Literature DB >> 24700927

Immunomodulatory mechanisms of action of calcitriol in psoriasis.

Suravi Raychaudhuri1, Anupam Mitra2, Ananya Datta-Mitra3.   

Abstract

BACKGROUND: Calcitriol is well known for its therapeutic efficacy in psoriasis, but its mechanism of action is still unclear. In this study, we tried to elucidate the precise mechanism of calcitriol for its therapeutic efficacy in psoriasis.
MATERIALS AND METHODS: Proliferation and apoptosis studies were done to determine the effect of calcitriol on normal human epidermal keratinocytes (NHEKs) and T lymphocytes. To elucidate the effect of Calcitriol on relevant chemokines and epidermal proteins of psoriasis, real-time polymerase chain reaction were done on the modified reconstructed human epidermis (RHE) an in vitro model of psoriasis. All experiments were done in triplicate. Results were expressed as mean ± standard error of mean. RESULTS AND
CONCLUSIONS: In vitro, Calcitriol showed significant inhibition of NHEKs and T lymphocyte proliferation by inducing apoptosis of these cells. Moreover, in an in vitro model of psoriasis (RHE), Calcitriol significantly inhibited relevant gene expression of chemokines (Interleukin-8, Regulated upon Activation Normal T-cell Expressed and Secreted [RANTES]) and psoriasin (S100A7). Here, we observed that Calcitriol inhibits critical pathological events associated with the inflammatory-proliferative cascades of psoriasis. Calcitriol induced apoptosis of NHEKs and T lymphocytes as well as inhibited gene expression of relevant chemokines and epidermal proteins in the in vitro model of psoriasis.

Entities:  

Keywords:  Calcitriol; T cells; chemokines; keratinocytes; psoriasis; reconstructed human epidermis

Year:  2014        PMID: 24700927      PMCID: PMC3969668          DOI: 10.4103/0019-5154.127668

Source DB:  PubMed          Journal:  Indian J Dermatol        ISSN: 0019-5154            Impact factor:   1.494


What was known? Immunomodulatory role of calcitriol is known, but its precise mechanism of immunomodulation is not known.

Introduction

Calcitriol (1α, 25-dihydroxyvitamin-D3), an active analog of vitamin D3, has been used as a first-line topical agent in psoriasis alone or in combination with steroids.[1] Calcitriol (Vit D), has been proposed to work in psoriasis by inhibiting keratinocyte proliferation, repressing growth signals, and T-cell signaling. Calcitriol binds to vitamin D receptor (VDR) with high specificity which accounts for its biological activity in VDR expressing tissues like skin, muscle, pancreas, pituitary gland, brain, kidneys, reproductive organs, and immune cells.[2] Previous studies have shown that Calcitriol arrests cytokine-induced maturation of dermal dendritic cells (DCs) and primes DC to induce regulatory T cells (Tregs).[34] It has been implicated to inhibit the production of proinflammatory cytokines, stimulate expression of the anti-inflammatory cytokines,[56] and also contributes to polarization of Th1/Th17 to a favorable Th2 and Treg cells in various autoimmune diseases.[789] Recent reports also suggest an autophagic role of vitamin-D3 and its analogs in different cancer cells as well as monocytes and normal human epidermal keratinocytes (NHEKs).[10111213] The pathogenesis of psoriasis involves an altered interaction between epidermal keratinocytes, chemokines, and infiltrating inflammatory cells.[141516] The antimicrobial peptide psoriasin [S100 calcium-binding protein A7, (S100A7)] is upregulated in psoriasis and plays a role in inflammation by recruiting leukocytes.[17] Th17 cytokines are important mediators of psoriatic inflammation and regulate psoriasin and chemokine expression in epidermal keratinocytes.[181920] Although other studies have shown the immunomodulatory effect of Calcitriol,[821] none of them focused on exploring the mechanism of Calcitriol behind these effects. In this study, we demonstrated that Calcitriol exerts its immunomodulatory effect by inducing apoptosis of key effector cells of psoriasis (NHEK and T lymphocytes), and downregulates the relevant chemokines and epidermal proteins of psoriasis in modified reconstructed human epidermis (RHE), an in vitro model of psoriasis.

