of omp10 as part of an operon
We hypothesize that the transposon insertion could alter the expression of omp10 and downstream genes. This hypothesis is based on recent work in which the transcriptome profile of A. marginale using RNAseq indicated that omp10 is expressed as part of a six-gene operon in erythrocytes of infected cattle [25]. This operon includes AM1225, omp10, omp9, omp8, omp7 and omp6 (Figure 5A).
Figure 5
Intergenic regions of to were analyzed by RT-PCR. A. Diagrammatic representation of the AM1225-omp6 operon with AM1225, omp10, omp9, omp8, omp7 and omp6 and intergenic regions. Location of primer pairs (AB1556-AB1591), (AB1592-AB1581), (AB1582-AB1569), and (AB1655-AB1595) designed for PCR amplification of omp7-8, omp8-9,omp9-10 and omp10-AM1225 intergenic regions using cDNA from ISE6 cells infected with A. marginale wild-type. B. Agarose gel analysis of amplicons connecting intergenic regions from omp7 through AM1225 (lanes 2, 5, 8, and 11). DNA was used as positive control (lanes 4, 7, 10, and 13). cDNAs from reactions with no reverse transcriptase were used as negative controls (lanes 3, 6, 9 and 12). 100 bp/1Kb DNA ladder (lane 1).
Intergenic regions of to were analyzed by RT-PCR. A. Diagrammatic representation of the AM1225-omp6 operon with AM1225, omp10, omp9, omp8, omp7 and omp6 and intergenic regions. Location of primer pairs (AB1556-AB1591), (AB1592-AB1581), (AB1582-AB1569), and (AB1655-AB1595) designed for PCR amplification of omp7-8, omp8-9,omp9-10 and omp10-AM1225 intergenic regions using cDNA from ISE6 cells infected with A. marginale wild-type. B. Agarose gel analysis of amplicons connecting intergenic regions from omp7 through AM1225 (lanes 2, 5, 8, and 11). DNA was used as positive control (lanes 4, 7, 10, and 13). cDNAs from reactions with no reverse transcriptase were used as negative controls (lanes 3, 6, 9 and 12). 100 bp/1Kb DNA ladder (lane 1).Because of this, we wanted to determine if omp10 is expressed within a polycistronic message in A. marginale replicating in ISE6 tick cells. The intergenic region between AM1225 and omp10 is 440 bp long, while intergenic regions between omp10-9, omp9-8, omp8-7 and omp7-6 are 62 bp, 63 bp, 64 bp and 36 bp respectively (Figure 5A). To test whether AM1225 through omp7 are expressed as a single transcriptional unit, total RNA isolated from ISE6 cells infected with wild-type A. marginale was reverse transcribed and template cDNA was used for amplification of intergenic regions with primers that connect neighboring genes (Figure 5A). The omp6 gene was not included in these experiments, because previous work [43] and work in our lab showed that transcripts from this gene are not detected in A. marginale during infection of tick cells. Appropriate size amplicons of the intergenic regions between omp7-8, omp8-9, omp9-10 and omp10-AM1225 gene were detected (Figure 5B), providing evidence that these genes are transcribed as a single mRNA in A. marginaleinfected tick cells.
RNA transcript analysis
Next, we determined if insertion of the Himar1 sequences resulted in alteration of omp10 expression and the expression of genes downstream. For this, total RNA from ISE6 tick cells infected with A. marginale wild-type and omp10::himar1 mutant was reverse transcribed and cDNA used as template for PCR amplification with specific primers that were designed to anneal to omp6, omp7, omp8, omp9, and omp10 in wild-type and omp10::himar1 mutant respectively (Figure 6A). The omp10, 9, 8, and 7 genes, but not omp6, are transcriptionally active in wild-type A. marginale, although at low levels (Figure 6B). The Himar1 transposon insertion into the coding sequence of omp10, disrupted its expression and that of omp9, omp8, and omp7 since transcripts from these genes were not detected in omp10::himar1 mutants of A. marginale by this method (Figure 6B). To ensure integrity, cDNA samples from A. marginale wild-type and omp10::himar1 mutant were used for amplification with specific primers of a region of 131 bp of the 16S rRNA. Amplicons from this region were detected in both wild-type and omp10::himar1 mutant. No bands were visualized in negative controls (Figure 6B).
