Literature DB >> 24714968

Candidatus Rickettsia andeanae, a spotted fever group agent infecting Amblyomma parvum ticks in two Brazilian biomes.

Fernanda Aparecida Nieri-Bastos1, Marcos Gomes Lopes1, Paulo Henrique Duarte Cançado2, Giselle Ayres Razera Rossa1, João Luiz Horácio Faccini3, Solange Maria Gennari1, Marcelo Bahia Labruna1.   

Abstract

Adult ticks of the species Amblyomma parvum were collected from the vegetation in the Pantanal biome (state of Mato Grosso do Sul) and from horses in the Cerrado biome (state of Piauí) in Brazil. The ticks were individually tested for rickettsial infection via polymerase chain reaction (PCR) targeting three rickettsial genes, gltA, ompA and ompB. Overall, 63.5% (40/63) and 66.7% (2/3) of A. parvum ticks from Pantanal and Cerrado, respectively, contained rickettsial DNA, which were all confirmed by DNA sequencing to be 100% identical to the corresponding fragments of the gltA, ompA and ompB genes of Candidatus Rickettsia andeanae. This report is the first to describe Ca. R. andeanae in Brazil.

Entities:  

Mesh:

Year:  2014        PMID: 24714968      PMCID: PMC4015251          DOI: 10.1590/0074-0276140283

Source DB:  PubMed          Journal:  Mem Inst Oswaldo Cruz        ISSN: 0074-0276            Impact factor:   2.743


