Literature DB >> 24705103

Gene Expressions for Signal Transduction under Acidic Conditions.

Toshihiko Fukamachi1, Syunsuke Ikeda2, Xin Wang3, Hiromi Saito4, Masatoshi Tagawa5, Hiroshi Kobayashi6.   

Abstract

Although it is now well known that some diseased areas, such as cancer nests, inflammation loci, and infarction areas, are acidified, little is known about cellular signal transduction, gene expression, and cellular functions under acidic conditions. Our group showed that different signal proteins were activated under acidic conditions compared with those observed in a typical medium of around pH 7.4 that has been used until now. Investigations of gene expression under acidic conditions may be crucial to our understanding of signal transduction in acidic diseased areas. In this study, we investigated gene expression in mesothelioma cells cultured at an acidic pH using a DNA microarray technique. After 24 h culture at pH 6.7, expressions of 379 genes were increased more than twofold compared with those in cells cultured at pH 7.5. Genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors numbered 35, 32, and 17 among the 379 genes, respectively. Since the functions of 78 genes are unknown, it can be argued that cells may have other genes for signaling under acidic conditions. The expressions of 37 of the 379 genes were observed to increase after as little as 2 h. After 24 h culture at pH 6.7, expressions of 412 genes were repressed more than twofold compared with those in cells cultured at pH 7.5, and the 412 genes contained 35, 76, and 7 genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors, respectively. These results suggest that the signal pathways in acidic diseased areas are different, at least in part, from those examined with cells cultured at a pH of around 7.4.

Entities:  

Year:  2013        PMID: 24705103      PMCID: PMC3899954          DOI: 10.3390/genes4010065

Source DB:  PubMed          Journal:  Genes (Basel)        ISSN: 2073-4425            Impact factor:   4.096


1. Introduction

In mammals, the pH values of blood and tissues are usually maintained in a narrow range around 7.4 [1]. In contrast, diseased areas, such as cancer nests, inflammatory loci, and infarction areas, have been found to be acidic. The extracellular pH in the central regions of tumors decreases below 6.7 in several tumors as a consequence of lactate accumulation derived from a lack of sufficient vascularization or an increase in tumor-specific glycolysis under aerobic conditions combined with impaired mitochondrial oxidative phosphorylation [1,2,3]. Extracellular pH may also drop to a value below 6 due to leaking of intracellular contents and the destruction of blood vessels resulting in hypoxic metabolism and related lactic acid production during inflammation against the infection of pathogens [4]. Similar acidic environments were also associated with other inflammation. The pH value of articular fluid in the rheumatoid human knee joint was around 6.6, compared to around 7.3 in normal knee joints [5]. Other studies also showed the acidification of synovial fluid in arthritis [6,7,8]. Although cell functions mediated by a large number of enzymes with pH-dependent catalytic activity are strongly affected by the disruption of pH homeostasis, there have been only a few studies of signal transduction, gene expression, and cellular functions under acidic conditions. Studies of Escherichia coli have suggested that this bacterium has multiple systems for a single function and that different systems having optimum activities at different pH values function under different pH conditions [9,10]. Our group previously found that different signal transduction pathways function under acidic environments [11,12], and that CTIB, an IκB-β variant, acted as a critical factor at pH 6.3 but not at pH 7.4 [13,14]. Our group also showed the elevated activation of p38 and ERK in human T cells cultured at acidic pH [12,15]. In addition to these reports by our group, activation of the MAPK pathways and increased COX-2 protein expression were reported in acid exposed cells in Barrett’s metaplasia [16]. Matrix metalloproteinase-9 (MMP-9) expression was induced at acidic extracellular pH in mouse metastatic melanoma cells through phospholipase D-mitogen-activated protein kinase signaling [17]. Carbonic anhydrase 9 (CA9) expression was increased by acidosis via a hypoxia-independent mechanism that operates through modulation of the basic CA9 transcriptional machinery [18]. The gene expression of VEGF was stimulated at low extracellular pH [19,20]. Glioma stem cells grown in low pH conditions displayed an increase in expressions of Olig2, Oct4, Nanog, interleukin-8 (IL-8), TIMP1, TIMP2, VEGF, Glut1, SerpinB9, and HIF2α, whereas expressions of Sox2, GFAP, and HIF1α were repressed in the cells [21]. The expression of HIF1α induced by hypoxia was decreased by acidosis and the expression of ATF4 was increased by the combination of acidosis with hypoxia [22]. These previous findings led us to assume that different signal pathways operate under acidic conditions in mammalian cells. In addition to the molecules reported in previous studies described above, numerous molecules may work preferentially under low pH conditions. To exhaustively identify genes working for cell proliferation under acidic conditions, we used cancer cells that were able to proliferate rapidly and investigated the gene expression in mesothelioma cells cultured at acidic pH using a DNA microarray technique in the present study. After 24 h culture at pH 6.7, expressions of 379 genes were increased more than twofold compared with those in cells cultured at pH 7.5. The 379 genes contained 84 genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors, suggesting that the signal pathways in acidic diseased areas are different, at least in part, from those examined with cells cultured at pH around 7.4. The identified genes may be potential candidates for cancer chemotherapeutics. After 24 h culture at pH 6.7, expressions of 412 genes were repressed more than twofold compared with those in cells cultured at pH 7.5, and genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors numbered 118 among the 412 genes.

2. Materials and Methods

2.1. Cells and Medium for Their Maintenance

Human mesothelial cell line H2052, human colon adenocarcinoma grade II cell line HT-29, human esophageal cancer cell line TE-11, human pancreatic ductal adenocarcinoma cell line BxPC3, and human hepatocellular carcinoma cell line HepG2 were used. For cell maintenance, cells were cultured in RPMI-1640 (WAKO) containing 10 μg/mL gentamicin (Sigma), 1 μg/mL fungizone (Bristol-Myers), and 10% FBS (Sigma) in the presence of 5% CO2 at 37 °C.

2.2. Cell Culture under Different pH Conditions

Media for cell culture at various pH values were prepared as follows. To minimize the pH change during the cell culture, 10 mM PIPES [piperazine-N,N'-bis(ethanesulfonic acid)] for acidic media or HEPES [4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid] for alkaline media was added to RPMI-1640 instead of NaHCO3. Medium containing fetal bovine serum (FBS) was often contaminated with germs when the medium pH was adjusted, and it was hard to sterilize medium containing FBS. Therefore, medium pH was first adjusted by the addition of NaOH to 6.3 and 7.6 before the addition of FBS. After sterilization of the medium by filtration, FBS was added. The medium pH values were changed into 6.7 and 7.5 by the addition of FBS, respectively. Cells were cultured at 37 °C without a CO2 supply but with an air supply to avoid hypoxia and constant humidity.

2.3. DNA Microarray

After H2052 cells had been cultured in pH 7.5 medium as described above for 24 h at 37 °C, the medium was exchanged for pH 6.7 medium, and cells were cultured at 37 °C for 2, 5, and 24 h. Total RNA was isolated with the use of a TRI reagent (Sigma) according to the manufacturer’s instructions, and microarray analysis was entrusted to Roche Diagnostics Corporation using the Roche NimbleGen Microarray A4487001-00-01. In order to compare, data were processed using the NimbleScan software that was developed based on previous papers [23,24].