Materials and Methods

Materials

Calcitriol (Vit D) was a kind gift from Dr. Rahul Ray (Vitamin D, Skin and Bone Research Laboratory, Boston University School of Medicine, Boston, MA, USA). The optimum concentration of Calcitriol was standardized in NHEKs by in vitro assay using 10-9 to 10-6 M. We observed that 10-6 M had optimum effect, which is in line with previous report,[22] and thus 10-6 M was used in subsequent experiments. All other chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA), if not mentioned separately.

Cell culture

After institutional review board approval, blood was collected from psoriatic patients (n = 10) following informed consent process. CD3+ T cells were sorted from peripheral blood mononuclear cells as per manufacturer's instructions (Stem Cell Technologies, Vancouver, BC, Canada). NHEKs were obtained from healthy individuals (n = 6) and cultured in keratinocyte basal medium supplemented with nutrients [KGM, (KGM-Gold™ SingleQuots, Lonza Walkersville, MD) USA] [Figure 1].[23]
Figure 1

Study flowchart

Study flowchart

Cell proliferation assays

MTT assay

MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide) is a rapid and reliable method to assess cell proliferation. Briefly, MTT, a yellow tetrazolium salt, converted to insoluble purple colored formazan by enzymes of metabolically active cells, which is solubilized with dimethyl sulfoxide. The intensity of the color is measured spectrophotometrically and the absorbance (represented by optical density; OD-570 nm) is directly proportional to the number of viable cells.[24] CD3+ T cells were incubated in presence or absence of anti-CD3/CD28 cocktail and Vit D. Similarly, NHEKs were incubated with or without Vit D at 37°C/5% CO2 for 5 days. MTT assay was done as described.[2526]

Carboxyfluorescein succinimidyl ester dilution assay

To confirm the findings of MTT assay, we did a more specific flow cytometry based proliferation assay, carboxyfluorescein succinimidyl ester (CFSE) dilution assay.[27] Briefly, CFSE is a colorless, nonfluorescent compound, freely permeable to the cells. Intracellularly, the acetate groups are cleaved by esterases to yield highly fluorescent CFSE, which reacts with intracellular amines forming fluorescent conjugates and well retained in the cell. The fluorescence is measured by flow cytometry and is inversely proportional to the number of viable cells. CD3+ T cells and NHEKs stained with CFSE (Molecular probes, Eugene, OR, USA) reagent was incubated for 5 days with treatments stated above. On 5th day, the cells were stained with antihuman primary antibodies (CD3, CD4, CD8) (BD Biosciences, San Jose, CA, USA).[28] CFSE dilution was assessed by flow cytometry (LSR Fortessa™ cell analyzer, BD, San Jose, CA, USA) and data were analyzed using FlowJo software (Tree Star, Ashland, OR, USA).[29] In FlowJo software, the parent population is represented by a single peak (orange color). The cells which are proliferating from the parent population, that is, the daughter population, are represented by several peaks (pink color). Thus, the number of daughter population (pink color) as well as number of cells in each population will represent the proliferative activity.

Apoptosis assay

CD3+ T cells and NHEKs were treated with above treatments for 5 days. Staurosporine (1 μM) (Cell Signaling, Danvers, MA, USA) induced apoptosis was used as positive control. At the end of incubation, cells were collected, incubated with Annexin V (BD Pharmingen, San Diego, CA, USA). Propidium iodide (BD Pharmingen, San Diego, CA, USA) was added just before data acquisition in flow cytometer (FACS Calibur™, BD, San Jose, CA, USA). FACS data were analyzed using FlowJo software.[30]

RHE model

EpiDerm™ RHE tissues and EPI-100-NMM medium were purchased from MatTek (Ashland, MA, USA). Three tissues per treatment condition were cultured as mentioned[3132] with Vit D and human recombinant interleukin (IL)-22 (30 ng/mL) (eBioscience, San Diego, CA, USA) alone or in combination. On 5th day, tissues were collected and used for real-time polymerase chain reaction (PCR) analysis [Figure 1].