The bacterial genus Rickettsia (Rickettsiales: Rickettsiaceae) includes Gram-negative coccobacilli organisms in obligatory associations with eukaryote cells. A number of Rickettsia species genetically classified into the spotted fever group (SFG) are agents of tick-borne diseases in the world (Parola et al. 2005). In Brazil, the most important SFG agents are Rickettsia rickettsii, the causative agent of Brazilian spotted fever, which is the most deadly rickettsiosis globally (Guedes et al. 2005, Labruna 2009), and the strain Atlantic rainforest, an Rickettsia parkeri- like agent that was only recently shown to cause spotted fever in humans (Spolidorio et al. 2010, Silva et al. 2011). Other tick-associated rickettsiae , namely Rickettsia rhipicephali, Rickettsia amblyommii, Rickettsia monteiroi and Rickettsia bellii, have also been reported in Brazil, but have not been associated with human illness (reviewed by Labruna et al. 2011). It is noteworthy that during the last three decades, approximately 10 SFG Rickettsia species or subspecies previously known to infect only ticks were further identified as emerging agents of tick-borne rickettsioses throughout the world (Parola et al. 2005, Shapiro et al. 2010). An outstanding example is R. parkeri, which has been known to infect Amblyomma ticks for more than 60 years, but was recognised as a human pathogen only during the last 10 years (Paddock et al. 2004). Based on these findings, it is prudent to consider any new tick-associated Rickettsia species as a potential human pathogen until further studies are conducted. The tick species Amblyomma parvum is distributed from southern Mexico to Argentina (Guglielmone et al. 2003). While the A. parvum adult stage has a preference for parasitising medium to large-sized mammals (ruminants, horses and carnivores), larvae and nymphs seem to prefer small mammals (Aragão 1936, Nava et al. 2008). Recent studies in Argentina and Brazil have indicated that rodents of the genera Galea and Trichomys are important hosts for A. parvum sub-adults (Nava et al. 2008, Horta et al. 2011). Of note, the A. parvum adult stage is an important human-biting tick in Argentina and Brazil ( Guglielmone et al. 2006); therefore, it is a potential pathogen vector for humans. To evaluate rickettsial infection in A. parvum ticks from Brazil, tick specimens were collected in two Brazilian biomes. In the Pantanal biome, free-living ticks were collected by CO 2 traps set on the vegetation in the Nhumirim Farm (18º59′S 56º39′W) at the Nhecolândia Pantanal, state of Mato Grosso do Sul, central-western Brazil, from March 2006-January 2007, as detailed previously (Cançado et al. 2008). In the Cerrado biome, ticks were collected from horses on a farm (04º76’91’’S 42º58’44’’W) in the municipality of Teresina, state of Piauí (PI), northeastern Brazil, during August 2010. The ticks were preserved in absolute ethanol until they were processed in the laboratory. Each adult A. parvum tick was subjected to DNA extraction by the guanidine isothiocyanate-phenol technique, as previously described (Sangioni et al. 2005). Purified DNA was stored at -20ºC until it was used as template for polymerase chain reaction (PCR) amplifications. Five microlitres of each tick DNA template (approximately 500 ng of DNA) was used for PCR using the primers CS-78 (forward) GCAAGTATCGGTGAGGATGTAAT and CS-323 (reverse) GCTTCCTTAAAATTCAATAAATCAGGAT, which amplify a 398-bp fragment of the citrate synthase gene (gltA) of, most likely, all known Rickettsia species (Labruna et al. 2004). If an expected product was observed following gel electrophoresis, the tick was tested using two other PCR protocols: one targeting a fragment of the rickettsial 190-kDa outer membrane protein gene (ompA) using primers Rr190.70F ATGGCGAATATTTCTCCAAAA and Rr190.701R GTTCCGTTAATGGCAGCATCT (Eremeeva et al. 2006) and the other targeting a fragment of the rickettsial 135-kDa outer membrane protein gene (ompB) using primers 120-M59 CCGCAGGGTTGGTAACTGC and 120-807 CCTTTTAGATTACCGCCTAA (Roux & Raoult 2000). Ten microlitres of each PCR product was electrophoretically separated in a 1.5% agarose gel stained with ethidium bromide and examined using ultraviolet transillumination. PCR products compatible with the expected band size were purified using ExoSap (USB Corporation, Cleveland, OH, USA) and sequenced in an automated sequencer (model ABI Prism 310 Genetic, Applied Biosystems, Perkin Elmer, CA, USA) according to the manufacturer’s protocol. The partial sequences that were obtained were subjected to BLAST analyses (ncbi.nlm.nih.gov/blast) to determine the closest similarities to other Rickettsia species available in GenBank. Sixty-three (37 males, 26 females) out of 81 A. parvum adult specimens collected from the vegetation in the Pantanal were tested in this study. From the Cerrado area of PI, 3 A. parvum specimens (2 males, 1 female) were collected from three out of 27 examined horses; other tick species (not tested in this study) collected from these horses were Amblyomma cajennense (8 adults) and Dermacentor nitens (570 adults). The gltA -PCR indicated that 40 (63.5%) A. parvum specimens (20 males, 20 females) from Pantanal and two A. parvum males (66.7%) from PI were infected by Rickettsia. From these 42 gltA- PCR positive ticks, 23 were positive in the ompA -PCR and 17 were also positive in the ompB- PCR. High-quality DNA sequences were obtained from 19 gltA- positive ticks, 12 ompA -positive ticks and 11 ompB -positive ticks, including the two males from PI. For each rickettsial gene, the sequences from different individual ticks were identical to each other and were also 100% identical to the corresponding sequences of Candidatus Rickettsia andeanae from the United States of America (USA), Peru and Argentina, (e.g., GU169051, EF451001 for gltA; EU826513, EF372578 for ompA; GU395297, EF451003 for ompB) when submitted to BLAST analyses. The sequences generated in this study have been submitted to GenBank under the accessions KF030931-KF030933. This study reports the identification of the SFG rickettsial agent Ca. R. andeanae for the first time in Brazil. Taxonomic identification of the agent was confirmed by sequencing fragments of one conserved housekeeping gene (gltA) and two highly polymorphic outer membrane protein genes (ompA and ompB). Among the 42 ticks that were PCR-positive for the gltA gene, only 23 were positive in the ompA -PCR and 17 in the ompB- PCR. Because fragments of approximately 398, 630 and 820 bp were targeted by the gltA, ompA and ompB- PCR protocols, respectively, the different results obtained with these protocols are possibly related to different PCR sensitivities, as it is well known that the shorter the PCR fragment, the more efficient the PCR reaction (Bustin 2000). Ca. R. andeanae has been reported to infect ticks in Peru, USA, Argentina and Chile (Blair et al. 2004, Pacheco et al. 2007, Paddock et al. 2010, Abarca et al. 2012). More recently, Luce-Fedrow et al. (2012) and Ferrari et al. (2013) reported evidence for the continuous in vitro cultivation of Ca. R. andeanae. A number of different tick species have been reported to harbour Ca. R. andeanae in nature. These species include Amblyomma maculatum, Ixodes boliviensis and Rhipicephalus sanguineus in Peru (Blair et al. 2004, Flores-Mendoza et al. 2013), A. maculatum in USA (Paddock et al. 2010, Luce-Fedrow et al. 2012), A. parvum and Amblyomma pseudoconcolor in Argentina (Pacheco et al. 2007, Tomassone et al. 2010) and Amblyomma triste in Chile (Abarca et al. 2012). According to these references, different designations have been given to Ca. R. andeanae, such as Rickettsia sp. strain Argentina or the rickettsial endosymbiont of A. maculatum. Because the DNA sequences representing these different designations were 100% identical to each other, they are all considered to represent Ca. R. andeanae (Paddock et al. 2010, Luce-Fedrow et al. 2012, Ferrari et al. 2013), which was first reported in Peru by Blair et al. (2004). Because Ca R. andeanae-infected ticks were found in distant areas of two Brazilian biomes, it is possible that the distribution of this organism within Brazil is much broader than is reported here. The majority of the ticks in this study were infected with Ca. R. andeanae. This finding is in accordance with previous studies that reported that most of the A. parvum ticks from Argentina (69.2%) were infected with Ca. R. andeanae. However, infection rates by this agent among A. maculatum ticks in USA have been much lower, usually between 1-10% (Paddock et al. 2010, Jiang et al. 2012). Regardless, the role of Ca. R. andeanae as a human pathogen is unknown. Because A. parvum is an important human-biting tick in South America (Guglielmone et al. 2006), further studies are needed to evaluate the capacity of Ca. R. andeanae to be tick transmitted and to infect humans or other vertebrate hosts.
  24 in total

