Literature DB >> 24686382

Molecular characterization of human T-cell lymphotropic virus type 1 full and partial genomes by Illumina massively parallel sequencing technology.

Rodrigo Pessôa1, Jaqueline Tomoko Watanabe1, Youko Nukui2, Juliana Pereira2, Jorge Casseb, Jorge Kasseb3, Augusto César Penalva de Oliveira3, Aluisio Cotrim Segurado4, Sabri Saeed Sanabani5.   

Abstract

BACKGROUND: Here, we report on the partial and full-length genomic (FLG) variability of HTLV-1 sequences from 90 well-characterized subjects, including 48 HTLV-1 asymptomatic carriers (ACs), 35 HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and 7 adult T-cell leukemia/lymphoma (ATLL) patients, using an Illumina paired-end protocol.
METHODS: Blood samples were collected from 90 individuals, and DNA was extracted from the PBMCs to measure the proviral load and to amplify the HTLV-1 FLG from two overlapping fragments. The amplified PCR products were subjected to deep sequencing. The sequencing data were assembled, aligned, and mapped against the HTLV-1 genome with sufficient genetic resemblance and utilized for further phylogenetic analysis.
RESULTS: A high-throughput sequencing-by-synthesis instrument was used to obtain an average of 3210- and 5200-fold coverage of the partial (n = 14) and FLG (n = 76) data from the HTLV-1 strains, respectively. The results based on the phylogenetic trees of consensus sequences from partial and FLGs revealed that 86 (95.5%) individuals were infected with the transcontinental sub-subtypes of the cosmopolitan subtype (aA) and that 4 individuals (4.5%) were infected with the Japanese sub-subtypes (aB). A comparison of the nucleotide and amino acids of the FLG between the three clinical settings yielded no correlation between the sequenced genotype and clinical outcomes. The evolutionary relationships among the HTLV sequences were inferred from nucleotide sequence, and the results are consistent with the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil.
CONCLUSIONS: This study has increased the number of subtype aA full-length genomes from 8 to 81 and HTLV-1 aB from 2 to 5 sequences. The overall data confirmed that the cosmopolitan transcontinental sub-subtypes were the most prevalent in the Brazilian population. It is hoped that this valuable genomic data will add to our current understanding of the evolutionary history of this medically important virus.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24686382      PMCID: PMC3970957          DOI: 10.1371/journal.pone.0093374

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Human T-cell leukemia virus type I (HTLV-1) is the retrovirus responsible for adult T-cell leukemia/lymphoma (ATLL) and for the chronic neurological disorder HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) [1], [2], [3], [4]. The virus has also been implicated in a variety of inflammatory diseases, such as uveitis [5], pulmonary alveolitis [6], Hashimoto thyroiditis [7], and chronic arthropathy [8]. Globally, an estimated 10–20 million individuals are HTLV-1 carriers [9]. The disease burden is unevenly distributed in endemic areas, particularly in southwest Japan, the Caribbean islands, South America, and portions of Central Africa [10], [11]. Among the 15 to 25 million HTLV-1-infected individuals living throughout the world, approximately 1 to 5% will develop ATL or HAM/TSP, depending on as-yet-unknown cofactors that could vary according to geographical location [12]. Similar to other retroviruses, HTLV-1 carries a diploid RNA genome comprising 9032 nucleotides that is reverse-transcribed into double-stranded DNA that integrates into the host genome as a provirus [13]. This genome contains gag, pol and env genes flanked by long terminal repeat (LTR) sequences at both the 5′ and 3′ ends. A distinct molecular structure, known as the pX region, that is not present in other retroviruses is found between env and the 3′ LTR. The plus strand of the pX region encodes the regulatory proteins p40 (Tax), p27 (Rex), p12, p13, p30, and p21, which are critical to the viral infectivity in resting primary lymphocytes and to proliferation in infected cells [14]. Much of our current understanding of the HTLV-1 genome structure, variability and evolution has come from the conventional Sanger di-deoxy sequencing approach applied to viral partial sequences. According to previously published data on phylogenetic comparisons of partial sequences, seven subtypes of HTLV-1 strains have been described thus far (a–g) [15]: the cosmopolitan subtype A, the Australo-Melanesian subtype C and the Central African subtype B, D, E, F and G. The cosmopolitan subtype A is further divided into five sub-subtypes : (A) Transcontinental, (B) Japanese, (C) West African, (D) North African, and (E) the Peruvian Black [11], [16], [17]. However, only 2 HTLV-1 subtypes (a and 1b) have had their whole genomes sequenced to date. The data on the complete genome sequences of the HTLV-1 strains found in Brazil are scant. Of note, HTLV-1 infection is endemic in Brazil, and the prevalence varies across different regions of Brazil [18], [19]. Recently, it has been reported that the overall seroprevalence of HTLV infection among 281,760 first-time donors from three blood centers in Brazil was approximately 135 per 105 [19]. The same study reported an incidence of 3.6×105 person-years, and the residual transfusion risk was 5.0×106 per blood unit transfused. A high prevalence of HTLV-1 infection has been reported in Salvador, a large city in the eastern part of Brazil, with an estimated prevalence of 1.35% among blood donors and 1.76% of the overall population [20]. The transcontinental sub-subtypes found in Brazil are believed to have been recently introduced from Africa, most likely through the post-Columbian migrations of the African slave trade between the sixteenth and nineteenth centuries[20], [21]. DNA sequencing has been dramatically advanced by increasingly high-throughput technology. Recent work has employed this technology to enable the characterization of entire viral populations in human and nonhuman primates [22], [23], [24] and to identify minor genomic variants [25], [26]. It is somewhat surprising then that despite millions of people being infected with HTLV-1 worldwide, what was known about HTLV-1 strain genomes was primarily derived from shorter partial sequences of the viral genomes. The scarcity of HTLV-1 complete genome sequences prompted us to characterize and generate newer genetic materials of these viruses, which provide a useful tool for studying viral origin and evolution, in addition to aiding epidemiological monitoring. Here, we combined Illumina's sequencing by synthesis (SBS) technology with a transposon-based fragmentation method to perform genome wide ultra-deep sequencing of 90 HTLV-1 amplified genomes. From this data, we sought to investigate whether different molecular subtypes were associated with disease development in the participating subjects.