Figure 6
Transcriptional analysis of the effect of the insertion of the transposon within the gene by RT-PCR. A. Binding sites of primers (AB1553-AB1554), (AB1555-AB1556), (AB1591-AB1592), (AB1559-AB1560), and (AB1561-AB1562), designed to amplify transcripts on omp6, 7, 8, 9 and 10, respectively, in wild-type (WT) and omp10::himar1 mutant. Complementary DNA from WT and omp10::himar1 mutant grown in ISE6 tick cells was used for PCR amplification for omp6 through 10 with specific primers to evaluate gene expression. B. Agarose gel analysis of PCR products for omp6 through 10 in omp10::himar1 mutant (lanes 2, 8, 14, 20, and 26). PCR products for omp6 through 10 in WT (lanes 5, 11, 17, 23, and 29). Genomic DNA was used as positive control (lanes 4, 7, 10, 13, 16, 19, 22, 25, 28, and 31). Complementary DNA from reactions without reverse transcriptase were used as negative controls (lanes, 3, 6, 9, 12, 15, 18, 21, 24, 27, and 30). 100 bp/1Kb DNA ladder lane 1). 16S rRNA (AB1572-AB1573) was used as an internal control to ensure integrity of cDNA (lanes 32–37).
Transcriptional analysis of the effect of the insertion of the transposon within the gene by RT-PCR. A. Binding sites of primers (AB1553-AB1554), (AB1555-AB1556), (AB1591-AB1592), (AB1559-AB1560), and (AB1561-AB1562), designed to amplify transcripts on omp6, 7, 8, 9 and 10, respectively, in wild-type (WT) and omp10::himar1 mutant. Complementary DNA from WT and omp10::himar1 mutant grown in ISE6 tick cells was used for PCR amplification for omp6 through 10 with specific primers to evaluate gene expression. B. Agarose gel analysis of PCR products for omp6 through 10 in omp10::himar1 mutant (lanes 2, 8, 14, 20, and 26). PCR products for omp6 through 10 in WT (lanes 5, 11, 17, 23, and 29). Genomic DNA was used as positive control (lanes 4, 7, 10, 13, 16, 19, 22, 25, 28, and 31). Complementary DNA from reactions without reverse transcriptase were used as negative controls (lanes, 3, 6, 9, 12, 15, 18, 21, 24, 27, and 30). 100 bp/1Kb DNA ladder lane 1). 16S rRNA (AB1572-AB1573) was used as an internal control to ensure integrity of cDNA (lanes 32–37).Since omp10 through omp7 are expressed at low levels in ISE6 tick cells, RT-qPCR was used to quantitatively determine differences of expression between A. marginale wild-type and omp10::himar1 mutant. For this, cDNA generated from ISE6 tick cells infected with A. marginale wild-type and omp10::himar mutant was used for real time PCR amplification using primers and probes targeting omp8, omp9, and the 3’ and 5’ ends of omp10 (Figure 7A).
Figure 7
Relative gene expression by RT-qPCR. A. location of binding sites for primers and probes designed to target omp8 (1. AB1591, 2. AB1592, 3. AB1593), omp9 (4. AB1581, 5. AB1582, 6. AB1583), 3’ end of omp10 (7. AB1569, 8. AB1570, 9. AB1571), and the 5’ end of omp10 (10. AB1594, 11. AB1595, 12. AB1596). B. Bar lengths represent the percentage of expression of omp8, omp9, 3’ end of omp10 and 5’ end of omp10 in A. marginale wild-type (red bars) and omp10::himar1 mutant (blue bars). msp5, rpoH and 16S rRNA were used as reference genes for data normalization. Changes in expression of these genes were calculated using the 2-ΔΔCtmethod.* Significant differences (P < 0.05) were calculated as described in materials and methods.
Relative gene expression by RT-qPCR. A. location of binding sites for primers and probes designed to target omp8 (1. AB1591, 2. AB1592, 3. AB1593), omp9 (4. AB1581, 5. AB1582, 6. AB1583), 3’ end of omp10 (7. AB1569, 8. AB1570, 9. AB1571), and the 5’ end of omp10 (10. AB1594, 11. AB1595, 12. AB1596). B. Bar lengths represent the percentage of expression of omp8, omp9, 3’ end of omp10 and 5’ end of omp10 in A. marginale wild-type (red bars) and omp10::himar1 mutant (blue bars). msp5, rpoH and 16S rRNA were used as reference genes for data normalization. Changes in expression of these genes were calculated using the 2-ΔΔCtmethod.* Significant differences (P < 0.05) were calculated as described in materials and methods.In order to compare these gene expression results between wild-type and omp10:himar1 A. marginale, Ct values were normalized to the rpoH, msp5 and 16S rRNA genes. Changes in expression of these genes were calculated by the 2-ΔΔCt method, and results were expressed as percentage of expression, with a 100% expression level being assigned to the calibrator or control group, which in this case is wild-type A. marginale.Although three different reference genes were used, RT-qPCR data normalization led to similar results in which there was a significantly reduced expression for omp8 (97–99%), omp9 (90–99%) and omp10 3’ end (85-98%) relative to their counterparts in wild-type A. marginale (Figure 7B). These results show that Himar1 transposon insertion into omp10 affected its expression and the expression of genes downstream, confirming the results obtained by RT-PCR and agarose gel electrophoresis. A second experiment investigated the possibility of the same effect occurring in regions of omp10 before the Himar1 transposon insertion site. For this, a primer and probe set was designed to anneal with a region at the 5’ end of omp10 (Figure 7A). Even though there was a significant reduction in the detection of transcripts from this region (27-57%) relative to the 5’ end of omp10 in wild-type, this reduction was not as great as with the sequences located in omp10 downstream of the Himar1 transposon insertion site.