1.  Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB).

Authors:  V Roux; D Raoult
Journal:  Int J Syst Evol Microbiol       Date:  2000-07       Impact factor: 2.747

2.  Isolation and identification of Rickettsia massiliae from Rhipicephalus sanguineus ticks collected in Arizona.

Authors:  Marina E Eremeeva; Elizabeth A Bosserman; Linda J Demma; Maria L Zambrano; Dianna M Blau; Gregory A Dasch
Journal:  Appl Environ Microbiol       Date:  2006-08       Impact factor: 4.792

Review 3.  Tick- and flea-borne rickettsial emerging zoonoses.

Authors:  Philippe Parola; Bernard Davoust; Didier Raoult
Journal:  Vet Res       Date:  2005 May-Jun       Impact factor: 3.683

4.  Characterization of spotted fever group rickettsiae in flea and tick specimens from northern Peru.

Authors:  Patrick J Blair; Ju Jiang; George B Schoeler; Cecilia Moron; Elizabeth Anaya; Manuel Cespedes; Christopher Cruz; Vidal Felices; Carolina Guevara; Leonardo Mendoza; Pablo Villaseca; John W Sumner; Allen L Richards; James G Olson
Journal:  J Clin Microbiol       Date:  2004-11       Impact factor: 5.948

Review 5.  Ticks (Ixodidae) on humans in South America.

Authors:  A A Guglielmone; L Beati; D M Barros-Battesti; M B Labruna; S Nava; J M Venzal; A J Mangold; M P J Szabó; J R Martins; D González-Acuña; A Estrada-Peña
Journal:  Exp Appl Acarol       Date:  2006-11-14       Impact factor: 2.132

6.  Detection of Rickettsia rickettsii in the tick Amblyomma cajennense in a new Brazilian spotted fever-endemic area in the state of Minas Gerais.

Authors:  Elizângela Guedes; Romário C Leite; Márcia C A Prata; Richard C Pacheco; David H Walker; Marcelo B Labruna
Journal:  Mem Inst Oswaldo Cruz       Date:  2006-01-20       Impact factor: 2.743

7.  Rickettsia parkeri: a newly recognized cause of spotted fever rickettsiosis in the United States.

Authors:  Christopher D Paddock; John W Sumner; James A Comer; Sherif R Zaki; Cynthia S Goldsmith; Jerome Goddard; Susan L F McLellan; Cynthia L Tamminga; Christopher A Ohl
Journal:  Clin Infect Dis       Date:  2004-03-01       Impact factor: 9.079

8.  Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic.

Authors:  Marcelo B Labruna; Ted Whitworth; Maurício C Horta; Donald H Bouyer; Jere W McBride; Adriano Pinter; Vsevolod Popov; Solange M Gennari; David H Walker
Journal:  J Clin Microbiol       Date:  2004-01       Impact factor: 5.948

9.  Isolation of "Candidatus Rickettsia andeanae" (Rickettsiales: Rickettsiaceae) in embryonic cells of naturally infected Amblyomma maculatum (Ixodida: Ixodidae).

Authors:  F A G Ferrari; J Goddard; G M Moraru; W E C Smith; A S Varela-Stokes
Journal:  J Med Entomol       Date:  2013-09       Impact factor: 2.278

10.  Rickettsial infection in animals and Brazilian spotted fever endemicity.

Authors:  Luis A Sangioni; Maurício C Horta; Manoella C B Vianna; Solange M Gennari; Rodrigo M Soares; Márcio A M Galvão; Teresinha T S Schumaker; Fernando Ferreira; Odilon Vidotto; Marcelo B Labruna
Journal:  Emerg Infect Dis       Date:  2005-02       Impact factor: 6.883

View more
  12 in total

1.  High prevalence of "Candidatus Rickettsia andeanae" and apparent exclusion of Rickettsia parkeri in adult Amblyomma maculatum (Acari: Ixodidae) from Kansas and Oklahoma.