Materials and Methods

Study Population

Ninety participants were randomly selected from a larger cohort of 233 HTLV-1-infected persons representing 48 (53.3%) asymptomatic carriers (ACs), 35 (38.9%) HAM/TSP patients and 7 (7.8%) ATLL patients. This sub-cohort was part of an ongoing project to profile human T-cells miRNAs in the course of HTLV-1 infection using a deep-sequencing approach. A decision to include 90 samples was made because up to 96 samples can be pooled and sequenced together in a single flow cell. HTLV-1-positive individuals were recruited from the HTLV-1 outpatient clinic at the University of Sao Paulo and the Institute of Infectious Diseases “Emilio Ribas.” All ACs were diagnosed as HTLV-1 carriers at the time of blood donation. Viral infection was identified by the Murex HTLV I + II (Abbott/Murex, Wiesbaden, Germany) and Vironostika HTLVI/II (bioMérieux bv, Boxtel, Netherlands) HTLV enzyme immunoassays, and infection was confirmed by HTLV BLOT 2.4 (HTLV blot 2.4, Genelabs Diagnostics, Science Park, Singapore). The clinical status of HAM/TSP was determined based on the WHO criteria for HTLV-1-associated diseases [27]. Diagnostic criteria for ATLL included serologic evidence of HTLV-1 infection and cytologically or histologically proven T cell malignancy. Written informed consent was obtained from each participant. The study was approved by the local review board (Comissão de Ética para Análise de Projetos de Pesquisa, CAPPesq).

DNA extraction and HTLV-1 proviral load determination

DNA was extracted from peripheral blood mononuclear cells (PBMCs) using a commercial kit (Qiagen GmbH, Hilden Germany) following the manufacturer's instructions. The extracted DNA was used as a template to amplify a 97-bp fragment from the HTLV-1 tax region using previously published primers [28]. The TaqMan real-time PCR assay was conducted in a 25-µL reaction mixture containing 10 µL of KAPA PROBE FAST Universal qPCR Master mix kit (KapaBiosystems), 5 µL of template DNA, 0.4 µM of each primer and 0.2 µM of the final concentration of each probe. Amplification and analysis were performed with the Applied Biosystems 7500 real-time PCR system using an initial denaturation step at 95°C for 2 minutes, followed by 40 cycles of 95°C for 10 seconds and 57°C for 45 seconds. A fragment of the RNase P gene from humans [29] was used as an internal control. A negative, no-template control (H2O control) was run with every assay. Standard curves for HTLV-1 tax were generated from MT-2 cells of log10 dilutions (from 105 to 100 copies). The threshold cycle for each clinical sample was calculated by defining the point at which the fluorescence exceeded a threshold limit. Each sample was assayed in duplicate, and the mean of the two values was considered the copy number of the sample. The HTLV-1 proviral load was calculated as the copy number of HTLV-1 (tax) per 1000 cells = (copy number of HTLV-1 tax)/(copy number of RNase P gene/2)×1000 cells. The method could detect 1 copy per 103 PBMCs.

