Two enhancers control transcription of Drosophila muscleblind in the embryonic somatic musculature and in the central nervous system.

The phylogenetically conserved family of Muscleblind proteins are RNA-binding factors involved in a variety of gene expression processes including alternative splicing regulation, RNA stability and subcellular localization, and miRNA biogenesis, which typically contribute to cell-type specific differentiation. In humans, sequestration of Muscleblind-like proteins MBNL1 and MBNL2 has been implicated in degenerative disorders, particularly expansion diseases such as myotonic dystrophy type 1 and 2. Drosophila muscleblind was previously shown to be expressed in embryonic somatic and visceral muscle subtypes, and in the central nervous system, and to depend on Mef2 for transcriptional activation. Genomic approaches have pointed out candidate gene promoters and tissue-specific enhancers, but experimental confirmation of their regulatory roles was lacking. In our study, luciferase reporter assays in S2 cells confirmed that regions P1 (515 bp) and P2 (573 bp), involving the beginning of exon 1 and exon 2, respectively, were able to initiate RNA transcription. Similarly, transgenic Drosophila embryos carrying enhancer reporter constructs supported the existence of two regulatory regions which control embryonic expression of muscleblind in the central nerve cord (NE, neural enhancer; 830 bp) and somatic (skeletal) musculature (ME, muscle enhancer; 3.3 kb). Both NE and ME were able to boost expression from the Hsp70 heterologous promoter. In S2 cell assays most of the ME enhancer activation could be further narrowed down to a 1200 bp subregion (ME.3), which contains predicted binding sites for the Mef2 transcription factor. The present study constitutes the first characterization of muscleblind enhancers and will contribute to a deeper understanding of the transcriptional regulation of the gene.

Introduction

Muscleblind proteins were initially identified in Drosophila and associated to the development of the embryonic peripheral nervous system [1], the muscles [2] and the adult photoreceptors [3]. They were later found to regulate alternative splicing of defined pre-mRNAs by binding to specific consensus sequences and to hairpins containing pyrimidine mismatches through conserved zinc finger motifs of the CCCH type ([4], [5] and reviewed in [6]). Muscleblind target transcripts encode cell adhesion and cytoskeleton components, proteins involved in muscle excitation and contraction, structural proteins in muscle sarcomere and signalling molecules, among others [5], [7], [8], [9], [10], [11]. Through alternative splicing musclebIind transcripts themselves generate at least fourteen transcript isoforms. Most of them share common 5′ sequences but differ at the 3′-ends, encoding proteins of different lengths and carboxyl termini. The muscleblind transcriptional unit is large and has a complex organization with ten exons distributed over about thirty times more than the average gene length in Drosophila [5], [12].

In contrast to Drosophila, which has a single gene, three Muscleblind-like homologs (MBNL1, MBNL2, and MBNL3) exist in humans and mice [13], [14]. Although recent results have highlighted MBNL proteins as regulators of messenger RNA (mRNA) stability [15], [16], [17], localization [10], [18] or miRNA biogenesis [19] in the cytoplasm, these proteins are particularly well-known for their nuclear function as alternative splicing regulators. MBNL1 plays a primary role in alternative splicing allowing the fetal-to-adult splicing transitions needed for development of skeletal and cardiac muscle whereas MBNL2 seems to perform a similar function in the central nervous system [20], [21]. Similarly, MBNL1 and MBNL2 are direct negative regulators of a large program of cassette exon alternative splicing events that are differentially regulated between embryonic stem cells and other cell types [22]. In contrast, MBNL3 has been reported as a member of the family with unusual functions. MBNL3 antagonizes muscle differentiation by promoting exclusion of the alternatively spliced β-exon of Myocyte enhancer factor 2D (Mef2D) [23] and also by the inhibition of myogenesis by maintaining myoblasts in a proliferative state [24], [25]. As a result of this regulation a negative correlation exists between MBNL1 and MBNL3 expression levels in muscle during development when MBNL3 is mainly detected during embryonic development, but also transiently during injury-induced adult skeletal muscle regeneration [13], [26]. MBNL1 and MBNL2 have a similar expression pattern in skeletal and heart muscle, kidney, liver, lung, intestine, brain and placenta. However, MBNL1 expression in skeletal muscle is higher than MBNL2 [13], [25].