2.4. Real-Time Quantitative Polymerase Chain Reaction (PCR)

Total RNA (1 µg) prepared as described above was reverse-transcribed using ReverTra Ace (TOYOBO) in a total volume of 20 µL containing the random primer for 18S rRNA or the polyT primer for targeted genes. Real-time quantitative PCR amplification was performed with an ABI Prism 7000 Sequence Detection System (Applied Biosystems) using the FastStart Universal SYBR Green Master[Rox] (Roche Diagnostics) according to the manufacturer’s instructions. The PCR reaction was carried out with a mixture containing 12.5 µL of Real-Time PCR Master Mix, 7.5 µM of each sense and antisense primer, 25 ng of cDNA, and nuclease-free water in a total volume of 25 µL. The standard thermal profile for PCR amplification was 50 °C for 2 min, 95 °C for 10 min, and 40 cycles of 95 °C for 15 s and 60 °C for 60 s. The primers used are shown in Table 1.
Table 1

Primers used in this study.

Gene nameSequence
18S rRNAF;TAGAGTGTTCAAAGCAGGCCC
R;CCAACAAATAGAACCGCGGT
IL-32F;TCAAAGAGGGCTACCTGGAG
R;TTTCAAGTAGAGGAGTGAGCTCTG
ATP6V0D2F;GACCCAGCAAGACTATATCAACC
R;TGGAGATGAATTTTCAGGTCTTC
TNFRSF9F;AAACGGGGCAGAAAGAAACT
R;CTTCTGGAAATCGGCAGCTA
AREGF;GGGAGTGAGATTTCCCCTGT
R;AGCCAGGTATTTGTGGTTCG
DMGDHF;GAGCTCACGGCTGGATCTAC
R;CCACCACCTGACCAGTTTCT
ERBB3F;TGCAGTGGATTCGAGAAGTG
R;GGCAAACTTCCCATCGTAGA

18S rRNA, 18S ribosomal ribonucleic acid; IL-32, interleukin 32; ATP6V0D2, V0 subunit d2 of lysosomal H+ transporting ATPase; TNFRSF9, tumor necrosis factor receptor superfamily member 9; AREG, amphiregulin; DMGDH, dimethylglycine dehydrogenase; ERBB3, erythroblastic leukemia viral oncogene homolog 3.

It has been reported that the content of ribosomes per cell is approximately 4 × 106 [25], and the amount of mRNA per cell can be estimated using 18S rRNA as a control RNA with the following equation. 4 × 10 where Ct is the threshold cycle number. Primers used in this study. 18S rRNA, 18S ribosomal ribonucleic acid; IL-32, interleukin 32; ATP6V0D2, V0 subunit d2 of lysosomal H+ transporting ATPase; TNFRSF9, tumor necrosis factor receptor superfamily member 9; AREG, amphiregulin; DMGDH, dimethylglycine dehydrogenase; ERBB3, erythroblastic leukemia viral oncogene homolog 3.

2.5. Other Reagents

Taq DNA polymerase (Bio Academia) and Ribonuclease inhibitor (TOYOBO) were used.

2.6. Statistical Analysis

The Student’s t-test was utilized in this study.

3. Results

3.1. Highly Expressed Genes under Acidic Conditions in Mesothelioma Cells

Approximately 24,000 genes were examined by microarray in mesothelioma cells (supplementary table), and the expressions of 379 genes were elevated more than twofold in cells cultured at pH 6.7 for 24 h compared with the cells cultured at pH 7.5 (Table 2). The accuracy of microarray analysis is mainly dependent on the RNA preparation. When the copy number of mRNA was low, the standard deviations of real-time quantitative PCR were close to 50% (Figure 1). We therefore assumed that more than twofold changes were significant in the present study. The 379 genes contained 35, 32, and 17 genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors, respectively (Table 2). The functions of 78 genes among the 379 genes are unknown.
Table 2

Genes whose expression was induced more than twofold after 2, 5, and 24 h culture at acidic pH.

Gene2 h5 h24 h
number of genes260175379
receptors292235
signal proteins 1252132
cytokines 251017

1 including transcription factors; 2 including growth factors.

Figure 1

Gene expressions of IL-32, TNFRSF9, AREG, ERBB3, ATP6V0D2, and DMGDH at pH 7.5 and 6.7 in TE-11 cells. TE-11 cells were incubated at pH 7.5 (open bars) and 6.7 (closed bars) for 24 h. mRNA number per one cell was detected with real-time quantitative PCR. Calculation is described in Materials and Methods. The mean values and standard deviations obtained from three independent experiments are represented. P values were calculated as described in Materials and Methods.

Genes whose expression was induced more than twofold after 2, 5, and 24 h culture at acidic pH. 1 including transcription factors; 2 including growth factors. Gene expressions of IL-32, TNFRSF9, AREG, ERBB3, ATP6V0D2, and DMGDH at pH 7.5 and 6.7 in TE-11 cells. TE-11 cells were incubated at pH 7.5 (open bars) and 6.7 (closed bars) for 24 h. mRNA number per one cell was detected with real-time quantitative PCR. Calculation is described in Materials and Methods. The mean values and standard deviations obtained from three independent experiments are represented. P values were calculated as described in Materials and Methods. The expressions of IL-8 [21], MMP-9 [17], VEGF [19,20,21], CA9 [18], and COX-2 [16] were reported to increase under acidic stress. Our present results showed that the ratios of the expressions of IL-8, MMP-9, and VEGF in cells cultured at pH 6.7 to those at pH 7.5 were 2.52, 1.90, and 1.12, respectively. The expression of CA9 increased 1.35-fold at pH 6.7, but COX-2 expression was decreased at pH 6.7. It was reported that MnSOD participates in metastasis [26], and our data showed that the increase in the expression of MnSOD at acidic pH was 1.70-fold. The previous reports by our group showed that p38 and ERK were activated more strongly at acidic pH than at alkaline pH [12,15]. The present data showed that p38-α (MAPK14) expression increased 1.71-fold after 5 h culture at pH 6.7, but decreased after 24 h culture at pH 6.7 (supplementary table), suggesting that p38-α is up-regulated for a short time after cells have been stressed by acidosis. The expressions of p38-γ (MAPK12) and ERK1 increased only 1.29-fold at pH 6.7. The expressions of other p38 and ERK families decreased slightly at acidic pH.

3.2. Gene Expression after Culture for a Short Period at pH 6.7

The gene expressions were also examined after 2 and 5 h at pH 6.7, and genes whose expression was increased were classified into seven groups as shown in Table 3. The expressions of 260 genes increased more than twofold in cells cultured at pH 6.7 for 2 h compared with pH 7.5. The 260 genes contained 29, 25, and 5 genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors, respectively (Table 2). The expressions of 15 among the 260 genes maintained high levels more than twofold for 24 h (Table 3, group A), while the expressions of 223 among the 260 genes decreased again after 24 h (Table 3, groups E and G). The 191 genes were expressed at a high level only at 2 h after the pH shift to 6.7 (Table 3, group G). After 5 h culture at pH 6.7, 175 genes were expressed more than twofold higher than the expression levels at pH 7.5 (Table 2), and the 91 genes were expressed at a high level only at 5 h after acidic stress (Table 3, group F). Genes encoding proteins for signal pathways among the genes whose expression was increased at acidic pH are listed in Table 4.
Table 3

Classification of genes whose expression was induced at acidic pH.