Amplification of the complete provirus genomes

The complete provirus genome was amplified in two large fragments (A, 4.939 bp, nt 10 to 4930, and B, 4562 bp, nt 4459 to 9006) from 200–300 ng of extracted genomic DNA. The structural and regulatory genes of each sequence were mapped based on comparison with the genomic sequence of B1033-2009 sub-subtype aB from Japan (GenBank accession no. AB513134). Fragment A was amplified using the primers HTLV-1 FG_O1S 5′ and HTLV-1 FG_O1R 5′. Fragment B was amplified using the primers HTLV-1 FG_O2S 5′ and HTLV-1 FG_O2R 5′. The boldface nucleotides (non-HTLV-1 specific sequences) are tails at the 5′ end of the outer primers and were added to enhance the nested amplification with inner primers. The PCR products were then subjected to nested PCR to amplify the A and B nested fragments. The nested primers for fragment A were HTLV-1 FG_N1S 5′CCA TGA GCC CCA AAT ATC CCC CGG′3 and HTLV-1 FG_N1R 5′GGG GGG AGT GGT GAA GCT GCC′3. The nested primers for fragment B were HTLV-1 FG_N2S 5′GGC CTA CTT CCT AAC CAC ATC TGG CAA GG′3 and HTLV-1 FG_N2R 5′GGA GCC AGC GAC AGC CCA TCC TAT′3. The PCR conditions for outer and inner PCR were as follows: an initial step of 5 min at 94°C; 35 cycles, with 1 cycle consisting of 30 s at 94°C, 30 s at 60°C, and 5 min at 72°C; and a final step of 10 min at 72°C. The amplified DNA fragments from the nested PCR product were separated by gel electrophoresis and purified using Freeze ‘N Squeeze DNA Gel Extraction Spin Columns. Each purified amplicon was quantified using Quant-IT HS reagents (Invitrogen, Life Technologies, Carlsbad, CA), and both amplicons from a single viral genome were pooled together at equimolar ratios.

Whole viral genome library preparation

Each pool was then quantitated, and approximately 1 ng of each was used in a fragmentation reaction mix using a Nextera XT DNA sample prep kit according to the manufacturer's protocol. Briefly, tagmentation and fragmentation of each pool were simultaneously performed by incubation for 5 min at 55°C followed by incubation in neutralizing tagment buffer for 5 min at room temperature. After neutralization of the fragmented DNA, a light 12-cycle PCR was performed with Illumina Ready Mix to add Illumina flowcell adaptors, indexes and common adapters for subsequent cluster generation and sequencing. Amplified DNA was then purified using Agencourt AMPure XP beads (Beckman Coulter), which excluded very short library fragments. Following AMPure purification, the quantity of each library was normalized to ensure equally library representation in our pooled samples. Prior to cluster generation, normalized libraries were further quantified by qPCR using the SYBR fast Illumina library quantification kit (KAPA Biosystems) following the instructions of the manufacturer. The qPCR was run on the 7500 Fast Real-Time PCR System (Applied Biosystems). The thermocycling conditions consisted of an initial denaturation step at 95°C for 5 min followed by 35 cycles of [30 s at 95°C and 45 s at 60°C]. The final libraries were pooled at equimolar concentration and diluted to 4 nM. To denature the indexed DNA, 5 µL of the 4 nM library were mixed with 5 µL of 0.2 N fresh NaOH and incubated for 5 min at room temperature. 990 µL of chilled Illumina HT1 buffer was added to the denatured DNA and mixed to make a 20 pM library. After this step, 360 µL of the 20 pM library was multiplexed with 6 µL of 12.5 pM denatured PhiX control to increase sequence diversity and then mixed with 234 µL of chilled HT1 buffer to make a 12 pM sequenceable library. Finally, 600 µL of the prepared library was loaded on an Illumina MiSeq clamshell style cartridge for paired end 250 sequencing.

Data analysis

Fastq files were generated by the Illumina MiSeq reporter for downstream analysis and validated to evaluate the distribution of quality scores and to ensure that quality scores do not drastically drop over each read. Validated fastq files from each viral genome were de novo assembled into contiguous sequences and annotated with CLC Genomics Workbench version 5.5 (CLC Bio, Aarhus, Denmark) and the Sequencher program 5.2 (Gene Code Corp., Ann Arbor, MI). To improve the quality of reads, approximately 10 nucleotides were trimmed from the 3′ end of the reads from each sequence library of each sample. Because the repetitive and identical sequences of both LTR presented the biggest difficulty in assembling HTLV-1 genome sequence data, we decided to only use the 3′ LTR sequence from each sequence for further analysis. The contiguous genomic sequence from each virus strain was extracted from the assembly and used for further analysis. The full designation of samples is 0YYBR_CLNXXX, where 0YY stands for the year of study, BR for Brazil, CLN for clinical status, and XXX for the enrolment number. To increase the reliability of the observed DNA variations, the background error rate was set at 1% meaning that DNA variations detected in at least 1% of the viral sequences within a given sample are genuine variations. Open reading frames were individually aligned with prototype variant B1033-2009 using the MAFFT algorithm [30]. Individual open reading frame alignments were then concatenated, and the nucleotide-level similarities of the resulting full-length coding genomes (gag, pol, env p30 and tax) were calculated using MEGA5 [31]. Bayesian inference (BI) phylogenetic analyses were conducted using MrBayes v. 3.2 [32]. The settings used for the analysis of the resulting partial and full-length coding genomes were nst = 6, with the gamma-distributed rate variation across sites and a proportion of invariable sites (rates = invgamma). Posterior probability distributions were generated using the Markov Chain Monte Carlo (MCMC) method with four chains being run simultaneously for 1,000,000 generations. Burn-in fraction was set at 2500 and trees were sampled every 100 generations. Due to the large size of the LTR dataset and the limited computer capacity, analyses were run until the average standard deviation of split frequencies fell below 0.05. At termination, parameters and trees were summarized with a burnin of 25%. The plot of log-likelihood values over generations were assessed for adequate sampling and potential scale reduction factors for convergence. All trees were displayed using either FigTree v1.4 (http://tree.bio.ed.ac.uk/) or the freely available Archaeopteryx Java software [33]. Nucleotide similarities were estimated using a maximum composite likelihood model implemented in MEGA version 5.0 software.