Drosophila Muscleblind shows tissue-specific expression during development. In eye-antennal imaginal discs Muscleblind is required for the formation of photoreceptor rhabdomeres, identifying muscleblind as a general factor required for terminal differentiation of adult ommatidia [3]. Its expression was also reported in the embryonic central nervous system and in the somatic muscles, where disruption of muscleblind caused defects on muscle attachments to the epidermis and disrupted Z-band formation in muscle sarcomeres [2]. Recent studies have revealed a role for muscleblind in the myoblast fusion process through a splice-independent regulation of muscle protein 20 (Mp20), a gene that promotes myoblast fusion [11]. Consistent with its function during terminal muscle differentiation, Drosophila Myocyte enhancer factor 2 (Mef2) activates muscleblind in embryos, placing this gene downstream of Mef2 function in the myogenic differentiation program in flies [2]. The muscleblind chaste mutation has revealed that the gene is not only required during embryo development but also in adult brain, where it is necessary for the normal development of neural circuitry that regulate female sexual receptivity [27].

Muscleblind-like proteins are critically involved in many pathogenesis pathways, but most notably in myotonic dystrophies type 1 and type 2 (DM1 and DM2; reviewed in [6], [28]). DM1 is caused by the expansion of the unstable CTG triplet in the 3′untranslated region of the Dystrophia Myotonica Protein Kinase (DMPK) gene [29]. DM2 patients carry an unstable CCTG repeat expansion in intron 1 of CCCH-type zinc finger nucleic acid binding protein (CNBP) [30]. In both cases, transcribed repeat expansions form ribonuclear foci that have the ability to sequester, among others, MBNL proteins, which are therefore depleted from their normal functions [14], [31], [32]. DM1 and DM2 are typically regarded as muscular diseases but many other organs are also affected resulting in eye cataracts, cognitive dysfunction and cardiac conduction defects.

Despite biomedical and developmental relevance, the knowledge on the transcriptional regulation of muscleblind genes, particularly in Drosophila and in humans, is extremely limited. With the aim to fill this gap, in this study we have performed in silico and in vivo analyses to define gene promoters and tissue-specific cis-regulatory regions that control Drosophila muscleblind expression. Using a candidate approach, we have identified two putative gene promoters, located in exon 1 and exon 2, and have confirmed two intronic regions with the ability to drive expression to embryonic somatic muscle and the nerve cord. This constitutes the first description of tissue-specific enhancers and provides new insights into the muscleblind gene.

Results

1. Mapping of the Promoter Regions of Drosophila muscleblind

The analysis of available cDNA sequences and expressed sequence tags (EST) involving the muscleblind locus showed that 5′-end sequences clustered to two locations in the gene, to the beginning of exon 1 and to the beginning of exon 2 (Fig. 1B), which suggests that muscleblind might have two transcription start sites (TSS). To test this hypothesis we defined two regions as potential promoters of muscleblind. P1 ranged from −180 to +335 (515 bp long) while P2 spanned from −243 to +343 (586 bp long) (Fig. 1), defining as +1 the first bp in exon 1 and exon 2, respectively. Although core promoter regions are typically defined as +50 to −50 of transcription start site [33], a longer region was used to include not only the core promoter but also proximal promoter sequences with potential activator binding sites.

Figure 1

Organization of the muscleblind genomic region.

(A) Representation of 90 kb of the Drosophila melanogaster muscleblind gene. Green boxes represent exons and black lines introns. Representation according to [5]. Candidate promoter regions P1 and P2, and their shorter versions P1.1 and P2.1, are indicated. Black arrows denote putative transcription start sites located in exons 1 and 2. (B) 5′-Ends of ESTs mapping to the muscleblind gene, according to the UCSC Genome Browser, suggest that most transcripts start in exon 1 and 2. Genomic context around exon 1 (C) and exon 2 (D). Exonic sequence is in capital letters, P1 and P2 are highlighted in blue (GenBank accession numbers KJ398152 and KJ398154, respectively), and P1.1 and P2.1 are underlined (GenBank accession numbers KJ398151 and KJ398153, respectively). Blue boxes denote promoter consensus sequences with Sig value greater than 7 according to Scope (significant by default). (E) Relative luciferase activity from transiently transfected Drosophila S2 cells. Luciferase activity was stronger from P1 (or P1.1) than from P2 (or P2.1) promoters. Luciferase activity was measured 48 h after transfection. Renilla expression levels were used to normalize cell number, transfection efficiency, and general effects on gene transcription. All data were also normalized to luciferase levels of the empty vector pGL3 Basic. ***P<0.001. Bar graph shows means+s.e.m. from three independent experiments with three technical replicates each.