GroupExpression level *Number of genes
2 h5 h24 hTotalSignal **
A>2>2>2157
B>2<=2>2223
C<=2>2>2378
D<=2<=2>230566
E>2>2<=2326
F<=2>2<=29132
G>2<=2<=219143
total693165

* ratio of the expression in cells cultured at pH 6.7 to those at pH 7.5; ** genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors.

Table 4

Genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors whose expression was high at pH 6.7.

GeneRatio *Accession numberDescription
Group A
RSPO37.346NM_032784R-spondin 3 homolog (Xenopus laevis)
IL323.711NM_001012631interleukin 32
TAS2R393.035 NM_176881taste receptor, type 2, member 39
SLAMF82.751 NM_020125SLAM family member 8
TRAF12.644 NM_005658TNF receptor-associated factor 1
IL82.519 NM_000584interleukin 8
RAB33A2.356 NM_004794RAB33A, member RAS oncogene family
Group B
LOC5531584.306 NM_181334PRR5-ARHGAP8 fusion
PPP1R3E3.702 XM_927029protein phosphatase 1, regulatory (inhibitor) subunit 3E
BDKRB22.168 NM_000623bradykinin receptor B2
Group C
TNFRSF95.464 NM_001561tumor necrosis factor receptor superfamily, member 9
FGF73.219 NM_002009fibroblast growth factor 7 (keratinocyte growth factor)
ZNF2262.926 NM_015919zinc finger protein 226
MGC173302.755 NM_052880HGFL gene
IL1RAP2.551 NM_134470interleukin 1 receptor accessory protein
NFKBIZ2.159 NM_001005474nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor, ζ
OLR12.054 NM_002543oxidized low density lipoprotein (lectin-like) receptor 1
TRIB32.031 NM_021158tribbles homolog 3 (Drosophila)
Group D
ERBB35.997 NM_001982v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
AREG5.650 NM_001657amphiregulin (schwannoma-derived growth factor)
LOC6531934.485 XM_926448similar to Amphiregulin precursor (AR) (Colorectum cell-derived growth factor) (CRDGF)
RARRES13.882 NM_002888retinoic acid receptor responder (tazarotene induced) 1
RRAD3.827 NM_004165Ras-related associated with diabetes
CRELD13.707 NM_001031717cysteine-rich with EGF-like domains 1
ARHGAP83.547 NM_001017526Rho GTPase activating protein 8
GPR783.302 NM_080819G protein-coupled receptor 78
GDF153.112 NM_004864growth differentiation factor 15
PTP4A33.037 NM_007079protein tyrosine phosphatase type IVA, member 3
IL162.926 NM_004513interleukin 16 (lymphocyte chemoattractant factor)
PAQR62.919 NM_198406progestin and adipoQ receptor family member VI
OR52N42.915 NM_001005175olfactory receptor, family 52, subfamily N, member 4
OR56B12.913 NM_001005180olfactory receptor, family 56, subfamily B, member 1
PTPRQ2.834 XM_926134protein tyrosine phosphatase, receptor type, Q
LOC4399572.784 XM_495805similar to Ig κ chain V-I region Walker precursor
TNFSF92.744 NM_003811tumor necrosis factor (ligand) superfamily, member 9
TNFSF72.714 NM_001252tumor necrosis factor (ligand) superfamily, member 7
GPR872.641 NM_023915G protein-coupled receptor 87
Group D
GTF2IRD2B2.609 NM_001003795general transcription factor 21 repeat domain containing 2β
RGS72.573 NM_002924regulator of G-protein signalling 7
FOLR32.506 NM_000804folate receptor 3 (γ)
RELB2.471 NM_006509v-rel reticuloendotheliosis viral oncogene homolog B, nuclear factor of κ light polypeptide gene enhancer in B-cells 3 (avian)
TAS2R402.459 NM_176882taste receptor, type 2, member 40
CCL3L32.418 NM_001001437chemokine (C-C motif) ligand 3-like 3
GPR1442.391 NM_182611G protein-coupled receptor 144
RND12.389 NM_014470Rho family GTPase 1
CD62.381 NM_006725CD6 molecule
ZNF1652.368 NM_003447zinc finger protein 165
ICHTHYIN2.353 XM_371777ichthyin protein
PKD1L12.334 NM_138295polycystic kidney disease 1 like 1
NPHP12.318 NM_207181nephronophthisis 1 (juvenile)
PTK62.312 NM_005975PTK6 protein tyrosine kinase 6
IL15RA2.282 NM_002189interleukin 15 receptor, α
POU6F12.271 NM_002702POU domain, class 6, transcription factor 1
TNFRSF10C2.268 NM_003841tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain
IL152.248 NM_172175interleukin 15
P2RY122.233 NM_176876purinergic receptor P2Y, G-protein coupled, 12
MST12.186 NM_020998macrophage stimulating 1 (hepatocyte growth factor-like)
KDR2.184 NM_002253kinase insert domain receptor (a type III receptor tyrosine kinase)
GPR682.174 NM_003485G protein-coupled receptor 68
GPR442.170 NM_004778G protein-coupled receptor 44
RAI172.162 NM_020338retinoic acid induced 17
OR10V12.156 NM_001005324olfactory receptor, family 10, subfamily V, member 1
ASB12.148 NM_016114ankyrin repeat and SOCS box-containing 1
CMTM12.146 NM_181293CKLF-like MARVEL transmembrane domain containing 1
PHF72.141 NM_173341PHD finger protein 7
GPRC5D2.114 NM_018654G protein-coupled receptor, family C, group 5, member D
TP53INP22.108 NM_021202tumor protein p53 inducible nuclear protein 2
ARHGAP152.082 NM_018460Rho GTPase activating protein 15
GEFT2.066 NM_182947RAC/CDC42 exchange factor
PIM12.062 NM_002648pim-1 oncogene
TNFRSF252.055 NM_148973tumor necrosis factor receptor superfamily, member 25
GPR1572.049 NM_024980G protein-coupled receptor 157
NR2E32.045 NM_014249nuclear receptor subfamily 2, group E, member 3
LOC6192072.042 XM_927510scavenger receptor protein family member
WISP32.033 NM_003880WNT1 inducible signaling pathway protein 3
P2RX42.030 NM_002560purinergic receptor P2X, ligand-gated ion channel, 4
RASD22.029 NM_014310RASD family, member 2
FGF22.028 NM_002006fibroblast growth factor 2 (basic)
RGR2.011 NM_001012720retinal G protein coupled receptor
Group D
NRXN22.011 NM_015080neurexin 2
EDG42.009 NM_004720endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4
KGFLP12.006 NM_174950keratinocyte growth factor-like protein 1
PTPRH2.005 NM_002842protein tyrosine phosphatase, receptor type, H
OR52A52.001 NM_001005160olfactory receptor, family 52, subfamily A, member 5
Group E
KLF93.169 NM_001206Kruppel-like factor 9
CLASP22.029 NM_015097cytoplasmic linker associated protein 2
E2F52.267 NM_001951E2F transcription factor 5, p130-binding
ZNF4742.203 NM_207317zinc finger protein 474
GPR372.411 NM_005302G protein-coupled receptor 37 (endothelin receptor type B-like)
PAX52.097 NM_016734paired box gene 5 (B-cell lineage specific activator)
Group F
OR4D62.809 NM_001004708olfactory receptor, family 4, subfamily D, member 6
OR5B122.783 NM_001004733olfactory receptor, family 5, subfamily B, member 12
VENTX2.515 NM_014468VENT homeobox homolog (Xenopus laevis)
UNC5B2.438 NM_170744unc-5 homolog B (C. elegans)
OR1J42.416 NM_001004452olfactory receptor, family 1, subfamily J, member 4
NR5A12.338 NM_004959nuclear receptor subfamily 5, group A, member 1
SESN22.331 NM_031459sestrin 2
CCL252.308 NM_148888chemokine (C-C motif) ligand 25
IL21R2.301 NM_021798interleukin 21 receptor
ATF32.220 NM_001030287activating transcription factor 3
TLR12.212 NM_003263toll-like receptor 1
C1QTNF72.202 NM_031911C1q and tumor necrosis factor related protein 7
TBX192.186 NM_005149T-box 19
MXD12.163 NM_002357MAX dimerization protein 1
GTPBP22.148 NM_019096GTP binding protein 2
NR4A22.117 NM_006186nuclear receptor subfamily 4, group A, member 2
PHLDA12.116 NM_007350pleckstrin homology-like domain, family A, member 1
LCP12.111 NM_002298lymphocyte cytosolic protein 1 (L-plastin)
FGFBP12.111 NM_005130fibroblast growth factor binding protein 1
OR2B112.078 NM_001004492olfactory receptor, family 2, subfamily B, member 11
OR56A32.073 NM_001003443olfactory receptor, family 56, subfamily A, member 3
GH22.071 NM_002059growth hormone 2
PTHLH2.061 NM_002820parathyroid hormone-like hormone
THBD2.059 NM_000361thrombomodulin
HGF2.055 NM_000601hepatocyte growth factor (hepapoietin A; scatter factor)
ARTN2.051 NM_003976artemin
EPHA82.040 NM_020526EPH receptor A8
CD200R12.023 NM_138939CD200 receptor 1
FZD72.017 NM_003507frizzled homolog 7 (Drosophila)
S100A122.012 NM_005621S100 calcium binding protein A12 (calgranulin C)
Group F
SPIC2.008 NM_152323Spi-C transcription factor (Spi-1/PU.1 related)
VSIG42.006 NM_007268V-set and immunoglobulin domain containing 4
Group G
TCF213.518 NM_198392transcription factor 21
DOK62.827 NM_152721docking protein 6
FZD32.815 NM_017412frizzled homolog 3 (Drosophila)
CD862.686 NM_006889CD86 molecule
OR2L132.677 NM_175911olfactory receptor, family 2, subfamily L, member 13
IL18RAP2.557 NM_003853interleukin 18 receptor accessory protein
TRPA12.427 NM_007332transient receptor potential cation channel, subfamily A, member 1
RTP32.417 NM_031440receptor transporter protein 3
GRIA22.353 NM_000826glutamate receptor, ionotropic, AMPA 2
OR51E12.351 NM_152430olfactory receptor, family 51, subfamily E, member 1
GRM22.343 NM_000839glutamate receptor, metabotropic 2
FCRLM12.335 NM_032738Fc receptor-like and mucin-like 1
NR4A32.332 NM_173199nuclear receptor subfamily 4, group A, member 3
SPI12.288 NM_003120spleen focus forming virus (SFFV) proviral integration oncogene spi1
SMAD62.282 NM_005585SMAD, mothers against DPP homolog 6 (Drosophila)
LOC6424002.281 XM_925921similar to tripartite motif protein 17
CAMTA12.274 NM_015215calmodulin binding transcription activator 1
GDF62.260 NM_001001557growth differentiation factor 6
OR51B22.258 NM_033180olfactory receptor, family 51, subfamily B, member 2
OR7D42.238 NM_001005191olfactory receptor, family 7, subfamily D, member 4
ECGF12.227 NM_001953endothelial cell growth factor 1 (platelet-derived)
LAIR12.218 NM_002287leukocyte-associated immunoglobulin-like receptor 1
NELL12.209 NM_006157NEL-like 1 (chicken)
OR8J12.188 NM_001005205olfactory receptor, family 8, subfamily J, member 1
GRM32.178 NM_000840glutamate receptor, metabotropic 3
PRKCQ2.170 NM_006257protein kinase C, θ
PPP1R3F2.164 NM_033215protein phosphatase 1, regulatory (inhibitor) subunit 3F
LOC6423382.150 XM_925874similar to vomeronasal 1 receptor, C3
CPNE52.148 NM_020939copine V
EPHB62.134 NM_004445EPH receptor B6
OR51M12.119 NM_001004756olfactory receptor, family 51, subfamily M, member 1
PTPRC2.105 NM_002838protein tyrosine phosphatase, receptor type, C
EBF32.100 NM_001005463early B-cell factor 3
BMPR1B2.091 NM_001203bone morphogenetic protein receptor, type IB
HRH42.084 NM_021624histamine receptor H4
SHE2.082 NM_001010846Src homology 2 domain containing E
T2R552.073 NM_181429taste receptor T2R55
SBK12.067 NM_001024401SH3-binding domain kinase 1
RASGRP22.048 NM_005825RAS guanyl releasing protein 2 (calcium and DAG-regulated)
CD962.047 NM_005816CD96 molecule
GRIN2B2.028 NM_000834glutamate receptor, ionotropic, N-methyl D-aspartate 2B
Group G
YAF22.018 NM_001012424YY1 associated factor 2
LCP22.001 NM_005565lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76 kDa)