GenBank accession numbers

All consensus genome assemblies generated in this study were submitted to NCBI's GenBank database (Accession numbers KF797891–KF797895, KF797896–KF797912, and KF797896–KF797912).

Results

In total, 90 blood samples from HTLV-1 infected individuals were included in the study. The participants' ages ranged between 31 and 81 years, and the median age was 56 years. Females constituted 68.9% (n = 62) of the study group. The median measurements of CD4 and CD8 lymphocyte percentage by flow cytometry (FACScan, Becton-Dickinson, Cowley, Oxford) were 45% and 22%, respectively, in 31% of subjects. The median proviral loads defined in this study in all the ACS, HAM/TSP and ATLL groups were 431 copies per 103 PBMCs (range, 2–420), 177 copies per 103 PBMCs (range, 4–1035) and 273 copies per 103 PBMCs (153–3279), respectively. The mean time to HTLV-1 diagnosis was 8.8±5.4 years. The characteristics of the 90 patients included in the study are summarized in .
Table 1

Demographic and Clinical Characteristics of the HTLV-1 Patients (n = 90).

Age (years)
Mean ±SD55.9±10.6
Median56
Range31–81
Gender (%)
Male62 (68.9)
Female28 (31.1)
Clinical status (%)
Asymptomatic carriers (ACs)48(53.3)
HAM/TSP35(38.9)
ATLL7(7.8)
1 Median lymphocyte subpopulations
% CD4 cells45
% CD8 cells22
2 Median proviral load/1000 PBMCs
Asymptomatic carriers43 (2–420)
HAM/TSP177 (4–1035)
ATLL224 (153–3297)
Mean follow-up after HTLV-1 diagnosis (years) 8.8±5.4

The median CD4 and CD8 percentage were measured in 31% of subjects (n = 28).

Patients with ATLL or HAM/TSP had significantly higher median proviral loads than ACs (P<0.001), while no significant difference was observed between the ATLL and HAM/TSP groups P = 0.06 (Mann-Whitney test).

The median CD4 and CD8 percentage were measured in 31% of subjects (n = 28). Patients with ATLL or HAM/TSP had significantly higher median proviral loads than ACs (P<0.001), while no significant difference was observed between the ATLL and HAM/TSP groups P = 0.06 (Mann-Whitney test). PCR amplifications were successful in all samples, even those harboring proviral copy numbers as low as 2 copies per 103 PBMCs. To assess the genetic variability of HTLV-1, the FLG sequences were successfully assembled into a single, high-quality contig in 76 HTLV-1 sequences, with the majority starting approximately at position 727 of the 5′ long terminal repeat (LTR) to the extreme 3′ LTR at position 9113 (average length of 8259 bp). No ambiguities were detected between the two overlapping sequences, indicating that errors due to PCR had little effect on the overall sequences of the proviral genome of these sequences. The read-through translation of the 5 open reading frames indicated that all complete coding sequences obtained in this study were intact and in frame. There were several nucleotide substitutions in the complete coding regions. Among these, we found 29 specific nucleotides that were always simultaneously substituted in 27 participants and were identical to the prototype Japanese ATK (sub-subtype aB, GenBank accession number J02029) ( ). Almost all of these substitutions were detected in 13 of 43 asymptomatic carriers, 12 of 31 HAM/TSP patients and 2 of 6 patients with ATLL. In 10 cases with such nucleotide substitutions, several other base substitutions were always simultaneously observed ( ). Close inspection of the BI tree inferred from the complete coding region alignment indicated that the viral sequences from these 10 cases clustered closely, forming a monophyletic lineage that falls into the transcontinental sub-subtype A cluster ( , highlighted in yellow). These results clearly indicate that variations in HTLV-1 are not randomly distributed but seem to be arranged in hot spots.
Table 2

Alignment of nucleotide variations detected simultaneously in the HTLV-1 proviral complete coding region from 27 participants.