Western immunoblot analysis
To determine if the decreased expression of mRNA in genes downstream of omp10 correlated with protein expression a Western immunoblot analysis using anti Omp9 antibody was performed.To compare the protein expression of omp9 between A. marginale omp10::himar1 and wild-type, the number of organisms per sample was quantified by qPCR using the opag2 single copy gene to determine the copy number of A. marginale. Equal amounts (108) of organisms of A. marginale wild-type and omp10::himar1 mutant were loaded per lane. A. marginale str. Virginia initial bodies and uninfected ISE6 cells were used as positive and negative controls respectively.Western immunoblot showed a reduced expression of Omp9 in omp10::himar1 A. marginale mutant compared with wild-type (Figure 8A). The Omp9 band of 40 kDa was present in wild-type and initial bodies but was not detected in the mutant or using negative control antibody Tryp1E1 (Figure 8B). Antibody F16C1 that reacts with major surface protein 5 (Msp5) was used as a loading control. Anti-Msp5 detected this protein (19 kDa) in wild-type and omp10::himar1 A. marginale (Figure 8C).
Figure 8
Immunoblotting of mutant and WT using the specific monoclonal antibody Omp9. Proteins from equal amounts of host cell-free wild-type (WT) and omp10::himar1 A. marginale were separated by SDS-PAGE gel electrophoresis. Immunoblot PVDF membranes of transferred proteins were reacted with monoclonal antibodies and reactions were visualized by chemiluminescence. A. Monoclonal antibody Omp9 (4 μg/ml) with specificity to Omp9 protein (40 kDa) (black arrow). B. Negative control, monoclonal Tryp1E1 (4 μg/ml) (exhibits specificity for a variable surface glycoprotein of Trypanosoma brucei. C. Monoclonal F16C1 (2 μg/ml), reacts with the Msp5 (19 kDa) (blue arrow) protein of A. marginale, was used as loading control. A. marginale str. Virginia and uninfected ISE6 cells were used as positive and negative controls respectively.
Immunoblotting of mutant and WT using the specific monoclonal antibody Omp9. Proteins from equal amounts of host cell-free wild-type (WT) and omp10::himar1 A. marginale were separated by SDS-PAGE gel electrophoresis. Immunoblot PVDF membranes of transferred proteins were reacted with monoclonal antibodies and reactions were visualized by chemiluminescence. A. Monoclonal antibody Omp9 (4 μg/ml) with specificity to Omp9 protein (40 kDa) (black arrow). B. Negative control, monoclonal Tryp1E1 (4 μg/ml) (exhibits specificity for a variable surface glycoprotein of Trypanosoma brucei. C. Monoclonal F16C1 (2 μg/ml), reacts with the Msp5 (19 kDa) (blue arrow) protein of A. marginale, was used as loading control. A. marginale str. Virginia and uninfected ISE6 cells were used as positive and negative controls respectively.These results correlated with results obtained from the RNA transcript analysis, showing that the transposon insertion severely affected the expression of both mRNA and protein from downstream genes such as omp9.