* ratio of the expression in cells cultured at pH 6.7 after 24, 5, and 2 h culture to those at pH 7.5 in groups A to D, E to F, and G, respectively.

Classification of genes whose expression was induced at acidic pH. * ratio of the expression in cells cultured at pH 6.7 to those at pH 7.5; ** genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors. Genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors whose expression was high at pH 6.7. * ratio of the expression in cells cultured at pH 6.7 after 24, 5, and 2 h culture to those at pH 7.5 in groups A to D, E to F, and G, respectively.

3.3. Genes Whose Expression Was Repressed at Acidic pH

The expressions of 412 genes were repressed more than twofold in cells cultured at pH 6.7 for 24 h, and the 412 genes contained 35, 76, and 7 genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors, respectively (Table 5). Genes whose expression was repressed at acidic pH were classified into seven groups, as shown in Table 6. The expressions of 17 genes decreased already after 2 h culture at pH 6.7 (Table 6, groups A and B).
Table 5

Genes whose expression was repressed more than twofold after 2, 5, and 24 h culture at acidic pH.

Gene2 h5 h24 h
number of genes385141412
receptors321435
signal proteins 1311476
cytokines 2807

1 including transcription factors; 2 including growth factors.

Table 6

Classification of genes whose expression was repressed at acidic pH.

GroupExpression level *Number of genes
2 h5 h24 hTotalSignal **
A<0.5<0.5<0.584
B<0.5>=0.5<0.593
C>=0.5<0.5<0.5324
D>=0.5>=0.5<0.5363107
E<0.5<0.5>=0.5258
F>=0.5<0.5>=0.57612
G<0.5>=0.5>=0.534356
total856194

* ratio of the expression in cells cultured at pH 6.7 to those at pH 7.5; ** genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors.

The expressions of 385 genes were repressed more than twofold in cells cultured at pH 6.7 for 2 h (Table 5), but the expressions of 368 of these 385 genes increased again after 24 h culture (Table 6, groups E and G). The expressions of 343 among 385 genes were repressed only after 2 h culture at pH 6.7 (Table 6, group G). After 5 h culture at pH 6.7, the expressions of 141 genes were repressed (Table 5) and 76 genes were repressed only after 5 h culture at pH 6.7 (Table 6, group F). Genes encoding proteins for signal pathways among the genes whose expression was repressed at acidic pH are listed in Table 7.
Table 7

Genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors whose expression was repressed at pH 6.7.