1028110811481382212121682503281428442937294029913249348935193612392041304182426047254749478348665191560256956376659367326793690769237003700970937147718372427254736778807940826182798357
ATK J02029GCCTCGAGCAACCTAAGGGCCTTTGTTGTTCGCTTTTGAGCTCGTG
012BR_ATL003_HC..............................................
012BR_ATL005_HC..............................................
012BR_HAM011_HC...............g.................c............
012BR_HAM013_HC...............g.................c............
012BR_ASY013..............................................
012BR_HAM114........t.....................................
012BR_ASY016.........g.t.........cc.a......at....a........
012BR_HAM019_HC..............................................
012BR_HAM020_HC..............................................
012BR_ASY032................a.............................
012BR_ASY036----.....g....................................
012BR_ASY037..............................................
012BR_ASY040..............................................
012BR_ASY042..............................................
012BR_HAM107.....................g........................
012BR_HAM426-------.......................................
012BR_HAM452..............................................
012BR_ASY008 att......g.t.....a.t.ccca......atc...a.....a.a
012BR_ASY014_HC att......g.t.....a.t.ccca......atc...a.....a.a
012BR_HAM016_HC -tt......g.t.....a.t.ccca......atc...a.....---
012BR_ASY045 att......g.t.....a.t.ccca......atc...a.....a.a
012BR_ASY049 att......g.t.....a.t.ccca......atc...a.....a.a
012BR_HAM086 att......g.t.....a.t.ccca......atc...a.....a.a
012BR_HAM093 att......g.t.....a.t.ccca..a...att...a.....a.a
012BR_ASY097 att......g.t.....a.t.ccca......atc...a.....a.a
012BR_ASY098 att......g.t.....a.t.ccc-..a...atc...a.....a.a
012BR_HAM099 att......g.t.....a.t.ccca......atc...a.....a.a
AY563953_aA...cattatgg.tcgca.a.t....gcacgt...ccc.gatct.c.

Dashes indicate gaps; dots indicate identity with the prototype Japanese ATK (sub-subtype aB, GenBank accession number J02029). Nucleotide substitutions are enclosed in boxes. Sequences written in italics displayed additional simultaneous base substitutions.

Figure 1

Phylogenetic tree of HTLV-1 sub-subtypes based on Bayesian Inference analysis of the complete coding region sequences (7593 bp, nucleotide 804–8397 according to position in B1033-2009 “GenBank accession no. AB513134”) of 76 participant samples.

Colored (blue, sub-subtype aA; red, sub-subtype aB) and black branches represent patient samples and reference sequences from all verified sub-subtypes, respectively. Sequences displayed simultaneous base substitutions over the complete coding region (see Table 2) and formed a monophyletic cluster are indicated by yellow box. For clarity, the tree was midpoint rooted. Values at the nodes represent Bayesian probabilities.

Phylogenetic tree of HTLV-1 sub-subtypes based on Bayesian Inference analysis of the complete coding region sequences (7593 bp, nucleotide 804–8397 according to position in B1033-2009 “GenBank accession no. AB513134”) of 76 participant samples.

Colored (blue, sub-subtype aA; red, sub-subtype aB) and black branches represent patient samples and reference sequences from all verified sub-subtypes, respectively. Sequences displayed simultaneous base substitutions over the complete coding region (see Table 2) and formed a monophyletic cluster are indicated by yellow box. For clarity, the tree was midpoint rooted. Values at the nodes represent Bayesian probabilities. Dashes indicate gaps; dots indicate identity with the prototype Japanese ATK (sub-subtype aB, GenBank accession number J02029). Nucleotide substitutions are enclosed in boxes. Sequences written in italics displayed additional simultaneous base substitutions. The BI tree analysis from the complete coding region determined that HTLV-1 strains from our patients belonged to the cosmopolitan transcontinental sub-subtypes or HTLV-1 aA, except for 3 (4%) samples (012BR ATL003 HC, 012BR ASY032, and 012BR ATL005 HC), which belonged to the Japanese HTLV-1 aB sub-subtypes and are represented in this tree by a single branch ( ). The HTLV-1 aA was detected in all patients with HAM/TSP, 40 of 41 ASCs, and 4 of 6 patients with ATLL. No distinctive mutations were observed among the viral sequences from the three clinical groups. Neither the ASCs nor the HAM/TSP or ATLL sequences formed a unique cluster. The maximum nucleotide distances within each group were 0.5%, 0.7% and 0.5% in the TSP/HAM, ATLL and asymptomatic HTLV-1 infected patients, respectively. The complete genomes of HTLV-1 aA had a mean nucleotide divergence from HTLV-1 aB of 1% ( ). Based on the latter analysis, it was hard to determine the relationship between viral sequence and virulence. Furthermore, HTLV-1 aA had a slightly higher intragroup divergence than sequences belonging to HTLV-1 aB. The sequence analysis of the tax gene of the sequences with complete coding regions confirmed the presence of the complete set of four polymorphic sites [34] characteristic of tax A in 73 (96%) samples, but the tax B profile was confirmed in only 3 (4%) strains, namely 012BR ATL003 HC, 012BR ASY032, and 012BR ATL005 HC, which clustered within the tax B sub-subtypes ( ).
Table 3

Comparison of the nucleotides of the transcontinental (A) and Japanese (B) sub-subtypes of the cosmopolitan genotype*.

Intragroup (%)Intergroup (%)
HTLV-1aAHTLV-1aBHTLV-1aA vs HTLV-1aB
Complete genome0.50.21.0
gag 0.30.20.8
polymerase0.40.30.8
envelope0.50.21.1
pX0.90.21.7

*The intra- and intergroup comparisons were performed with the new sequences generated in this study.