A SCOPE database analysis of Drosophila promoter elements [34] confirmed the accumulation of known consensus sequences in P1 and P2, thus supporting their potential as promoter regions (Fig. 1 C,D). Furthermore, these motifs were phylogenetically conserved among Drosophila species in the Multiz Alignments & phastCons Scores provided by the UCSC, supporting the relevance of these non-coding regions (data not shown). To test the functional relevance of the putative promoters we generated reporter constructs in which P1 and P2 drove expression of Firefly luciferase. In addition, we also tested the activity of shorter versions, contained in the longer ones, of 220 bp long (−104 to +116; P1.1) and 397 bp long (−81 to +316; P2.1), respectively, in an attempt to define minimal promoters. Dual luciferase reporter assays in Drosophila S2 cells transfected with the resulting constructs revealed that P1 was able to boost luciferase readings more than 100 fold higher relative to the promoter-less control. This was 2.5 fold the transcription measured for P1.1, 12 fold higher than the luciferase activity driven by P2 and 7 times the activity measured for P2.1 (Fig. 1). Thus, robust expression of luciferase was observed in P1 constructs in comparison to reporter expression driven by P2, and the higher activity obtained with P1 in comparison to P1.1 suggests that P1 contains proximal promoter elements that are not included in P1.1.

2. Identification of Putative cis-regulatory Modules

Potential cis-regulatory elements of transcription can be identified as highly conserved non-coding regions in phylogenetic footprinting analyses (as an example see [35]). A fragment of 120 kb harbouring most of the muscleblind gene, plus 20 kb upstream of the gene (complete sequence analyzed chr2R: 13133058–13252891), was used as the reference DNA to align orthologous sequences from 12 Drosophilids. Using the bioinformatics tool rVista, an intronic sequence showing above 90% identity in a 100 bp window between Drosophila melanogaster and D.mojavensis was selected. This sequence, refered to as H region, was 872 bp long and was located in intron 2 (Fig. 2 and Table 1). Moreover, chromatin immunoprecipitation followed by microarray analysis (ChIP-on-chip) data revealed putative cis-regulatory modules (CRMs) M1, M2, M3 and ML (Fig. 2 and Table 1) in the muscleblind locus that bound Drosophila Mef2 [36], [37], [38]. We found these results particularly relevant because Mef2 is a known activator of muscleblind expression in the Drosophila embryo [2]. Interestingly, these candidate CRMs not only bind Mef2 in ChIP-on-chip experiments but also other muscle organizing factors such as Biniou (Bin), Tinman (Tin) or Twist (Table 1). The ML region only bound Mef2 in late embryos according to [37].

Figure 2

ME reproduces muscleblind expression in the embryonic somatic musculature.

(A) Localization of the putative cis-regulatory modules M1, M2, ML, H and M3, indicated as orange boxes, in the context of the muscleblind genomic locus. Fluorescence confocal images of lateral (B,E,H,) and ventral (C,F,I,) views of late Drosophila embryos. (D,G) Schematic representation of the reporter constructs used to transform the germline of Drosophila. In control yw flies (B,C) an anti-Mbl antibody detects robust expression in the somatic musculature and in the CNS (green). Direct visualization of the GFP reporter under the control of the ME enhancer in the pH-Stinger vector (E,F,H,I). Promoter-less ME constructs (D–F) do not activate GFP expression and serve as negative controls. Flies carrying the ME enhancer upstream of Hsp70 (G–I) reproduce Muscleblind expression in the somatic musculature but not in the CNS. All micrographs were taken at 200× magnification. Anterior is to the left and dorsal up unless otherwise stated.

Table 1

Putative cis-regulatory modules (CRMs) chosen for in vivo testing of reporter expression.