GeneRatio *Accession numberDescription
Group A
IL110.158 NM_000641interleukin 11
CCRL20.324 NM_003965chemokine (C-C motif) receptor-like 2
CD300LG0.444 NM_145273CD300 molecule-like family member g
ATOH10.459 NM_005172atonal homolog 1 (Drosophila)
Group B
RASGEF1C0.486 NM_001031799RasGEF domain family, member 1C
LGR50.491 NM_003667leucine-rich repeat-containing G protein-coupled receptor 5
HSH2D0.493 NM_032855hematopoietic SH2 domain containing
Group C
TLR40.099 NM_138554toll-like receptor 4
TSSK20.421 NM_053006testis-specific serine kinase 2
ADRB20.475 NM_000024adrenergic, β-2-, receptor, surface
FLRT20.400 NM_013231fibronectin leucine rich transmembrane protein 2
Group D
E2F20.150 NM_004091E2F transcription factor 2
ADRA2A0.193 NM_000681adrenergic, α-2A-, receptor
APLN0.243 NM_017413apelin, AGTRL1 ligand
REEP10.244 NM_022912receptor accessory protein 1
ARHGAP260.252 NM_015071Rho GTPase activating protein 26
UHRF10.259 NM_013282ubiquitin-like, containing PHD and RING finger domains, 1
ZNF3670.261 NM_153695zinc finger protein 367
POU5F10.267 NM_203289POU domain, class 5, transcription factor 1
RGS40.269 NM_005613regulator of G-protein signalling 4
RHOJ0.269 NM_020663ras homolog gene family, member J
MCF20.270 NM_005369MCF.2 cell line derived transforming sequence
CHRNA50.276 NM_000745cholinergic receptor, nicotinic, α 5
GPR1150.285 NM_153838G protein-coupled receptor 115
SORCS30.286 NM_014978sortilin-related VPS10 domain containing receptor 3
RBM140.287 NM_006328RNA binding motif protein 14
PDE4B0.298 NM_001037339phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)
PIK3CG0.310 NM_002649phosphoinositide-3-kinase, catalytic, γ polypeptide
RGPD20.311 NM_001024457RANBP2-like and GRIP domain containing 2
TP53RK0.314 NM_033550TP53 regulating kinase
MAP2K60.320 NM_002758mitogen-activated protein kinase kinase 6
TP730.330 NM_005427tumor protein p73
GPR630.338 NM_030784G protein-coupled receptor 63
FST0.340 NM_006350follistatin
MPP40.347 NM_033066membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
PDE4D0.350 NM_006203phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)
ANXA100.355 NM_007193annexin A10
Group D
RBL10.355 NM_002895retinoblastoma-like 1 (p107)
KIT0.360 NM_000222v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
PBX10.368 NM_002585pre-B-cell leukemia transcription factor 1
MTUS10.371 NM_001001924mitochondrial tumor suppressor 1
RORB0.386 NM_006914RAR-related orphan receptor B
LHX60.389 NM_014368LIM homeobox 6
PAQR40.392 NM_152341progestin and adipoQ receptor family member IV
ABRA0.394 NM_139166actin-binding Rho activating protein
GDAP10.396 NM_018972ganglioside-induced differentiation-associated protein 1
C1QTNF20.399 NM_031908C1q and tumor necrosis factor related protein 2
CMTM10.400 NM_181289CKLF-like MARVEL transmembrane domain containing 1
MLR10.404 NM_153686transcription factor MLR1
TSPAN80.405 NM_004616tetraspanin 8
SH2D4B0.406 NM_207372SH2 domain containing 4B
E2F10.406 NM_005225E2F transcription factor 1
VANGL10.411 NM_138959vang-like 1 (van gogh, Drosophila)
DUSP60.415 NM_001946dual specificity phosphatase 6
FZD30.416 NM_017412frizzled homolog 3 (Drosophila)
PPARGC1A0.417 NM_013261peroxisome proliferative activated receptor, γ, coactivator 1, α
HOXB70.419 NM_004502homeobox B7
PTGER20.420 NM_000956prostaglandin E receptor 2 (subtype EP2), 53 kDa
NGEF0.421 NM_019850neuronal guanine nucleotide exchange factor
FGF180.421 NM_033649fibroblast growth factor 18
LOC6535280.425 XM_927910similar to Teratocarcinoma-derived growth factor 2 (Epidermal growth factor-like cripto protein CR3) (Cripto-3 growth factor)
OR4N20.426 NM_001004723olfactory receptor, family 4, subfamily N, member 2
NKX6-20.429 NM_177400NK6 transcription factor related, locus 2 (Drosophila)
NFKBIL20.431 NM_013432nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor-like 2
PTPN220.431 NM_012411protein tyrosine phosphatase, non-receptor type 22 (lymphoid)
LOC3922690.432 XM_928112similar to Transcription factor SOX-2
MAL20.432 NM_052886mal, T-cell differentiation protein 2
SELPLG0.434 NM_003006selectin P ligand
GPR1770.434 NM_001002292G protein-coupled receptor 177
NCOA50.437 NM_020967nuclear receptor coactivator 5
RIF10.437 NM_018151RAP1 interacting factor homolog (yeast)
GPR30.439 NM_005281G protein-coupled receptor 3
CDC14A0.439 NM_003672CDC14 cell division cycle 14 homolog A (S. cerevisiae)
RP3-509I19.50.444 XM_294019similar to ECT2 protein (Epithelial cell transforming sequence 2 oncogene)
ADORA10.444 NM_000674adenosine A1 receptor
PTCH0.446 NM_000264patched homolog (Drosophila)
TCF210.446 NM_003206transcription factor 21
SPRY40.448 NM_030964sprouty homolog 4 (Drosophila)
CBX20.450 NM_005189chromobox homolog 2 (Pc class homolog, Drosophila)
OR6C740.451 NM_001005490olfactory receptor, family 6, subfamily C, member 74
Group D
CXCL140.452 NM_004887chemokine (C-X-C motif) ligand 14
CUBN0.453 NM_001081cubilin (intrinsic factor-cobalamin receptor)
NRG20.457 NM_013985neuregulin 2
SGIP10.457 NM_032291SH3-domain GRB2-like (endophilin) interacting protein 1
GNGT20.457 NM_031498guanine nucleotide binding protein (G protein), γ transducing activity polypeptide 2
EBF0.458 NM_024007early B-cell factor
ACVR1C0.458 NM_145259activin A receptor, type IC
PHTF20.458 NM_020432putative homeodomain transcription factor 2
RASSF10.460 NM_007182Ras association (RalGDS/AF-6) domain family 1
GPR109A0.462 NM_177551G protein-coupled receptor 109A
TSHR0.463 NM_000369thyroid stimulating hormone receptor
SIM20.468 NM_009586single-minded homolog 2 (Drosophila)
GABRA60.469 NM_000811γ-aminobutyric acid (GABA) A receptor, alpha 6
LAT20.469 NM_032464linker for activation of T cells family, member 2