Discussion
The possibility of creating insertional mutations in A. marginale not only could provide a broad understanding of gene products required for infectivity, growth or viability of this pathogen in the mammalian host and the tick vector, but also would allow the generation of genetically attenuated organisms that can be tested in vaccination trials.Here we report that transposon mutagenesis using the Himar1 transposon/transposase system for A. marginale is achievable and it could be useful for creating insertional mutations in these organisms. High throughput genome sequencing analysis for the characterization of these transformants established that transposon sequences are integrated within the omp10 gene of the A. marginale chromosome and its mobilization within this gene was mediated by the transposase in a cut and paste mechanism, since i.) the transposon sequences were integrated within a TA dinucleotide site ii.) upon integration of the transposon, this sequence was duplicated and is found flanking the transposon TIR at the junctions with the A. marginale genome and iii.) sequences from the delivering vector outside the transposon were not found.Although these omp10::himar1 mutant organisms were not cloned, they are isogenic for the transposon insertion within the omp10 because all the sequencing reads containing the transposon-A. marginale genome junctions aligned to the same genome site in the A. marginale/St. Maries reference genome sequence (CP000030). Possible reasons include transposon insertion into other genome regions that are essential for growth in tick cells, or insertion into regions that cause slower growth and non-recovery of these mutants. This suggests that further optimization is required to improve transformation efficiencies and for more rapid identification and separation of mutants before they are visible in cultures.The omp10 gene is part of the omp1 through omp14 clusters, members of the msp2 superfamily that correspond to the pfam01617 family of bacterial surface antigens [21]. Deep sequencing of cDNA generated from total RNA of erythrocytes infected with A. marginale identified 70 putative operon arrangements. One contained omp10 transcribed as part of an operon of six genes with AM1225 at the 5’ end and with omp9, omp8, omp7 and omp6 arranged in tandem at the 3’ end [25]. In order to have a better understanding of the effects of the transposon insertion in omp10 on adjacent genes it was important to determine if omp10 is also expressed as part of a polycistronic message in A. marginale replicating in tick cell cultures.RT-PCR of intergenic regions between omp7-8, omp8-9, omp9-10 and omp10-AM1225 provided evidence that omp10 is transcribed within a polycistronic message in A. marginaleinfected tick cells. However transcripts of omp6 were not detected. Similar results in which omp6 expression was not detected in A. marginale infected IDE8 tick cells and in tick midguts were obtained by others previously [43]. A lack of omp6 transcripts suggests that this gene may not be expressed in tick cells or only at very low levels. It has been shown that, in bacteria with reduced genomes such as Mycoplasma pneumoniae, gene members of an operon are not always expressed at the same levels and those genes distal from the promoter may have lower expression [44].RT-PCR and relative gene expression experiments demonstrated that insertion of Himar1 into omp10 at nucleotide 245 from the start of the ORF altered the sequence of this gene. This resulted in the loss of its expression since there was a significant reduction in the detection of transcripts from this gene when compared with the expression of omp10 transcripts from wild-type A. marginale.It has been shown that in bacteria production and/or stability of mRNA in regions downstream of a transposon insertion is greatly reduced, to the point where very little mRNA corresponding to this region can be isolated [45]. Insertion of Himar1 within a gene can affect the expression of neighboring genes, as shown in a variety of bacteria and especially in other tick-borne bacteria [38,39,46]. Therefore, we evaluated the effect of the Himar1 insertion on the expression of genes downstream and upstream of omp10 in omp10::himar1 A. marginale. Results showed that the transcriptional activities of omp9 and omp8 were negatively influenced by the insertion of the Himar1 within omp10 since detection of transcripts was significantly decreased in relation to wild-type omp9 and omp8.Although the transcription activity of regions upstream of the transposon insertion site at the 5’ end of omp10 dropped significantly in relation to wild-type A. marginale, it was not as severe as with genes downstream of omp10. Sequencing analysis determined that the transposon sense strand is found in the opposite orientation to omp10, so it might be possible for transcription to read through the Himar1 sequences and produce anti-sense transcripts that could reduce expression of sequences upstream of omp10, but to demonstrate this further characterization is required.Western immunoblot analysis showed that the transposon insertion into omp10 markedly reduced protein expression of omp9 in the omp10::himar1 mutant A. marginale when compared to wild-type, corroborating that both mRNA and protein expression from genes downstream of omp10 were disrupted.The evidence presented here suggests that these genes are not essential for growth of A. marginale in tick cell culture. Significant work on the possible interactions between the expressed proteins in different host environments has accumulated and offers important clues about the possible phenotypic effects of the disruption of these genes in A. marginale. For example omp7, omp8, omp9 and omp10 are differentially expressed in tick and mammalian cells with lower levels in tick midgut and cultured tick cells [43]. Detection of proteins from these genes has been reported [43,47,48]. Omp7, Omp8 and Omp9 are conserved during tick transmission and in acute and persistently infected cattle [43]. Characterization of the repertoire of outer membrane surface proteins by mass spectrometry identified Omp10 and Omp7 as immunogenic in cattle [47]. Proteome analysis using crosslinking and liquid chromatography–mass spectrometry (LC-MS/MS) to determine the composition and topological organization of surface proteins in A. marginale in mammalian and tick cells isolated a large protein complex and analysis demonstrated that Omp7, Omp8 and Omp9 are arranged in the outer membrane as near neighbors to Msp2, Msp3, Msp4, Omp1, Opag2, Am779, Am780, Am1011, Am854 and VirB1 in A. marginale isolated from erythrocytes [18]. In contrast a similar sized large protein complex in A. marginale isolated from tick cells was formed only by Msp2, Msp3, Msp4, Am778 and Am854. Although Omp7, Omp8 and Omp9 were expressed they did not seem to be localized to the surface, suggesting a possible re-arrangement in the topology of the surface of A. marginale during the transition from the tick cell into the mammalian cell [18].Interestingly, the number of Msp2 superfamily members such as omp1 to omp15 in A. marginale subsp. centrale, is reduced in comparison with US A. marginale strains [10]. For example, closely related sequences to omp8 and omp6 are missing and omp10 is found with omp7 and a reduced omp9 in tandem, which may indicate an important function of these genes in the pathogenicity of A. marginale.Based on this, further characterization of these omp10::himar1 mutants to understand the effects of the disruption of expression of omp10, 9, 8 and 7 on the phenotype of A. marginale is of critical importance. Phenotypic effects may include infectivity, tick transmissibility, stability under non selectable conditions, ability to induce immune responses and ability to establish persistent infection within the natural host.