CRM	Location	Size (bp)	TF binding sites
M1	Upstream	2278	1 Twi
			6 Mef2
			1 Bin
M2	Intron 2	3340	2 Mef2
			3 Bin
M3	Exon 4	1240	3 Mef2
			1 Bin
ML	Intron 2	830	3 Mef2
			1 Bin
H	Intron 2	872	0

All except region H according to [37].

3. In vivo Testing of Reporter Expression Reveals Tissue-specific Enhancers

To test the regulatory potential of the highly conserved (H) and the Mef2-bound (M1, M2, M3 and ML) genomic regions involving the muscleblind locus, we generated fusion constructs in the Drosophila transformation vector pH-Stinger. This vector contains the heat shock protein 70 (Hsp70) promoter and is specifically designed to avoid chromatin configuration effects (“position effects”) by flanking the eGFP reporter cDNA with two copies of insulator sequences from the gypsy transposon [39]. Embryonic expression of the eGFP was assessed either directly (green fluorescence) (Fig. 2) or immunodetecting the reporter protein with a polyclonal anti-GFP antibody (Fig. 3). Only embryos carrying reporter constructs under the control of the M2 and ML candidate CRMs revealed consistent patterns (Fig. 2 ; Fig. 3; and not shown) and in both cases eGFP expression was restricted to nuclei, as expected by the presence of a nuclear localization signal in the vector.

Figure 3

NE reproduces muscleblind expression in the central nervous system.

(A) Schematic representation of the reporter construct used to transform the Drosophila germline. Fluorescence confocal images of lateral (B–D) and ventral (E–J) views of late Drosophila embryos expressing construct (A) co-stained with anti-GFP (green) and anti-Mbl antibodies (red). NE drives expression in the CNS (arrows; C,I) overlapping Muscleblind expression (B,E,H; D,G,J shows the merge in yellow). No signal of the reporter was observed in tissues other than CNS. Endogenous Muscleblind expression in the muscles is in focus in (E,G,H,J). Micrographs were taken at 200× (B–G) and 400× magnification (H–J). Anterior is to the left and dorsal up unless otherwise stated.

We have previously shown that Muscleblind is localized in the nuclei of embryonic pharyngeal, visceral and somatic muscles, in the larval photoreceptor system, and in repeated clusters of cells within the central nervous system [2], [3] (Fig. 2). In combination with the Hsp70 promoter, M2 drove robust eGFP expression in the somatic musculature of late embryos, approximately starting from stage 13. Notably, no eGFP expression was detected in other muscle derivatives or tissues where endogenous muscleblind is normally detected, particularly the CNS (Fig. 2). As control, we generated transgenics carrying a promoter-less M2:eGFP construct, which revealed no eGFP expression (Fig. 2), thus confirming that M2 had no promoter activity by itself but requires the presence of a promoter to exert its enhancer activity. Similarly, double eGFP and Muscleblind immunostaining of fly embryos carrying ML:eGFP constructs revealed that ML drove expression to clusters of cells in the ventral cord of late embryos that overlapped with those expressing endogenous Muscleblind (Fig. 3). First signal started at developmental stage 12 and no eGFP expression was detected in tissues other than the CNS. Consistently, ML included predicted binding sites for factors involved in nervous system development such as Ladybird early (Lbe), Ladybird late (Lbl), Krüppel (Kr) and Hunchback (Hb) [40], [41], [42], [43] (Fig. 4). In summary, these results support that M2 and ML are somatic muscle and CNS-specific enhancers of muscleblind, respectively, at least during embryonic development. We therefore renamed these candidate CRMs as “ME” (from muscle enhancer) and “NE” (from nervous system enhancer). Importantly, both ME and NE were capable of activating a heterologous promoter, a typical ability of transcriptional enhancer elements.

Figure 4

ME and NE boost P1 and P2 promoter activity, respectively.