PHKG10.472 NM_006213phosphorylase kinase, γ 1 (muscle)
RGPD40.473 XM_496581RANBP2-like and GRIP domain containing 4
NKD10.474 NM_033119naked cuticle homolog 1 (Drosophila)
ZNF5880.475 NM_001013746zinc finger protein 588
SH3TC20.476 NM_024577SH3 domain and tetratricopeptide repeats 2
FZD10.478 NM_003505frizzled homolog 1 (Drosophila)
PKMYT10.478 NM_004203protein kinase, membrane associated tyrosine/threonine 1
DUSP40.480 NM_001394dual specificity phosphatase 4
WDR40.480 NM_018669WD repeat domain 4
WDR760.481 NM_024908WD repeat domain 76
WDHD10.483 NM_001008396WD repeat and HMG-box DNA binding protein 1
HOXA70.485 NM_006896homeobox A7
WDR690.486 NM_178821WD repeat domain 69
TFAP2C0.487 NM_003222transcription factor AP-2 γ (activating enhancer binding protein 2 γ)
CDGAP0.488 NM_020754Cdc42 GTPase-activating protein
RPIB90.491 NM_138290Rap2-binding protein 9
IFNAR10.493 NM_000629interferon (α, β and ω) receptor 1
POU3F20.493 NM_005604POU domain, class 3, transcription factor 2
LOC4022790.497 XM_377945similar to glutamate receptor, metabotropic 8
EYA40.498 NM_004100eyes absent homolog 4 (Drosophila)
ISL10.498 NM_002202ISL1 transcription factor, LIM/homeodomain, (islet-1)
SIRPD0.499 NM_178460signal-regulatory protein δ
NEDD90.499 NM_182966neural precursor cell expressed, developmentally down-regulated 9
TLR30.500 #NM_003265toll-like receptor 3
Group E
RAPSN0.354 NM_005055receptor-associated protein of the synapse, 43 kDa
GRAP0.363 NM_006613GRB2-related adaptor protein
CD480.410 NM_001778CD48 molecule
LOC6429660.428 XM_926351similar to olfactory receptor 139
SALL10.437 NM_002968sal-like 1 (Drosophila)
Group E
GLIS10.438 NM_147193GLIS family zinc finger 1
FOLR10.471 NM_016725folate receptor 1 (adult)
NRG40.482 NM_138573neuregulin 4
Group F
TACR10.408 NM_015727tachykinin receptor 1
NHLH10.414 NM_005598nescient helix loop helix 1
NF20.420 NM_181825neurofibromin 2 (bilateral acoustic neuroma)
LOC4406070.427 NM_001004340Fc-γ receptor I B2
MAF0.443 NM_001031804v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)
ZNF1600.449 NM_033288zinc finger protein 160
DUSP20.454 NM_004418dual specificity phosphatase 2
SOCS10.456 NM_003745suppressor of cytokine signaling 1
CHRNA30.471 NM_000743cholinergic receptor, nicotinic, α 3
CRLF20.481 NM_022148cytokine receptor-like factor 2
MRAP0.487 NM_178817melanocortin 2 receptor accessory protein
RPIP80.491 NM_006695RaP2 interacting protein 8
Group G
CLEC4G0.198 NM_198492C-type lectin superfamily 4, member G
FSTL40.246 NM_015082follistatin-like 4
RAB6C0.282 NM_032144RAB6C, member RAS oncogene family
CSF30.295 NM_172220colony stimulating factor 3 (granulocyte)
OR2T340.301 NM_001001821olfactory receptor, family 2, subfamily T, member 34
RRP220.304 NM_001007279RAS-related on chromosome 22
UTF10.305 NM_003577undifferentiated embryonic cell transcription factor 1
CHRND0.306 NM_000751cholinergic receptor, nicotinic, δ
GPR60.316 NM_005284G protein-coupled receptor 6
ANGPTL60.324 NM_031917angiopoietin-like 6
OR2M70.346 NM_001004691olfactory receptor, family 2, subfamily M, member 7
OR10P10.356 NM_206899olfactory receptor, family 10, subfamily P, member 1
FOXD30.364 NM_012183forkhead box D3
ZAP700.377 NM_207519ζ-chain (TCR) associated protein kinase 70 kDa
PTGER30.392 NM_000957prostaglandin E receptor 3 (subtype EP3)
CDX40.395 NM_005193caudal type homeobox transcription factor 4
TBX210.405 NM_013351T-box 21
TAS2R130.408 NM_023920taste receptor, type 2, member 13
IL17RE0.414 NM_153482interleukin 17 receptor E
PRDM90.415 NM_020227PR domain containing 9
CXCL120.422 NM_199168chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)
LILRA40.430 NM_012276leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4
LOC6425060.433 XM_926003similar to double homeobox 4c
NEUROD60.435 NM_022728neurogenic differentiation 6
KLF140.438 NM_138693Kruppel-like factor 14
TFAP2E0.439 NM_178548transcription factor AP-2 ε (activating enhancer binding protein 2 ε)
Group G
CCL10.439 NM_002981chemokine (C-C motif) ligand 1
VAV30.439 NM_006113vav 3 oncogene
IRS3L0.444 XM_498229insulin receptor substrate 3-like
GPR810.445 NM_032554G protein-coupled receptor 81
GPR320.445 NM_001506G protein-coupled receptor 32
GDF70.446 NM_182828growth differentiation factor 7
WDR42C0.447 XM_293354WD repeat domain 42C
LOC6192070.454 XM_927516scavenger receptor protein family member
FOLR10.457 NM_016724folate receptor 1 (adult)
ADRA1D0.457 NM_000678adrenergic, α-1D-, receptor
IL12RB20.459 NM_001559interleukin 12 receptor, β 2
GRIN10.460 NM_007327glutamate receptor, ionotropic, N-methyl D-aspartate 1
SHC20.461 XM_375550SHC (Src homology 2 domain containing) transforming protein 2
RAXL10.464 NM_032753retina and anterior neural fold homeobox like 1
CAMK2B0.472 NM_172084calcium/calmodulin-dependent protein kinase (CaM kinase) II β
CCL150.473 NM_004167chemokine (C-C motif) ligand 15
FSHR0.474 NM_000145follicle stimulating hormone receptor
WDR40B0.478 NM_178470WD repeat domain 40B
MAFB0.482 NM_005461v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)
TPRX10.484 NM_198479tetra-peptide repeat homeobox 1
FLT10.487 NM_002019fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
OLIG20.488 NM_005806oligodendrocyte lineage transcription factor 2
TBXA2R0.490 NM_001060thromboxane A2 receptor
SSTR50.490 NM_001053somatostatin receptor 5
MYOG0.491 NM_002479myogenin (myogenic factor 4)
OR2AG10.492 NM_001004489olfactory receptor, family 2, subfamily AG, member 1
FOXD4L10.495 NM_012184forkhead box D4-like 1
PSPN0.495 NM_004158persephin
PJCG60.496 NM_001040066similar to olfactory receptor 873
TSHR0.499 NM_001018036thyroid stimulating hormone receptor