Conclusions
Transposon mutagenesis is achievable for A. marginale. High throughput genome sequencing of recombinant bacteria electroporated with a single plasmid containing the Himar1 sequences and the A7 transposase showed insertion of the Himar1 sequences into the omp10 gene of A. marginale. The insertion was mediated by the transposase in a cut and paste mechanism. In tick cells omp10 is expressed as a polycistronic message with AM1225 at the 5’end and omp9, 8 and 7 at the 3’ end. Insertion of the Himar 1 transposon within omp10 not only disrupted its expression but also the expression of genes downstream, such as omp9, omp8 and omp7.This work shows the utility of the Himar1 system for the generation of insertional mutants in A. marginale, for the identification of genes involved in virulence and potentially for the development of attenuated organisms.
Methods
A. marginale cultivation
Cultures of A. marginale str. Virginia wild-type and omp10::himar1 mutant were maintained in tick ISE6 cells derived from embryonated eggs of the blacklegged tick, Ixodes scapularis at 34°C in non-vented 25-cm2 cell culture flasks (NUNC). A. marginale-infected cell cultures were maintained in L15B300 medium supplemented with 5% fetal bovine serum (FBS, BenchMark, Gemini Bio-Products), 5% tryptose phosphate broth (TPB, Difco, Becton Dickinson), 0.1% bovine lipoprotein concentrate (LPC, MP-Biomedical), 0.25% NaHCO3, and 25 mM HEPES buffer, adjusted to pH 7.8, as previously described [49]. The cell culture medium for ISE6 cells infected with the A. marginale omp10::himar1 mutant was supplemented with spectinomycin (Sigma Aldrich) and streptomycin (Sigma Aldrich) to a final concentration of 50 μg/ml each.
Isolation of the A. marginale mutant by transposon mutagenesis
To maximize chances of obtaining a transformant using transposon mutagenesis, we used a single plasmid construct that encoded both the transposon and the transposase in cis configuration as described [50], except that the fluorescent marker was replaced by sequences encoding a monomeric red fluorescent protein, mCherry[51] (Figure 1A). A. marginale bacteria passaged 53 times in ISE6 cells were harvested from one 25-cm2 culture in 5 ml of medium when ~80% of cells were infected, and many cells were undergoing lysis. The cells were recovered in 2 ml of culture medium, and added to a 2-ml microcentrifuge tube containing 0.3 ml of sterile silicon carbide abrasive (60/90 grit; Lortone, Inc), vortexed at maximum speed for 30 sec, and the lysate transferred to a fresh 2-ml tube on ice. Bacteria were collected by centrifugation at 11,000 g for 10 min at 4°C, and washed twice in ice-cold 300 mM sucrose. They were then resuspended in 50 μl of 300 mM sucrose containing 3 μg of plasmid DNA, and incubated on ice for 15 min before being electroporated (Biorad Gene Pulser II) at 2 kV, 400 Ohm and 25 μF in a 0.2 cm gap cuvette. The electroporation mixture was recovered in 1.5 ml of an ISE6 cell suspension (~2×106 cells), and centrifuged in a microcentrifuge tube at 1,000 g for 10 min at room temperature. The tube was left undisturbed for 30 min at room temperature, and the pellet then resuspended in the supernatant medium and added to a 25-cm2 flask containing ~5×106 ISE6 cells in 3 ml of L15B300 medium supplemented as described for Anaplasma-infected cultures. The culture was incubated at 34°C in a tightly capped flask. Three days after electroporation, the culture medium was replaced with 5 ml of medium additionally containing 50 μg/ml of spectinomycin and streptomycin (selection medium). Subsequently, the culture was fed twice weekly with selection medium and examined weekly on an inverted microscope (Diaphot, Nikon) fitted for epifluorescence using a Texas Red filter. The first fluorescent colonies of bacteria were noted 6 wk following electroporation, and the culture was maintained in selection medium with twice-weekly medium changes until ~90% of cells were infected. At that time, the mutant was passaged (ten-fold dilution) to fresh cells, and the remainder was stored in liquid nitrogen.
Preparation of host cell-free A. marginale wild-type and omp10::himar1 mutant from ISE6 tick cells
Isolation of A. marginale wild-type and omp10::himar1 mutant was performed by disruption of ISE6 tick cells with 1 mm diameter glass beads (BioSpec Technologies) in a Minibead beater (BioSpec technologies) as described elsewhere [52], with the exception that cells were shaken only once for 10s and immediately placed on ice. Cell lysates were transferred to 1.5 ml centrifuge tubes and centrifuged at 100 g for 5 min at 4°C to pellet cell debris. The supernatant was then carefully removed and transferred to clean 1.5 ml centrifuge tubes. A. marginale organisms (wild-type and omp10::himar1 mutant) were pelleted at 11,000 g for 10 min at 4°C, and stored at −20°C.