(A) Schematic representation of the Firefly luciferase reporter constructs used to transiently transfect Drosophila S2 cells. (B) ME, but not NE, potentiates P1 or P1.1 promoter activity. Basal promoter activity of P1 is significantly higher than P1.1 in these assays. Conversely, NE, but not ME, weakly enhanced P2 or P2.1 promoter function (C), being the relative luciferase activity measured approximately one tenth of that from P1 or P1.1. (D) Reversed P1 and P1.1 promoters still responded to ME and NE, although at much lower levels, whereas P2 and P2.1 did not significantly change reporter expression. (E) ME (GenBank accession number KJ201027) was subdivided into three smaller regions of approximately 1 kb (ME.1, ME.2 and ME.3). ME.3 retained most of ME ability to boost expression, although only for P1.1 it reached statistical significance. ME.3 and NE (GenBank accession number KJ201028) sequences are enriched in consensus binding sites for Mef2 (underlined) (F) and nervous system (G) transcription factors according to the following code: Hunchback sites, underlined; Ladybird early and Ladybird late, bold; Krüppel, italics respectively. Predictions used the Jaspar and rVista programs.

4. Characterization of the Muscle and Nervous Enhancer Elements of muscleblind

To test the ability of ME and NE genomic regions to enhance transcription from the putative muscleblind promoters, we used luciferase reporter assays in Drosophila S2 cells. We used S2 cells because this is a well characterized cell line whereas muscle or neuron-specific cell lines were not immediately available. Both enhancer regions were cloned upstream to each of the putative promoters P1, P1.1, P2 and P2.1 in their forward (Fig. 4A) and reverse (not shown) orientations in the pGL3 basic vector, which carries the Firefly luciferase reporter. As controls, ME and NE were tested in promoter-less constructs and no luciferase activity was detected (data not shown), thus confirming that the enhancer regions do not have any transcriptional activity by themselves. When promoters were in the forward orientation we observed that the transcription originated from P1 and P1.1 was strongly enhanced by ME, whereas NE had no effect on P1.1, or even decreased transcription when in combination with P1 (Fig. 4). Similarly, P2 and P2.1 promoter activity was significantly enhanced by NE (around 30% and 20%, respectively), but remained unchanged when in combination with ME that even repressed transcription from P2.1 (Fig. 4). As control of promoter directionality, luciferase levels of constructs carrying promoters in their reverse orientation were measured. Consistently, relative luciferase readings dropped to close to background levels in constructs containing promoters in their reverse orientation (Fig. 4 compare B,C with D), although both ME and NE still managed to significantly potentiate transcription from P1 and P1.1. Thus, promoter activity is orientation-dependent, as reversed promoters expressed significantly less luciferase reporter, and the activity of the ME and NE enhancers on P1 and P2 suggests enhancer-promoter communication specificity.

ME function was further analyzed to narrow down sequences necessary for enhancer activity. This involved testing three smaller regions, approximately 1 kb each, here referred to as ME.1, ME.2 and ME.3 according to their relative position in the original region (Fig. 4). These sequences were cloned upstream to the P1 and P1.1 promoters and were used in luciferase reporter assays in S2 cells (Fig. 4). Compared to the luciferase activity of the promoter alone, ME.3 was the only subregion able to significantly increase transcription from P1.1, also showing the same trend on the P1 promoter. Notably, all other subregions tested either did not boost expression from P1 or P1.1 or even inhibited it. Therefore, these data, and bioinformatics analyses support that ME.3 contains sequence motifs necessary for ME enhancing activity, including consensus Mef2 binding sites (Fig. 4), but they also suggest that for maximum enhancing activity all three subregions are required. Bioinformatics analyses in NE found an enrichment of targets for nervous system transcription factors (Fig. 4).

5. Functional Conservation of Human MBNL1 Promoter

Sequence conservation between Drosophila and human MBNL1 promoter sequences was patently non-existent. However, analysis of available cDNA sequences and ESTs in the MBNL1 locus suggested that human MBNL1 might also use TSS located in exon 1 and in exon 2 (Fig. 5). Consistently, putative TSS includes promoter marks such as CpG islands and histone modification tracks (Fig. 5). We defined 500 bp around the predicted start region from both exons to test them as putative human MBNL1 promoters; Hsa-P1 in exon 1 (chr3: 151985544–151985045) and Hsa-P2 in exon 2 (chr3: 152016823–152017382). Synthetic Hsa-P1 and Hsa-P2 sequences were designed to replace the Hsp70 promoter in the Drosophila transformation pH-Stinger vector. No eGFP expression was observed in transgenic fly embryos carrying any of the human promoters alone (data not shown and Fig. 5). However, we observed a robust expression of eGFP in the somatic musculature of embryos when ME drove expression of the Hsa-P1 promoter (Fig. 5 compare to Fig. 2). This expression was not observed in similar reporter constructs where Hsa-P2 replaced Hsa-P1 (ME-Hsa-P2; not shown). These data support that Hsa-P1 can initiate transcription, as we have also demonstrated for the muscleblind P1 promoter, and that ME is a muscle enhancer on a variety of promoters.