*The intra- and intergroup comparisons were performed with the new sequences generated in this study. Fourteen HTLV-1 sequences, identified by a phylogenetic tree from partial data as belonging to the HTLV-1 aA (n = 13) or HTLV-1 aB (n = 1) sub-subtypes (), failed to generate full genomic data by our deep sequencing method. The de novo assembly of the compiled genome from each of these sequences had an average sequencing depth ranging from 351–5713. When aligned to the B1033-2009 sequence, eight sequences displayed two contigs separated by a gap of less than 500 bp, suggesting the small size of most gaps (). Next, the intra-sample single nucleotide variability within each sample with partial and/or complete coding regions was investigated for potential quasispecies characterized by nucleotide substitutions. Based on our rigid criteria, the presence of genuine DNA variant could not be detected in any of the samples. Hence, it appeared that no minority viral variants were present in the 90 blood samples analyzed by illumina next generation sequencing. To further explore the genetic variation and subtype classifications within the HTLV subtype, all available LTR sequences (n = 88) were extracted from the HTLV complete and partial genomes of each subject and aligned with the LTR sequences representing all assigned subtypes and unassigned variants with a minimum length of 500 bp from the HTLV-1 molecular epidemiology database (http://htlv1db.bahia.fiocruz.br/). On the basis of a phylogenetic analysis of this region ( ), 84 subjects were classified as being infected with subtype aA, and 4 individuals were infected with subtype aB. Moreover, all sequences classified as subtype aA or aB on the basis of the complete coding region depicted in displayed a concordant subtype classification in LTR sub-genomic regions, suggesting the absence of inter-genomic recombination. As shown in , the LTR sequences from the current study (faint blue branches) were dispersed among other HTLV-1 aA sequences. Moreover, the phylogenies of subtype aA displayed no considerable grouping of sequences by clinical status. To investigate the origin of HTLV-1 subtypes in Brazil, we compiled the LTR data sets of the current study (n = 88 sequences) and all reference sequences (n = 297 sequences) for these subtypes from different geographic origins, including Brazil ( ). No significant unique cluster of Brazilian HTLV-1 aA was observed. Instead, these subtypes are all interspersed with strains from different geographic locations, mainly in South America, Europe, Africa and Asia. Seven of the 11 (4 ACs and 3 HAM/TSP) patients of Japanese descent (n = 11) or those who had sexual contact with a Japanese partner (n = 1) in this study were infected with HTLV-1 a grouped in a monophyletic cluster within the Japanese tax sequences that belong to the LTR sub-subtypes of cosmopolitan A ( ). This group was also separated by an excellent aLRT value (93%) in the complete coding region ( ). In the case of subtype bA ( ), the 4 LTRs from this study were sequenced from Japanese descendants and positioned with other Brazilian sequences in a main cluster of sequences that originated from Japan, Taiwan, Argentina and Colombia.
Figure 2

Phylogenetic tree of HTLV-1 sub-subtypes based on Bayesian Inference analysis from the long terminal repeat (LTR, 664 bp) of 88 participant samples and 279 HTLV-1 LTR sequences from the database representing 5 of the HTLV-1 subtypes.

The representatives of the 5 references are color-coded. Branches with posterior probabilities ≥0.70 are displayed with blank square.

Figure 3

Bayesian analysis of 297 long terminal repeat (LTR) sequences from various global locations (colored branch), including previously published Brazilian and other South American sequences from neighboring countries.

The tree also contains 88 sequences from the current study. Branches with posterior probabilities ≥0.70 are displayed (white dots).

Phylogenetic tree of HTLV-1 sub-subtypes based on Bayesian Inference analysis from the long terminal repeat (LTR, 664 bp) of 88 participant samples and 279 HTLV-1 LTR sequences from the database representing 5 of the HTLV-1 subtypes.

The representatives of the 5 references are color-coded. Branches with posterior probabilities ≥0.70 are displayed with blank square.

Bayesian analysis of 297 long terminal repeat (LTR) sequences from various global locations (colored branch), including previously published Brazilian and other South American sequences from neighboring countries.

The tree also contains 88 sequences from the current study. Branches with posterior probabilities ≥0.70 are displayed (white dots).