DNA isolation and Phi29 amplification of the A. marginale omp10::himar1 mutant
Before DNA isolation, pelleted A. marginale omp10::himar1 mutants were treated with RNaseA (QIAGEN) and DNase I (Sigma Aldrich) to remove ISE6 host cell contaminant nucleic acids. DNA isolation was performed using the QIAamp DNA Mini kit (QIAGEN) as per manufacturer’s instructions, but in this case the DNA was eluted in 50 μl of 1 mM Tris pH 9.0. DNA concentration was determined using the Qubit dsDNA HS assay kit (Life technologies) on a Qubit fluorometer (Life technologies). 5 reactions of 10 ng of DNA were used for whole genome amplification using the Genomi Phi V2 DNA amplification kit (GE Healthcare) according to manufacturer’s instructions. Following amplification, aliquots were pooled together and the DNA purified with GelElute Extraction Kit (5 PRIME) by adsorption to silica particles and eluted with 10 mM Tris pH8.2.
Genome sequencing and bioinformatics
Samples from 2.0 to 3.6 μg of amplified DNA derived from the omp10::himar1 mutant, were provided for library construction and sequencing by the Roche/454 (GS-FLX) method to the Interdisciplinary Center for Biotechnology Research (ICBR) at the University of Florida. Also, samples of equivalent amounts were provided to the Scripps Research Institute, La Jolla, California for sequencing by the Illumina (HiSeq) method.A total of 374,151 and 207,288,916 reads of Roche/454 and Illumina sequencing data, respectively, were obtained. The FASTQ files provided by the sequencing facilities were uploaded to the UF GALAXY web site http://galaxy.hpc.ufl.edu, and analyzed separately.Uploaded Illumina FASTQ files were groomed, filtered and formatted into FASTA files using the FASTQ Groomer, Filter FASTQ and FASTQ to FASTA converter tools located in the NGS: QC and manipulation toolbox of GALAXY. FASTA files were then aligned to the A. marginale str. St Maries reference genome sequence (CP000030) using the Megablast alignment tool (NCBI BLAST + blastn (version 0.0.12) in GALAXY) to obtain sequencing reads that contained A. marginale sequences.These A. marginale sequencing reads were then used for a second Megablast alignment using as a reference sequence 28 nucleotides from the Himar1 terminal inverted repeats (TIR). The transposon insertion locus within the A. marginale chromosome was then determined, since the reads obtained contained the A. marginale-Himar1 TIR junctions.A similar strategy was used for the analysis of the Roche/454 sequencing reads. CLC genomics workbench, version 6.5 was used for assemblies of Roche/454 and Illumina reads.
RNA isolation
For RNA isolation, three samples of ISE6 cells infected with A. marginale wild-type and three omp10::himar1 samples were used. Each sample derived from separate cultures grown in T-25 cell culture flasks. Samples containing approximately equal numbers of infected cells were collected in RNA stabilization reagent RNAlater (AMBION-Life technologies) and stored at −80°C. Total RNA was isolated using the RNeasy kit (QIAGEN) with an added “on-column” DNase I treatment (QIAGEN) according to manufacturer’s instructions. Aliquots of extracted RNA were used to measure contaminant DNA concentration using the Qubit dsDNA HS assay kit (Life technologies). Additionally, RNA was treated three times with RNase-free Dnase I (AMBION-Life technologies) to remove any trace of contaminant DNA in the sample. RNA concentration was measured with the Qubit RNA assay kit (Life technologies), and samples were stored at −80°C.
RT-PCR and RT-qPCR experiments
RNA (2 μg) from ISE6 cells infected with A. marginale wild-type and omp10::himar1 mutant was converted to cDNA by random priming using a Omniscript reverse transcriptase kit (QIAGEN) according to manufacturer’s conditions. Genomic DNA and no-reverse transcriptase reactions were included as controls for each sample and each nucleic acid target. Specific primers (Table 1) were designed to amplify transcripts from intergenic regions between omp7-omp8, omp8-omp9, omp9-omp10 and omp10-AM1225 using cDNA from ISE6 cells infected with A. marginale wild-type as template. Similarly transcripts from within omp6, omp7, omp8, omp9, and omp10 genes were detected by PCR amplification of cDNA from ISE6 cells infected with A. marginale wild-type and the omp10::himar1 mutant using omp6-10 specific primers (Table 1). PCR amplification conditions for each PCR experiment are described in Additional file 1: Tables S1 and S2 respectively.