Figure 5

Genomic organization of the human MBNL1 gene.

(A) Scale representation of 198 kb of the human MBNL1 locus. Green boxes correspond to exons and black lines to introns. Tested promoter regions are indicated as P1 and P2; a yellow circle denotes a predicted CpG island. (B) Schematic representation of H3K27Ac marks, typical of promoter regions, on seven human cell lines. (C) 5′-Ends of ESTs mapping to the MBNL1 locus support two potential transcription start sites for the gene. Data according to the UCSC Genome Browser [58]. (E,F,H,I) Direct visualization of the eGFP reporter under the control of the ME enhancer. (D–F) Enhancer-less Hsa-P1 construct is a negative control. (G–I) Flies carrying the ME enhancer upstream of the human MBNL1 promoter (Hsa-P1) reproduce Muscleblind expression in the somatic musculature. (E,H) Lateral and (F,I) ventral views of late embryos. All micrographs were taken at 200× magnification. Anterior is to the left and dorsal up, unless otherwise stated.

Discussion

Muscleblind orthologues have attracted intense research interest due to their important role in vertebrate muscle development as well as involvement in several degenerative RNA-mediated diseases including DM1 and DM2, Huntingtońs disease, Huntington’s disease-like (HDL2) or spinocerebellar ataxia 8 (SCA8) [6], [44], [45], [46]. More recently, MBNL proteins were found to repress embryonic stem cell alternative splicing patterns, uncovering an additional role in the control of the cell pluripotency [22]. Despite this, little is known about the transcriptional regulation of muscleblind genes both in Drosophila and in vertebrates.

As a means of dissecting the cis-regulation of muscleblind, we analyzed a genomic DNA fragment harboring the muscleblind locus and its upstream region, looking for CRMs that regulate basal initiation of transcription (promoters) and tissue-specific expression (enhancers). In silico and in vivo studies identified two putative promoters, P1 in exon 1 and P2 in exon 2, and two intronic tissue-specific regulatory elements, a region of 3340 bp which drives specific expression in somatic muscle (ME) and a region of 830 bp which drives expression in central nervous system (NE). Both enhancers had been selected because of their enrichment in Mef2 binding sites according to ChIP-on-chip data [37], because Mef2 is a known positive regulator of muscleblind in the embryo [2]. Nevertheless, other enhancer elements must exist in order to explain the rich embryonic expression pattern of muscleblind, which also includes expression in visceral and pharyngeal musculature, the Bolwiǵs organ (the larval photoreceptor system) and the imaginal discs [2], [3]. Regarding this, putative CRMs that did not reproduce any embryonic pattern in our study can not be discarded as functional in other developmental stages.

Enhancer regions ME and NE were able to boost expression originating from the heterologous Hsp70 promoter in transgenic embryos. However, in luciferase S2 assays, ME preferentially activated the P1 promoter while NE showed preference for P2, although the enhancer activity of NE was smaller than that of ME and transcription arising from P2 was on average one tenth of that from P1 (Fig. 4). Our results in transgenic flies carrying the ME in combination with the human MBNL1 P1 promoter also suggest enhancer promoter specificity as ME only induced reporter expression from Hsa-P1, but not from Hsa-P2. The use of alternative promoters is a known mechanism of transcriptional regulation, which has been reported to influence levels of transcription, turnover or translation efficiency of mRNA isoforms with different leader exons, tissue specificity [47] and to generate protein isoforms differing in the amino termini (reviewed in [48]). Furthermore, different core promoters have been found to possess distinct regulatory activities driven by the same enhancer in the Drosophila embryo ([49]). In muscleblind, the potential in vivo use of P1 and P2 as alternative promoters would have no consequences as for the encoded protein since the start codon is located in exon 2, which is downstream of both. However, the in vivo relevance of the internal promoter P2 remains to be specifically addressed. It is also worth mentioning that whereas the identified enhancers provided strong activation of the reporter in vivo, particularly ME, the measured activation in S2 cells was discrete, reaching some 6-fold increase over the promoter alone condition (Fig. ). This may stem from the particular combination of transcription factors that S2 cells express, which may not be particularly favourable to activate myogenic enhancers. Mef2, for example, is weakly expressed in S2 cells according to modENCODE data [, and, consistently, Muscleblind is only barely detectable in this cell line [51]. Nevertheless, the low expression of Muscleblind in S2 cells offers an opportunity to test the activating potential of candidate regulatory transcription factors.