Real-time PCR

Total cellular RNA from RHE tissues were isolated using TRIzol reagent (Life Technologies, Green Island, NY, USA) according to manufacturer's instructions. RNA was then reverse transcribed to cDNA (Qiagen Inc., Valencia, CA, USA). Real-time PCR was conducted in the ABI 7500 Fast RT PCR system (Applied Biosystems, CA, USA) using SYBR green (Qiagen Inc. CA, USA) and specific primers for IL-8, RANTES, and S100A7 (Invitrogen, Green Island, NY, USA) as per our standardized protocol.[33] 18S rRNA was used as a reference gene for the real-time PCR assay. The primer sequences are IL-8-forward 5’AGGTGCAGTTTTGCCAAGGA3’; reverse 5’TTTCTGTGTTGGCGCAGTGT3’; RANTES-forward 5’TCCTGCAGAGGATCAAGACA3’; reverse 5’CA ATGTAGGCAAAGCAGCAG3’; S100A7-forward 5’CT TCTACTCGTGACGCTTCC3’; reverse 5’AATTTGT GCC CTTTTTGTCA3’; RN18S1-forward 5’TCAAGAACGA AAGTCGGAGG3’; reverse 5’GGACATCTAAGGGCAT CACA3’.

Statistical analysis

All experiments were done in triplicate. Results were expressed as mean ± standard error of mean. For CFSE dilution assay, the percent divided cells of each treatment group were determined using the FlowJo software. Statistical analysis was done using the GraphPad Prism software, version 5.0 (GraphPad Software Inc, CA, USA). Nonparametric unpaired test (Mann-Whitney U Test) was used to determine statistical significance. A P < 0.05 was considered statistically significant.

Results

Calcitriol inhibited the proliferation of activated T lymphocytes and NHEKs

Anti-CD3/CD28 stimulation induced significant proliferation (Optical density [OD]: 1.79 ± 0.3) of CD3+ T lymphocytes compared to unstimulated cells (OD: 0.89 ± 0.11, P < 0.01) as determined by MTT assay. Calcitriol (Vit D) effectively inhibited anti-CD3/CD28 induced proliferation of CD3+ T lymphocytes (OD: 0.91 ± 0.11 vs. 1.79 ± 0.3, P = 0.012) [Figure 2a]. Similar results were observed in the CFSE dilution assay; anti-CD3/CD28 induced significant proliferation of CD3+ T lymphocytes (21.18% ± 1.27%) compared to unstimulated cells (6.06% ± 1.13%, P < 0.0001) [Figure 2b]. Calcitriol (13.14% ± 1.94%) significantly inhibited anti-CD3/CD28 stimulated T lymphocyte proliferation (21.18% ± 1.27%, P = 0.0003) [Figure 2b]. Similarly, in NHEKs, Calcitriol showed significant antiproliferative effect compared to unstimulated cells (OD: 1.26 ± 0.1 vs. 1.81 ± 0.12, P < 0.01, MTT assay and 25.93% ± 0.7% vs. 34.11% ± 0.6%, P < 0.01, CFSE dilution assay) [Figures 2c and d, respectively].
Figure 2

(a and c) MTT, (b and d) CFSE dilution assay showing antiproliferative effect of Calcitriol (Vit D) on T lymphocytes (a, b) and NHEKs (c, d)

(a and c) MTT, (b and d) CFSE dilution assay showing antiproliferative effect of Calcitriol (Vit D) on T lymphocytes (a, b) and NHEKs (c, d)

Antiproliferative effect of Calcitriol extended to helper (CD4+) and cytotoxic (CD8+) T lymphocytes

Next, we extended our observation of the antiproliferative effect of Calcitriol on different T lymphocyte subpopulations. In CFSE dilution assay, we observed that Calcitriol significantly inhibited the proliferation of both activated helper (CD4+, 4.57% ± 2.2% vs. 16.3% ± 3%, P = 0.013) and suppressor/cytotoxic (CD8+, 2.9% ± 0.54% vs. 18.47% ± 2.21%, P = 0.0009) T lymphocytes compared to anti-CD3/CD28 stimulated cells [Figures 3b and c].
Figure 3