Table 1
PCR and Taqman qPCR oligonucleotides used in this study
Oligonucleotide sequence (5’ to 3’)
Target
Size
Reference
PCR
AB1553
CTCCAATCGGAGGGGTTGTG
omp6
492bp
[43]
AB1554
GCATAAATCCAGTTTAGCCTCC
AB1555
GTGGTTAGATCTTTTCTGTTGGG
omp7
399bp
[43]
AB1556
CGCTCTACCACTGACCTTCATG
AB1591
GCTGGAGTTCGAAGCGATGC
omp8
259bp
This study
AB1592
CAGAGCGCCCTGTTTCAGTG
AB1559
AGCTGGGGCTCTTGCGTTTG
omp9
1096bp
[43]
AB1560
AACATATTCACTATAATCTGACGCTGC
AB1561
TCCTTCGGGTTGCTGCGTTG
omp10
969bp
[43]
AB1562
GCTTACCCCCATTCCAGCAC
AB1572
AGGATGATCAGCCACACTGGAA
16S
131bp
This study
AB1573
TACAACCCTAAGGCCTTCCTCA
**qPCR
AB1591
GCTGGAGTTCGAAGCGATGC
AB1592
CAGAGCGCCCTGTTTCAGTG
omp8
259bp
This study
AB1593
GCGTGAGCACTGCGGTACAGACGG
AB1581
GAAGTCACTACACGACCTGACTGT
AB1582
TAAAGCATCTTCGCGGGTCGT
omp9
145bp
[43]
AB1583
TATTCAGTGCGCTGAACACTGCGATCCA
AB1594
GTGGGTGCTGTACGCACATT
AB1595
AAAGACAGCAGGCAGCAACA
omp10-5'
170bp
This study
AB1596
CGCGTGTCCTTCGGGTTGCT
AB1569
GGTGCTGAGTTGAAGCTTGC
AB1570
GCCACAGACCCACTATCAGC
omp10-3'
140bp
[43]
AB1571
TATCTCGCGCTGCATCGGTG
AB1572
AGGATGATCAGCCACACTGGAA
AB1573
TACAACCCTAAGGCCTTCCTCA
16S
131bp
[42]
AB1574
TATTGGACAATGGGCGCAAGCCTGAT
AB1606
CTCACAGGCGAAGAAGCAGAC
AB1607
GCCCGACATACCTGCCTTT
msp5
145bp
[55]
AB1610
TGGGCGACAAGAAGCCAAGTGA
AB1608
ATCAAAGCTATTGCGGAGGA
AB1607
ACAGAACTCTCCCCATGCAC
rpoH
116bp
This study
AB1611
TGCCAATCGGGACGTTTCGC
AB1242
AAAACAGGCTTACCGCTCCAA
AB1243
GGCGTGTAGCTAGGCTCAAAGT
opag2
151bp
[41]
AB1250
CTCTCCTCTGCTCAGGGCTCTGCG
*Primers and TaqMan probes used were manufactured at Eurofins MGM Operon.
Oligonucleotides are labeled with 6-Carboxyfluorescein 6-FAM at the 5’ end and Tetramethylrhodamine TAMRA at the 3’ end.
PCR and Taqman qPCR oligonucleotides used in this study*Primers and TaqMan probes used were manufactured at Eurofins MGM Operon.Oligonucleotides are labeled with 6-Carboxyfluorescein 6-FAM at the 5’ end and TetramethylrhodamineTAMRA at the 3’ end.
RT-qPCR experiments
Transcript differences between omp8, omp9, omp10-5’ end, and omp10-3’ genes in A. marginale wild-type and omp10::himar1 mutant were determined using the comparative 2-∆∆Ct method [53,54] and the results were based on the mean of three biological samples (individual RNA extracts). For Taqman quantitative PCR, cDNA obtained from ISE6 cells infected with A. marginale wild-type and the omp10::himar1 was used with primers and probes (Table 1) designed to amplify omp8, omp9, omp10-5’ end, omp10-3’ end, msp5, rpoH and the 16S gene sequences. Reaction conditions are described in Additional file 1: Table S3, specificity of primers and probes is shown in Additional file 1: Figure S1 and the amplification efficiencies for each target are reported in Additional file 1: Table S4. For a valid 2-∆∆Ct calculation, relative efficiencies of target vs. reference genes were calculated and are reported in Additional file 1: Table S5.Significant differences between the A. marginale wild-type and omp10::himar1 mutant were calculated by Student’s t test (P < 0.05), comparing ∆Ct values (target gene- reference gene) of the omp10::himar1 mutant and the wild-type. The fold difference was based on ∆∆Ct (omp10::himar1 mean ∆Ct – wild-type mean ∆Ct) and calculated as 2-∆∆Ct which yields the expression ratio. The expression ratio was then expressed as percentage of expression by multiplying the 2-∆∆Ct values by 100. For normalization of relative gene expression data msp5[55], rpoH, and 16S were used as reference genes.