Despite that sequences homologous to ME or NE in human MBNL1 are not obvious, ENCODE Chip-seq data confirms that there is a high concentration of transcription factor binding sites in the first intron of MBNL1, including multiple MEF2A and MEF2C binding regions, thus suggesting that MEF2, a central regulator of diverse developmental programs [52], is also involved in the regulation of human MBNL1 transcription. Indeed, detailed information on the multiple transcription factors converging on the Drosophila ME and NE enhancer elements would help in the identification of the functionally equivalent enhancer regions that integrate inputs from the same factors in humans. Although hypothetical, the functional conservation among fly and human muscleblind enhancers is conceivable. Deformed enhancers, for example, drive meaningful spatial expression patterns in vivo in a mouse context [53]. In any event, this initial characterization of cis-regulatory regions is the first step towards the understanding of the transcriptional regulation of muscleblind.

Materials and Methods

Constructs

P1 and P2, and their shorter versions P1.1 and P2.1, promoter regions were synthesized by GenScript with NheI/XhoI terminal adapters and were provided cloned into the pUC57 vector. High fidelity PCR (KAPA HiFi DNA Polymerase, KAPA biosytems) was used to subclone into the pGL3-Basic vector (Promega) previously linearized with the same enzymes. ME, ME.1, ME.2, ME.3 (spanning from 13170622–13171543, ME.1; 13171544–13172759, ME.2; 13172760–13173908, ME.3) and NE were obtained from Drosophila genomic DNA by high fidelity PCR and were cloned into KpnI/SacI digested pGL3-Basic vectors already including different promoter regions. To generate transgenic flies, M1, M2, M3, H and ML fragments were PCR amplified from genomic DNA and were cloned into the BglII and XbaI sites of the Drosophila expression vector pH-Stinger [54]. Synthetic Hsa-P1 and Hsa-P2 promoter regions, including PstI, BglII, XhoI (5′) and HindIII, PstI (3′) adapter sites, were cloned into the pUC57 vector and subsequently transferred to the PstI site of the pH-Stinger vector. To generate ME-Hsa-P1 and ME-Hsa-P2 constructs, M2 was amplified with specific oligos containing BglII/XhoI adapters, digested, and cloned into the corresponding sites of the pH-Stinger vector already containing the candidate human promoters. All constructs were confirmed by sequencing. Description of used primers is in Table 2.

Table 2

Sequence and melting temperature (Tm) of PCR primers used for cloning genomic DNA.