(a) Gating strategy for CD3+ T lymphocytes, (b) Representative FACS histogram and, (c) Bar diagram showing Calcitriol's (Vit D) effect on CD4+/CD8+ T lymphocytes

(a) Gating strategy for CD3+ T lymphocytes, (b) Representative FACS histogram and, (c) Bar diagram showing Calcitriol's (Vit D) effect on CD4+/CD8+ T lymphocytes

Calcitriol inhibits T lymphocytes and NHEKs proliferation by inducing early apoptosis

To determine one of the antiproliferative mechanisms of the Calcitriol on NHEKs and T lymphocytes, we evaluated the proapoptotic effect of Calcitriol by using Annexin V assay. Staurosporine was used as a positive control for this assay. We observed that Calcitriol significantly induced early apoptosis (Annexin V+ PI−) in approximately 26% (26.10% ± 2.05%) of CD3+ T lymphocytes compared to unstimulated cells (3.28% ± 0.17%, P < 0.01) [Figure 4b]. Similarly in NHEKs, Calcitriol induced early apoptosis in 43% (43% ± 0.76%) compared to unstimulated cells (9.7% ± 0.48%, P < 0.001) [Figure 4b].
Figure 4

(a) Representative dot plot and (b) Bar diagram showing percentage of apoptotic CD3+ T lymphocytes and NHEKs. Calcitriol = Vit D

(a) Representative dot plot and (b) Bar diagram showing percentage of apoptotic CD3+ T lymphocytes and NHEKs. Calcitriol = Vit D

Calcitriol downregulates mRNA expression of relevant chemokines (IL-8 and RANTES) and psoriasin (S100A7) in IL-22 treated RHE tissue

Further to determine the immunomodulatory mechanisms of Calcitriol in psoriasis, we evaluated the effect of Calcitriol on the relevant chemokines (IL-8, RANTES) and epidermal protein (S100A7) of psoriasis by using an in vitro model, RHE. We observed that in vitro, IL-22 induced hallmark pathological features of psoriasis in RHE tissue which is in accordance with other research groups.[1831] In RHE tissue, IL-22 significantly upregulates the expression of critical genes of psoriasis: RANTES, IL-8 and S100A7 by almost 27 fold (26.96 ± 0.45), 32 fold (31.54 ± 1.22) and 92 fold (92.40 ± 1.80), respectively, compared to unstimulated cells [Figure 5]. Calcitriol effectively downregulates the IL-22 induced upregulation of RANTES (2.73 ± 0.34, P < 0.0001), IL-8 (9.40 ± 0.98, P = 0.0004) and S100A7 (13.85 ± 0.63, P < 0.0001) [Figure 5].
Figure 5

Relative gene expression of (a) RANTES, (b) IL-8, and (c) S100A7 using 18S rRNA as reference gene. Calcitriol = Vit D

Relative gene expression of (a) RANTES, (b) IL-8, and (c) S100A7 using 18S rRNA as reference gene. Calcitriol = Vit D