Discussion

Currently, there are only 15 complete sequences of HTLV-1 sequences in the GenBank and HTLV-1 molecular epidemiology databases (http://htlv1db.bahia.fiocruz.br/) that were classified as subtypes aA (n = 8), aB (n = 2), aC (n = 2) and 1b (n = 1) and 2 unassigned, for which some of the sequences have the country of sampling stated. Among these, there were 3 recovered from Brazil. The scarcity of these sequences prompted us to generate newer genetic materials of these viruses and to obtain more information on the molecular basis of HTLV-1 sequences in Brazil. To date, no study has employed second-generation sequencing techniques to examine HTLV-1 heterogeneity across entire genomes from different clinical settings. In this work, we used state-of-the-art Illumina MiSeq instrumentation to generate 76 and 14 HTLV-1 complete and partial genome sequences, respectively, from different ACs, HAM/TSP and ATLL clinical sources in a single run. Thus, the sequences described in this study quintuple the publicly available full genome sequence information for HTLV-1 viruses. Analysis indicates that the vast majority of subjects in this study was infected with the cosmopolitan genotype, mostly the transcontinental and more rarely the Japanese sub-subtypes, a finding that is in agreement with previous reports [35], [36], [37], [38]. Nevertheless, we obtained no evidence that a specific HTLV-1-subtypes or sub-subtypes are associated with a certain clinical status. This finding is in accordance with earlier studies demonstrating that the nucleotide substitutions in some fragments of the HTLV-1 genome were specific for the geographic origin of the patients rather than for the type of associated pathologies [36], [39], [40], [41]. Regardless of the patient's clinical status, sequence homogeneity between strains recovered from a common geographical origin is often seen. In the present study, 88 Brazilian HTLV-1 LTR sequences were extracted from their complete genomes and used to reconstruct the phylogenetic history of the virus in this country. This region has previously been shown to provide a sufficiently strong phylogenetic signal to allow the distinction of HTLV-1 sub-subtypes and contains a larger number of HTLV-1 sequences in the database [42]. It is important to note that the best resolution of evolutionary patterns is obtained from complete genomes. However, this was not possible because there were only a few HTLV-1 complete genome sequences publicly available. As expected, all of the transcontinental strains identified in this study were clustered in different branches with strains from different geographic origins in Europe, Africa, Asia and, mainly, South America, corresponding to the formerly named Latin American cluster. The grouping of the Brazilian HTLV-1 sequences into different subclusters support the hypothesis that there were multiple introductions of the transcontinental subtype in Brazil. These findings further support several studies conducted in some Brazilian and other Latin American populations that suggested the introduction of HTLV-1 on multiple occasions and that demonstrate an association between the Latin American cluster with sequences of African origin [37], [43], [44], [45], [46]. The results of detecting HTLV-1 aA and aB among patients of Japanese descent is consistent with previous data described among Japanese immigrants in Sao Paulo, where the detection of both sub-subtypes has been reported [17], [35], [47], [48]. In conclusion, we provided new full-length genome sequences of HTLV-1 from the different clinical setting determined by deep sequencing for two different variants. Therefore, this study has increased the number of subtype aA full-length genomes to 81 and HTLV-1 aB to 5 sequences. Together with other partial sequences, we confirmed that HTLV-1 subtype a transcontinental sub-subtypes A was the most prevalent in the Brazilian population. We believe that these data open avenues for further studies on the evolutionary relationships between the HTLV-1 subtypes and may contribute to the information on the genetic diversity of HTLV-1 worldwide. Schematic representation of the sequences that failed to generate full genomic data when subjected to our deep sequencing method. Consensus sequence reads were aligned and mapped to the Brazilian reference sequence (GenBank: AY563953.1) to define their genomic locations. The star symbol indicates proviral load (number of proviral copies per 1000 cells). The pilcrow symbol indicates the overall mean coverage depth. (TIF) Click here for additional data file.
  46 in total

1.  Design and development of a quantitative real time PCR assay for monitoring of HTLV-1 provirus in whole blood.

Authors:  Mahmood Naderi; Mahdi Paryan; Kayhan Azadmanesh; Houshang Rafatpanah; Houri Rezvan; Siamak Mirab Samiee
Journal:  J Clin Virol       Date:  2012-02-04       Impact factor: 3.168

2.  Sensitive and specific polymerase chain reaction assays for diagnosis of human T-cell lymphotropic virus type I (HTLV-I) and HTLV-II infections in HTLV-I/II-seropositive individuals.

Authors:  W Heneine; R F Khabbaz; R B Lal; J E Kaplan
Journal:  J Clin Microbiol       Date:  1992-06       Impact factor: 5.948

3.  MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.

Authors:  Koichiro Tamura; Daniel Peterson; Nicholas Peterson; Glen Stecher; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2011-05-04       Impact factor: 16.240

4.  Distribution of human T-lymphotropic virus type I among blood donors: a nationwide Brazilian study.

Authors:  B Galvão-Castro; L Loures; L G Rodriques; A Sereno; O C Ferreira Júnior; L G Franco; M Muller; D A Sampaio; A Santana; L M Passos; F Proietti
Journal:  Transfusion       Date:  1997-02       Impact factor: 3.157

5.  Distribution of human T cell lymphotropic virus type 1 (HTLV-1) subtypes in Brazil: genetic characterization of LTR and tax region.

Authors:  Simone Kashima; Luiz Carlos Alcantara; Osvaldo Massaiti Takayanagui; Marco Aurelio Valtas Cunha; Bernardo Galvão Castro; Maria Socorro Pombo-de-Oliveira; Marco Antonio Zago; Dimas Tadeu Covas
Journal:  AIDS Res Hum Retroviruses       Date:  2006-10       Impact factor: 2.205

6.  In vivo genomic variability of human T-cell leukemia virus type I depends more upon geography than upon pathologies.

Authors:  F Komurian; F Pelloquin; G de Thé
Journal:  J Virol       Date:  1991-07       Impact factor: 5.103

7.  Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemia and its implication in the disease.

Authors:  M Yoshida; I Miyoshi; Y Hinuma
Journal:  Proc Natl Acad Sci U S A       Date:  1982-03       Impact factor: 11.205

8.  Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma.