Authors:  Christopher D Paddock; Amy M Denison; Michael W Dryden; Bruce H Noden; R Ryan Lash; Sarah S Abdelghani; Anna E Evans; Aubree R Kelly; Joy A Hecht; Sandor E Karpathy; Roman R Ganta; Susan E Little
Journal:  Ticks Tick Borne Dis       Date:  2015-03-13       Impact factor: 3.744

2.  Detection of Rickettsia spp. in ticks parasitizing toads (Rhinella marina) in the northern Brazilian Amazon.

Authors:  Hermes Ribeiro Luz; Ercileide Silva-Santos; Carlos Eduardo Costa-Campos; Igor Acosta; Thiago F Martins; Sebástian Muñoz-Leal; Douglas McIntosh; João Luis Horacio Faccini; Marcelo B Labruna
Journal:  Exp Appl Acarol       Date:  2018-05-30       Impact factor: 2.132

3.  In vitro efficacy of Metarhizium anisopliae sensu lato against unfed Amblyomma parvum (Acari: Ixodidae).

Authors:  Marcos Valerio Garcia; Vinicius da Silva Rodrigues; Antônio Carlos Monteiro; Lucas Detogni Simi; Leandro de Oliveira Souza Higa; Maria Marlene Martins; Nancy Prette; Dinalva Alves Mochi; Renato Andreotti; Matias Pablo Juan Szabó
Journal:  Exp Appl Acarol       Date:  2018-11-12       Impact factor: 2.132

4.  Ticks and rickettsial infection in the wildlife of two regions of the Brazilian Amazon.

Authors:  Herbert S Soares; Amália R M Barbieri; Thiago F Martins; Antonio H H Minervino; Júlia T R de Lima; Arlei Marcili; Solange M Gennari; Marcelo B Labruna
Journal:  Exp Appl Acarol       Date:  2014-10-02       Impact factor: 2.132

5.  Bacteria of the genera Ehrlichia and Rickettsia in ticks of the family Ixodidae with medical importance in Argentina.

Authors:  Patrick S Sebastian; Evelina L Tarragona; María N Saracho Bottero; Atilio J Mangold; Ute Mackenstedt; Santiago Nava
Journal:  Exp Appl Acarol       Date:  2016-11-03       Impact factor: 2.132

6.  Diversity of ticks and detection of Rickettsia amblyommatis infecting ticks on wild birds in anthropogenic landscapes in Bahia state, northeast Brazil.

Authors:  Josiane M Rocha; Philipe B de Oliveira; Thiago F Martins; João Luiz H Faccini; Anaiá P Sevá; Hermes R Luz; George R Albuquerque
Journal:  Exp Appl Acarol       Date:  2021-04-23       Impact factor: 2.132

7.  Molecular characterization of Rickettsia spp., Bartonella spp., and Anaplasma phagocytophilum in hard ticks collected from wild animals in Benin, West Africa.

Authors:  Roland Eric Yessinou; Safiou Adehan; Georges Codjo Hedegbetan; Rudi Cassini; Samuel Elias Mantip; Souaïbou Farougou
Journal:  Trop Anim Health Prod       Date:  2022-09-16       Impact factor: 1.893

8.  Detection of Rickettsia spp. in ticks associated to wild mammals in Northeastern Brazil, with notes on an undetermined Ornithodoros sp. collected from marsupials.

Authors:  Maerle O Maia; Valdinei C Koppe; Sebastián Muñoz-Leal; Thiago F Martins; Arlei Marcili; Marcelo B Labruna; Richard Campos Pacheco
Journal:  Exp Appl Acarol       Date:  2018-11-15       Impact factor: 2.132

9.  Detection of Rickettsia bellii and Rickettsia amblyommii in Amblyomma longirostre (Acari: Ixodidae) from Bahia state, Northeast Brazil.

Authors:  Douglas McIntosh; Rodrigo Alves Bezerra; Hermes Ribeiro Luz; João Luiz Horacio Faccini; Fernanda Amato Gaiotto; Gastón Andrés Fernandez Giné; George Rego Albuquerque
Journal:  Braz J Microbiol       Date:  2015-07-01       Impact factor: 2.476

10.  Rickettsia amblyommatis infecting ticks and exposure of domestic dogs to Rickettsia spp. in an Amazon-Cerrado transition region of northeastern Brazil.

Authors:  Francisco B Costa; Andréa P da Costa; Jonas Moraes-Filho; Thiago F Martins; Herbert S Soares; Diego G Ramirez; Ricardo A Dias; Marcelo B Labruna
Journal:  PLoS One       Date:  2017-06-08       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.