Western immunoblots
Expression of the Omp9 protein in A. marginale wild-type and omp10::himar1 mutant was assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting using equal amounts (108) of host-free bacteria. Membranes were incubated with three different antibodies; the anti-Omp9 monoclonal antibody (121/1055) [43], the monoclonal antibody F16C1 (reacts with the Msp5 protein and served as a loading control) [56] and the monoclonal antibody Tryp1E1 (exhibits specificity for a variable surface glycoprotein of Trypanosoma brucei) [56]. This last antibody served as a negative control. Final concentrations of each antibody used were 4 μg/ml, 2 μg/ml and 4 μg/ml. Antibody binding was detected with the secondary antibody goat anti-mouse IgG, horseradish peroxidase labeled and diluted to 1:10,000 using the Pierce ECL Western blotting substrate (Thermo scientific) as described in manufacturer’s instructions.Quantification of the number of A. marginale wild-type and omp10::himar1 organisms was performed as described elsewhere [41].
GenBank accession numbers
for assembled contigs containing the Himar1 transposon sequences integrated within omp10 and upstream genes (KJ567138) and omp10 (partial 3’ end) and omp9 genes (KJ567139).
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
FLC designed and carried out experiments, data analysis and authored this manuscript. HLW and MGP carried out tick cell media preparation, maintenance of uninfected tick cell cultures and co-authored the manuscript. AML performed Western blot experiments and co-authored the manuscript. AFB advised on experiments, genome sequencing analysis, critically evaluated and co-authored the manuscript. SMN provided monoclonal antibodies for Western blot experiments, co-authored and critically evaluated the manuscript. UM kindly provided transformed A. marginale organisms co-authored and critically evaluated the manuscript. All authors read and approved the final manuscript.
Additional file 1
RT-PCR and RT-qPCR experiments Figure and Tables.Click here for file
Authors: Tina R Clark; Amanda M Lackey; Betsy Kleba; Lonnie O Driskell; Erika I Lutter; Craig Martens; David O Wood; Ted Hackstadt Journal: J Bacteriol Date: 2011-07-15 Impact factor: 3.490
Authors: Douglas J Botkin; April N Abbott; Philip E Stewart; Patricia A Rosa; Hiroki Kawabata; Haruo Watanabe; Steven J Norris Journal: Infect Immun Date: 2006-10-02 Impact factor: 3.441
Authors: Philip E Stewart; Jessica Hoff; Elizabeth Fischer; Jonathan G Krum; Patricia A Rosa Journal: Appl Environ Microbiol Date: 2004-10 Impact factor: 4.792
Authors: Paul A Beare; Kelsi M Sandoz; Anders Omsland; Daniel D Rockey; Robert A Heinzen Journal: Front Microbiol Date: 2011-05-02 Impact factor: 5.640
Authors: Roderick F Felsheim; Michael J Herron; Curtis M Nelson; Nicole Y Burkhardt; Anthony F Barbet; Timothy J Kurtti; Ulrike G Munderloh Journal: BMC Biotechnol Date: 2006-10-31 Impact factor: 2.563
Authors: Erin E McClure; Adela S Oliva Chávez; Dana K Shaw; Jason A Carlyon; Roman R Ganta; Susan M Noh; David O Wood; Patrik M Bavoil; Kelly A Brayton; Juan J Martinez; Jere W McBride; Raphael H Valdivia; Ulrike G Munderloh; Joao H F Pedra Journal: Nat Rev Microbiol Date: 2017-06-19 Impact factor: 60.633
Authors: Francy L Crosby; Kelly A Brayton; Forgivemore Magunda; Ulrike G Munderloh; Karen L Kelley; Anthony F Barbet Journal: Appl Environ Microbiol Date: 2015-01-16 Impact factor: 4.792
Authors: Aminat T Oki; David Seidman; Michael G Lancina; Manoj K Mishra; Rangaramanujam M Kannan; Hu Yang; Jason A Carlyon Journal: Microbes Infect Date: 2015-09-11 Impact factor: 9.570
Authors: M Catherine O'Conor; Michael J Herron; Curtis M Nelson; Anthony F Barbet; F Liliana Crosby; Nicole Y Burkhardt; Lisa D Price; Kelly A Brayton; Timothy J Kurtti; Ulrike G Munderloh Journal: Pathog Dis Date: 2021-06-08 Impact factor: 3.951
Authors: Adela S Oliva Chávez; James W Fairman; Roderick F Felsheim; Curtis M Nelson; Michael J Herron; LeeAnn Higgins; Nicole Y Burkhardt; Jonathan D Oliver; Todd W Markowski; Timothy J Kurtti; Thomas E Edwards; Ulrike G Munderloh Journal: PLoS Pathog Date: 2015-11-06 Impact factor: 6.823