* ratio of the expression in cells cultured at pH 6.7 after 24, 5, and 2 h culture to those at pH 7.5 in groups A to D, E to F, and G, respectively; # 0.499857.

Genes whose expression was repressed more than twofold after 2, 5, and 24 h culture at acidic pH. 1 including transcription factors; 2 including growth factors. Classification of genes whose expression was repressed at acidic pH. * ratio of the expression in cells cultured at pH 6.7 to those at pH 7.5; ** genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors. Genes encoding receptors, signal proteins, transcription factors, cytokines, and growth factors whose expression was repressed at pH 6.7. * ratio of the expression in cells cultured at pH 6.7 after 24, 5, and 2 h culture to those at pH 7.5 in groups A to D, E to F, and G, respectively; # 0.499857.

3.4. The Gene Expressions in Various Cells

To confirm whether or not the gene expression pattern observed in mesothelioma cells is specific to these cells, we selected six genes, IL-32, TNFRSF9, AREG, ERBB3, ATP6V0D2, and DMGDH whose expressions were observed to increase more than three-fold at acidic pH using a microarray, and examined their expressions in various cells. IL-32 has been reported to be a cytokine, but its function remains unclear. TNFRSF9, AREG, and ERBB3 have been reported to be a receptor, growth factor, and oncogene product, respectively. ATP6V0D2 is one subunit of ATPase which has a role in pH regulation. DMGDH is a mitochondrial matrix enzyme. One problem in the measurement of mRNA was determining which gene was available as a control gene. A housekeeping gene such as GAPDH has been used generally until now. The previous report from our group showed that the amount of 18S rRNA was constant at both acidic and alkaline pH in human T cells [15]. The amount of 18S rRNA in mesothelioma cells did not vary as pH changed (data not shown). Based on these data, 18S rRNA was used as a control RNA in this study. The amount of ribosomes per cell was approximately 4 × 106 [25]. The copy number of mRNA per cell can be estimated using this number. IL-32, AREG, ERBB3, ATP6V0D2, and DMGDH genes showed increased expression in TE-11 cells after 24 h culture at acidic pH (Figure 1). These data were in agreement with the DNA array data. In contrast, the expression of TNFRSF9 did not increase under acidic pH in TE-11 (Figure 1). The expression of IL-32 was increased at acidic pH in HT-29, HepG2, and BxPC3. HT-29 cells showed increased expressions of ERBB3, ATP6V0D2, and DMGDH at acidic pH, but the expressions of AREG and TNFRSF9 decreased. The expression of ATP6V0D2 was decreased by acidosis in BxPC3. The expressions of AREG, ERBB3, and ATP6V0D2 were not affected by pH in HepG2. These results suggested that genes whose expression is stimulated at acidic pH are different in different cells.

4. Discussion

The effect of acidosis on gene expression has been generally studied in medium without FBS until now. Cells are unable to proliferate under these conditions. In the present study, we used medium containing FBS which supported cell proliferation. We used medium without the addition of bicarbonate, because the medium pH was changed after the medium had been put into a CO2 incubator and the measurement of the exact pH value in the CO2 incubator was difficult. When the CO2 incubator is not used, the addition of bicarbonate is not necessary for cell proliferation. Bicarbonate is produced via metabolic processes, such as glycolysis and the citric acid cycle under aerobic conditions, and the production is enough for cell proliferation. In fact, all cell lines we used proliferated in medium without the addition of bicarbonate, and the proliferation rate was the same as that in medium with the addition of bicarbonate. The number of mesothelioma cells increased twofold during 2 days of incubation at pH 6.7 under our experimental conditions, but no proliferation was observed at pH 6.5 or less. We therefore used pH 6.7 medium under acidic conditions in this study. Some diseased areas are acidified, but the acidification is less than 1 pH unit in many cases. Such a small change in pH has been thought to have little effect on mammalian cell functions until now. Our present data, however, clearly showed that acidification affects gene expression even if the pH change is small. Approximately 24,000 genes, about two-thirds of the mammalian genes, were analyzed in the present study, and 693 genes were up-regulated and 856 genes were down-regulated more than twofold at acidic pH in mesothelioma cells (Table 3, Table 6). The expressions of 260 genes increased more than twofold in cells cultured at pH 6.7 for 2 h compared with pH 7.5. The expressions of 223 among the 260 genes decreased again after 24 h (Table 3). The physiological significance of the expression for a short time remains unclear. It is probably not due to the fluctuation of internal pH because the internal pH was decreased within 1 h after the acidic shift and then maintained at a constant level (data not shown). It has been generally accepted that the activation of the signal proteins increases rapidly after the stimulation and then decreases. It could be suggested that the expression levels of some genes for signal proteins decrease after the initial stimulation, although no direct evidence has yet been reported. Our group found that the decrease in external pH below 7 changes the signal pathways, at least in part [11,12,15], and we identified a gene product that was essential for proliferation at acidic pH [13]. The present data showed that 84 genes for signaling were expressed more strongly after 24 h culture at acidic pH. The functions of the 78 genes whose expressions were up-regulated at acidic pH are unknown. It might be possible that some of these unidentified genes encode proteins for cellular signaling. Since translational activities are different in different genes, the mRNA level is not proportional to the enzyme level. Therefore, all protein levels encoded by genes whose expression is affected by pH may be required for clarifying the signal pathways working at acidic pH. Furthermore, there are some genes whose expression is constitutive, but function is preferential at acidic pH. Lao et al. found CTIB to be essential for growth at acidic pH, but its expression was not affected by pH in the range from 6 to 8 [13,14,27]. p38 and ERK were activated strongly at acidic pH [12,15], but our present results showed no significant stimulation of their expression by acidosis. Identification of such proteins will be essential for improving our understanding of signal pathways operating under acidic diseased loci, and our present data could be useful for these studies as a database at the transcriptional level. We found that different cytokines are expressed under different pH conditions (Table 4, Table 7). Especially IL-32 was found to express at a higher level at acidic pH in various cells. IL-32 was first identified in natural killer (NK) cells and IL-2 activated T cells [28], and was designated NK4. Since recombinant NK4 induced TNF-α production in human macrophages, it was assumed to have interleukin-like activity and hence was designated IL-32 [29]. Subsequent studies suggested that IL-32 is linked with pathological inflammation which often causes an acidic environment. Elevated IL-32 concentrations in synovial fluids and synovial tissues were demonstrated in rheumatoid arthritis but not in osteoarthritis patients [30,31]. Up-regulated IL-32 expression was also observed in the pancreatic ducts of chronic pancreatitis patients [32]. Taken together with our present data, IL-32 may be a factor that works under acidic conditions, but is not a cytokine specific to immune functions. IL-8, IL-15, and IL-16 were also up-regulated at acidic pH, and these interleukins may work in acidic diseased areas. Our present data suggest that different signal pathways operate under different pH conditions. Why do mammalian cells have this multiplicity of signaling systems? The underlying mechanism is still unclear. Cytosolic pH changed with the change in extracellular pH, and the change in internal pH may affect protein activity because all proteins have pH-dependent activity. One possible explanation is that an enzyme having maximum activity at acidic pH works under acidic pH instead of the enzyme having maximum activity at alkaline pH. E. coli has multiple transport systems for sodium and potassium ions, and these systems work under different pH conditions [9,10]. Glycolysis was reported to increase in several tumors [1,2,3]. Only phosphoglycerate mutase 2 (muscle) was increased 2.03-fold at acidic pH (supplementary table), suggesting that other enzymes still work under acidic conditions without the elevation of transcription. Phosphoglycerate mutase 2 was reported to be a muscle-specific enzyme [33]. Since the muscles are often acidified, it can be argued that this enzyme works at acidic pH and the other isozyme does at alkaline pH. The expressions of many receptor genes were affected by the pH change (Table 4, Table 7). Since receptors in the cytoplasmic membranes generally have a domain located outside the cells, the activity may be more sensitive to external acidosis compared with the cytosolic enzymes, and the gene expression of many receptors having an optimum activity at acidic pH may be stimulated by acidosis to compensate for the functional decline of receptors having an optimum activity at alkaline pH. We used mesothelioma cells in the present study. Since the gene expression patterns were shown to be different in different cells, our present data may be applicable only to responses of mesothelioma cells. Analysis of the gene expressions in various cells, including non-tumor cells and normal tissues under acidic conditions will be essential for clarifying cell functions in acidic diseased areas.