Discussion

Vitamin D analogs are used in treatment of psoriasis, but the mechanisms behind their antipsoriatic effect are not fully understood. Previous studies have shown that Calcitriol inhibit antigen induced T lymphocyte proliferation[34] and cytokine production.[35] In this study, we worked to reveal the possible mechanisms of actions of Calcitriol for its therapeutic efficacy in psoriasis. Quite intriguingly, we found that the antimitotic effect of Calcitriol in T lymphocytes and keratinocytes is dependent on induction of apoptosis in these cells. A number of reports suggest antiproliferative role of vitamin D and its analogs on T lymphocyte survival.[213637] However, very few studies examined Calcitriol's differential effects on T lymphocyte subpopulations. Our results revealed that Calcitriol significantly inhibited the proliferation of activated CD4+ and CD8+ T lymphocytes of psoriatic patients [Figure 3]. Similarly, in the keratinocytes we found that Calcitriol is a potent antiproliferative agent, which is in line with other research groups’ findings.[38] Next, we sought to determine whether the antiproliferative effect of Calcitriol is due to induction of apoptosis. We observed that calcitriol induced significant apoptosis in CD3+ T lymphocytes and NHEKs when cultured in similar environment [Figure 4]. Thus, we conclude that the antiproliferative effect of Calcitriol on T lymphocytes and NHEKs is by induction of apoptosis. Next, we sought to determine the effect of calcitriol on expression of relevant chemokines and epidermal proteins known to be critical for psoriasis using RHE model. RHE is comprised of basal, spinous, granular, and cornified layers mimicking multilayered epidermis in vivo. NHEKs express functional receptors for IL-22[39] and IL-22 upregulated proinflammatory gene expression in NHEKs. Several studies including our previous study demonstrated that psoriatic pathology can be induced in the RHE model by IL-22.[183132] Thus, the modified RHE model is considered as an important in vitro model of human psoriasis. We investigated the effect of calcitriol on relevant chemokines (IL-8, RANTES) and epidermal proteins (S100A7) of psoriasis using the modified RHE tissue model. Briefly, RANTES and IL-8 play a critical role in the pathogenesis of psoriasis and it has been reported that IL-22 is capable of inducing these genes in keratinocytes.[3940] In the IL-22 treated RHE tissue, we observed that Calcitriol effectively downregulated the mRNA expression of RANTES and IL-8 [Figure 5]. S100A7 belongs to a group of calcium-binding proteins, involved in antimicrobial defense, chemotaxis, epidermal differentiation complex, and amplification of inflammation.[17] Epidermal expression of S100A7 is considered to be a hallmark feature of a psoriatic lesion. S100A7 primes epidermal keratinocytes for an enhanced production of immunotropic cytokines, such as TNF-α, IL-6, and IL-8; inhibition of the S100A7-mediated inflammatory loop is found to be an important therapeutic option in psoriasis.[41] Previous reports demonstrated that high levels of IL-22 in psoriatic skin were associated with upregulation of psoriasin and it is overexpressed in psoriatic lesions.[42] Here, we observed that IL-22 upregulates mRNA of S100A7 and Calcitriol (Vit D) significantly downregulates the IL-22 induced S100A7 upregulation [Figure 5]. These observations suggest that the antiproliferative effect of Calcitriol on NHEKs and activated T lymphocytes is mediated through induction of apoptosis of these cells. Further, Calcitriol downregulates expression of the key regulatory chemokines and epidermal proteins such as S100A7 in the in vitro model of psoriasis (RHE). All these effects account for the antipsoriatic properties of Calcitriol. Thus, our observations shed light on the molecular mechanisms of Calcitriol in respect to its therapeutic efficacy in psoriasis. What is new? Antiproliferative effect of calcitriol on NHEK and CD3+ T cells was found to be due to induction of apoptosis. The immunomodulatory role of Calcitriol also extended to modified RHE model, an in vitro model of psoriasis, where Calcitriol inhibited chemokine and psoriasin gene expression, thereby suggesting regulatory role in the inflammatory and proliferative cascades of psoriasis.
  41 in total

1.  Quantifying cell turnover using CFSE data.

Authors:  Vitaly V Ganusov; Sergei S Pilyugin; Rob J de Boer; Kaja Murali-Krishna; Rafi Ahmed; Rustom Antia
Journal:  J Immunol Methods       Date:  2005-03       Impact factor: 2.303

2.  Regulation of cytokine production in human peripheral blood mononuclear cells and allergen-specific th cell clones by 1alpha,25-dihydroxyvitamin D3.

Authors:  Xiahoui Rausch-Fan; Fritz Leutmezer; Martin Willheim; Andreas Spittler; Barbara Bohle; Christof Ebner; Erika Jensen-Jarolim; George Boltz-Nitulescu
Journal:  Int Arch Allergy Immunol       Date:  2002-05       Impact factor: 2.749

3.  RANTES expression in psoriatic skin, and regulation of RANTES and IL-8 production in cultured epidermal keratinocytes by active vitamin D3 (tacalcitol).