Authors:  B J Poiesz; F W Ruscetti; A F Gazdar; P A Bunn; J D Minna; R C Gallo
Journal:  Proc Natl Acad Sci U S A       Date:  1980-12       Impact factor: 11.205

9.  Correlation between LTR point mutations and proviral load levels among human T cell lymphotropic virus type 1 (HTLV-1) asymptomatic carriers.

Authors:  Walter K Neto; Antonio C Da-Costa; Ana Carolina S de Oliveira; Vanessa P Martinez; Youko Nukui; Ester C Sabino; Sabri S Sanabani
Journal:  Virol J       Date:  2011-12-13       Impact factor: 4.099

10.  MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space.

Authors:  Fredrik Ronquist; Maxim Teslenko; Paul van der Mark; Daniel L Ayres; Aaron Darling; Sebastian Höhna; Bret Larget; Liang Liu; Marc A Suchard; John P Huelsenbeck
Journal:  Syst Biol       Date:  2012-02-22       Impact factor: 15.683

View more
  20 in total

1.  miR-28-3p is a cellular restriction factor that inhibits human T cell leukemia virus, type 1 (HTLV-1) replication and virus infection.

Authors:  Xue Tao Bai; Christophe Nicot
Journal:  J Biol Chem       Date:  2015-01-07       Impact factor: 5.157

2.  First report of HTLV-1 truncated p12 protein in Brazil.

Authors:  Carolina Rosadas; Ana C P Vicente; Louise Zanella; Mauro J Cabral-Castro; José M Peralta; Marzia Puccioni-Sohler
Journal:  Virulence       Date:  2016-12-14       Impact factor: 5.882

3.  Pace of Coreceptor Tropism Switch in HIV-1-Infected Individuals after Recent Infection.

Authors:  Muhammad Shoaib Arif; James Hunter; Ana Rachel Léda; Jean Paulo Lopes Zukurov; Sadia Samer; Michelle Camargo; Juliana Galinskas; Esper Georges Kallás; Shirley Vasconcelos Komninakis; Luiz Mario Janini; Maria Cecilia Sucupira; Ricardo Sobhie Diaz
Journal:  J Virol       Date:  2017-09-12       Impact factor: 5.103

4.  Enhanced detection of viral diversity using partial and near full-length genomes of human immunodeficiency virus Type 1 provirus deep sequencing data from recently infected donors at four blood centers in Brazil.

Authors:  Rodrigo Pessôa; Jaqueline Tomoko Watanabe; Paula Calabria; Cecilia Salete Alencar; Paula Loureiro; Maria Esther Lopes; Anna Barbara Proetti; Alvina Clara Félix; Ester C Sabino; Michael P Busch; Sabri S Sanabani
Journal:  Transfusion       Date:  2014-11-21       Impact factor: 3.157

5.  Spread of Human T-Lymphotropic Virus 1 and 2 Among Relatives of People Who Use Illicit Drugs in Northern Brazil.

Authors:  Aldemir Branco Oliveira-Filho; Paula Cristina Rodrigues Frade; Ricardo Roberto de Souza Fonseca; Leila Sawada; Luísa Caricio Martins; Luiz Fernando Almeida Machado; Antonio Carlos Rosário Vallinoto; Ricardo Ishak; José Alexandre Rodrigues de Lemos; Benedikt Fischer; Emil Kupek
Journal:  Front Microbiol       Date:  2022-06-03       Impact factor: 6.064

Review 6.  HTLV-1: A real pathogen or a runaway guest of a diseased cell?

Authors:  L I B Kanzaki
Journal:  J Biosci       Date:  2018-09       Impact factor: 1.826

7.  Genetic Characterization of HIV-1 Subtype D Near-Full-Length Proviral Genomes by Illumina Massively Parallel Sequencing Technology.

Authors:  Rodrigo Pessôa; Maria Esther Lopes; Sabri S Sanabani
Journal:  Genome Announc       Date:  2014-06-12

8.  Identification of a Novel HIV-1 Circulating Recombinant Form (CRF72_BF1) in Deep Sequencing Data from Blood Donors in Southeastern Brazil.

Authors:  Rodrigo Pessôa; Anna Bárbara de Freitas Carneiro Proietti; Michael P Busch; Sabri S Sanabani
Journal:  Genome Announc       Date:  2014-06-12

9.  Deep sequencing of HIV-1 near full-length proviral genomes identifies high rates of BF1 recombinants including two novel circulating recombinant forms (CRF) 70_BF1 and a disseminating 71_BF1 among blood donors in Pernambuco, Brazil.

Authors:  Rodrigo Pessôa; Jaqueline Tomoko Watanabe; Paula Calabria; Alvina Clara Felix; Paula Loureiro; Ester C Sabino; Michael P Busch; Sabri S Sanabani
Journal:  PLoS One       Date:  2014-11-17       Impact factor: 3.240

10.  Ultra-Deep Sequencing of HIV-1 near Full-Length and Partial Proviral Genomes Reveals High Genetic Diversity among Brazilian Blood Donors.

Authors:  Rodrigo Pessôa; Paula Loureiro; Maria Esther Lopes; Anna B F Carneiro-Proietti; Ester C Sabino; Michael P Busch; Sabri S Sanabani
Journal:  PLoS One       Date:  2016-03-31       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.