5. Conclusions

Some diseased areas, such as cancer nests, inflammatory loci, and infarction areas, are acidified, but the acidification is less than 1 pH unit in many cases. Our present data clearly showed that acidification affects gene expression even if the pH change is small. Approximately 24,000 genes, about two-thirds of the mammalian genes, were analyzed using mesothelioma cells. The expressions of 693 genes were up-regulated more than twofold at acidic pH, and genes encoding proteins for signal pathways numbered 165 among the 693 genes. The expressions of 856 genes were down-regulated more than twofold at acidic pH, and 194 among the 856 genes encoded proteins for signal pathways.
  31 in total

1.  Different proteins are phosphorylated under acidic environments in Jurkat cells.

Authors:  Toshihiko Fukamachi; Hiromi Saito; Tomohito Kakegawa; Hiroshi Kobayashi
Journal:  Immunol Lett       Date:  2002-06-03       Impact factor: 3.685

2.  On the origin of cancer cells.

Authors:  O WARBURG
Journal:  Science       Date:  1956-02-24       Impact factor: 47.728

3.  Identification of a novel gene expressed in activated natural killer cells and T cells.

Authors:  C A Dahl; R P Schall; H L He; J S Cairns
Journal:  J Immunol       Date:  1992-01-15       Impact factor: 5.422

4.  Interstitial pH and pO2 gradients in solid tumors in vivo: high-resolution measurements reveal a lack of correlation.

Authors:  G Helmlinger; F Yuan; M Dellian; R K Jain
Journal:  Nat Med       Date:  1997-02       Impact factor: 53.440

5.  Kup is the major K+ uptake system in Escherichia coli upon hyper-osmotic stress at a low pH.

Authors:  A Trchounian; H Kobayashi
Journal:  FEBS Lett       Date:  1999-03-26       Impact factor: 4.124

6.  Acidic stress promotes a glioma stem cell phenotype.

Authors:  A B Hjelmeland; Q Wu; J M Heddleston; G S Choudhary; J MacSwords; J D Lathia; R McLendon; D Lindner; A Sloan; J N Rich
Journal:  Cell Death Differ       Date:  2010-12-03       Impact factor: 15.828

7.  Tissue and intracellular pH in normal periarticular soft tissue and during different phases of antigen induced arthritis in the rat.

Authors:  S E Andersson; K Lexmüller; A Johansson; G M Ekström
Journal:  J Rheumatol       Date:  1999-09       Impact factor: 4.666

8.  Interleukin-32: a cytokine and inducer of TNFalpha.

Authors:  Soo-Hyun Kim; Sun-Young Han; Tania Azam; Do-Young Yoon; Charles A Dinarello
Journal:  Immunity       Date:  2005-01       Impact factor: 31.745

9.  Analysis of pH and pO2 in abscesses, peritoneal fluid, and drainage fluid in the presence or absence of bacterial infection during and after abdominal surgery.

Authors:  H P Simmen; J Blaser
Journal:  Am J Surg       Date:  1993-07       Impact factor: 2.565

Review 10.  Blood flow, oxygen and nutrient supply, and metabolic microenvironment of human tumors: a review.

Authors:  P Vaupel; F Kallinowski; P Okunieff
Journal:  Cancer Res       Date:  1989-12-01       Impact factor: 12.701

View more
  5 in total

1.  Expression of acidosis-dependent genes in human cancer nests.

Authors:  Toshihiko Fukamachi; Shunsuke Ikeda; Hiromi Saito; Masatoshi Tagawa; Hiroshi Kobayashi
Journal:  Mol Clin Oncol       Date:  2014-07-11

Review 2.  Role of interleukin-32 in cancer biology.

Authors:  Haimeng Yan; Donghua He; Xi Huang; Enfan Zhang; Qingxiao Chen; Ruyi Xu; Xinling Liu; Fuming Zi; Zhen Cai
Journal:  Oncol Lett       Date:  2018-05-07       Impact factor: 2.967

Review 3.  Cancer Chemotherapy Specific to Acidic Nests.

Authors:  Hiroshi Kobayashi
Journal:  Cancers (Basel)       Date:  2017-04-20       Impact factor: 6.639

4.  Acidic microenvironment plays a key role in human melanoma progression through a sustained exosome mediated transfer of clinically relevant metastatic molecules.

Authors:  Zaira Boussadia; Jessica Lamberti; Fabrizio Mattei; Elisabetta Pizzi; Rossella Puglisi; Cristiana Zanetti; Luca Pasquini; Federica Fratini; Luca Fantozzi; Federica Felicetti; Katia Fecchi; Carla Raggi; Massimo Sanchez; Stefania D'Atri; Alessandra Carè; Massimo Sargiacomo; Isabella Parolini
Journal:  J Exp Clin Cancer Res       Date:  2018-10-05

Review 5.  Role of microenvironmental acidity and tumor exosomes in cancer immunomodulation.

Authors:  Zaira Boussadia; Cristiana Zanetti; Isabella Parolini
Journal:  Transl Cancer Res       Date:  2020-09       Impact factor: 1.241

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.