Authors:  M Fukuoka; Y Ogino; H Sato; T Ohta; K Komoriya; K Nishioka; I Katayama
Journal:  Br J Dermatol       Date:  1998-01       Impact factor: 9.302

Review 4.  Pathogenesis and therapy of psoriasis.

Authors:  Michelle A Lowes; Anne M Bowcock; James G Krueger
Journal:  Nature       Date:  2007-02-22       Impact factor: 49.962

5.  IL-22 induced cell proliferation is regulated by PI3K/Akt/mTOR signaling cascade.

Authors:  Anupam Mitra; Smriti Kundu Raychaudhuri; Siba P Raychaudhuri
Journal:  Cytokine       Date:  2012-07-25       Impact factor: 3.861

6.  The anti-proliferative and differentiation-inducing effects of vitamin D analogs are not determined by the binding affinity for the vitamin D receptor alone.

Authors:  C M Hansen; I S Mathiasen; L Binderup
Journal:  J Investig Dermatol Symp Proc       Date:  1996-04

7.  1α,25-Dihydroxyvitamin-D3-3-bromoacetate regulates AKT/mTOR signaling cascades: a therapeutic agent for psoriasis.

Authors:  Ananya Datta Mitra; Siba P Raychaudhuri; Christine J Abria; Anupam Mitra; Rebecca Wright; Rahul Ray; Smriti Kundu-Raychaudhuri
Journal:  J Invest Dermatol       Date:  2013-01-11       Impact factor: 8.551

8.  Inhibition of human T lymphocyte proliferation and cytokine production by 1,25-dihydroxyvitamin D3. Differential effects on CD45RA+ and CD45R0+ cells.

Authors:  K Müller; K Bendtzen
Journal:  Autoimmunity       Date:  1992       Impact factor: 2.815

9.  1,25-dihydroxyvitamin D3 modulates Th17 polarization and interleukin-22 expression by memory T cells from patients with early rheumatoid arthritis.

Authors:  E M Colin; P S Asmawidjaja; J P van Hamburg; A M C Mus; M van Driel; J M W Hazes; J P T M van Leeuwen; E Lubberts
Journal:  Arthritis Rheum       Date:  2010-01

10.  Control of macroautophagy by calcium, calmodulin-dependent kinase kinase-beta, and Bcl-2.

Authors:  Maria Høyer-Hansen; Lone Bastholm; Piotr Szyniarowski; Michelangelo Campanella; György Szabadkai; Thomas Farkas; Katiuscia Bianchi; Nicole Fehrenbacher; Folmer Elling; Rosario Rizzuto; Ida Stenfeldt Mathiasen; Marja Jäättelä
Journal:  Mol Cell       Date:  2007-01-26       Impact factor: 17.970

View more
  4 in total

1.  The Putative Role of Thyroid Hormones and Vitamin D on Severity and Quality of Life in Psoriasis.

Authors:  Kulkarni Sweta; M Monica Freeda; M Lenin
Journal:  Int J Appl Basic Med Res       Date:  2020-07-11

2.  Effect of Vitamin D on Peripheral Blood Mononuclear Cells from Patients with Psoriasis Vulgaris and Psoriatic Arthritis.

Authors:  Susana Cubillos; Nadine Krieg; Johannes Norgauer
Journal:  PLoS One       Date:  2016-04-06       Impact factor: 3.240

3.  The therapeutic effects of Bombyx mori sericin on rat skin psoriasis through modulated epidermal immunity and attenuated cell proliferation.

Authors:  Kitiya Rujimongkon; Sumate Ampawong; Onrapak Reamtong; Theerapong Buaban; Pornanong Aramwit
Journal:  J Tradit Complement Med       Date:  2021-07-01

4.  Case report: Focal segmental glomerulosclerosis and nephrotic syndrome following treatment with pamidronate for calcitriol toxicity.

Authors:  Katherine Ann Dawson; April Blong; Rebecca Walton
Journal:  Front Vet Sci       Date:  2022-08-12
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.