Primer pair	Forward 5′→3′	Tm	Reverse 5′→3′	Tm
M1 pH-Stinger	GAAGATCTCGGTTCGACGTGACTTTTGC	70,1	GCTCTAGATAATAATAGATAATAAATATGG	52.2
M2 pH-Stinger	GAAGATCTCTCGACAAACAATTGTCAG	66.8	GCTCTAGATGCCGATGACGTTTCAAT	70.6
M3 pH-Stinger	GAAGATCTTGAGTTTCGGTCTGATGCC	66.9	GCTCTAGAATGCATTTCAAATTTTGG	62.0
H pH-Stinger	GAAGATCTACTCTTTGTCTATTTTCAC	52.3	GCTCTAGACATGCCATTGTGGAAAAGC	67.5
ML pH-Stinger	GAAGATCTTAACCAGCAGTTGATGTCT	65.5	GCTCTAGATTTGCCTATCCCATCGGCA	74.2
P1 pGL3-Basic	ATTGCTAGCTTGAAGTTACTAAA	55.9	ATTCTCGAGGAACGACTTTCGACA	68.9
P1.1 pGL3-Basic	ATTGCTAGCGCAGAGAGTGAAAGA	67.2	ATTCTCGAGGTGACT GAGCAGAA	66.3
P2 pGL3-Basic	ATTGCTAGCTTGCATTCTGCATAA	65.5	ATTCTCGAGGGTTTTGAGTGCTCC	69.3
P2.1 pGL3-Basic	ATTGCTCGCATTTCTATTTATCTC	56.6	ATTCTCGAGCCTCTCGCGACAC	71.0
ME pGL3-Basic	TATGGTACCCTCGACAAACAATTGTCAG	69.9	ATTGAGCTCTGCCGATGACGTTTCAAT	73.4
NE pGL3-Basic	TATGGTACCTAACCAGCAGTTGATGTCT	67.2	ATTGAGCTCTTTGCCTATCCCATCGGCA	76.7
ME.1 pGL3-Basic	TATGGTACCCTCGACAAACAATTGTCAG	69.9	ATTGAGCTCTAACGGTCGGCAAAGG	72.3
ME.2 pGL3-Basic	TATGGTACCGTGTGCTGACGTCGTTAGG	74.1	ATTGAGCTCAAAGGCACAGGGTCC	72.0
ME.3 pGL3-Basic	TATGGTACCGGTTGACAAACGATTCGG	75.7	ATTGAGCTCTGCCGATGACGTTTCAAT	73.4

Restriction sites are highlighted in bold.

Cell Culture and Dual Luciferase Assays

Drosophila melanogaster Schneider 2 cells (S2) were cultured at 27°C in growing media containing 90% Schneideŕs insect media (Gibco), 10% heat inactivated fetal bovine serum (FBS), 100 units/ml of penicillin and 100 mg/ml of streptomycin. 48 h before transfection, 106 log-phase cells were transferred onto 24-well plates (300 μl per well). 4 μl of Cellfectin reagent (Invitrogen) in 200 μl of serum and antibiotic-free medium were used to co-transfect 450 ng of the pGL3 reporter plasmid of interest and 25 ng of Renilla luciferase. A GFP expressing vector served as transfection efficiency control. Cells were incubated 16 h with transfection mix, then media was replaced by Schneideŕs complete medium and the culture was additionally maintained 24 h at 27°C. Luciferase expression was monitorized using the Dual-Luciferase Reporter Assay System (Promega). Briefly, this involved adding 100 μl of lysis buffer per well, shaking for 15 min and transferring the lysate to a white 96-well plate with 40 μl of luciferase substrate. After 10 s of luminescence detection, Stop&Glo buffer was added and luminescence measurement was repeated. Luminescence readings used an EnVision plate reader (PerkinElmer). In cell culture luciferase reporter assays, all graphs show the average of three independent experiments with three technical replicates each. P-values were obtained using a two-tailed, non-paired t-test (α = 0.05). Welch’s correction was applied when variances were significantly different.

Immunohistochemistry of Drosophila Embryos

Embryos were fixed for 20 min using 4% paraformaldehyde in PBS, devitelinized with a heptane:methanol 1∶1 mixture, and blocked with 0.1% Triton-X-100 in PBS (PBT) with 1% BSA for 15 min and later with 2% BSA in PBT for 30 min. Subsequently they were incubated with rabbit anti-GFP (1∶200 Torrey Pines Biolabs) antibody diluted in blocking solution containing 1% donkey serum for 2 h at room temperature. After washes embryos were incubated with an anti-rabbit-FITC (1∶200 Calbiochem) secondary antibody for 45 min. Muscleblind detection used sheep anti-Muscleblind (1∶500 [55]) for 2 h followed by washes and primary antibody recognition with sheep biotin-conjugated secondary antibody (1∶100, Sigma) for 2 h. Then, washed embryos were incubated with ABC solution (ABC kit, VECTASTAIN) for 30 min at room temperature, and were washed and incubated with streptavidin-Texas Red (1∶1000, Vector) for 45 min. In all cases embryos were washed 3× with 1% BSA in PBT and were mounted in Vectashield (Vector) with 2 μg/ml DAPI. Images were taken on an Olympus FluoView FV100 confocal microscope. At least 10–15 embryos of the desired stage, and showing the relevant expression patterns, were analyzed.

Drosophila Strains and Transgenics

Genomic DNA was extracted from the Drosophila genome project strain y (Bloomington Drosophila Stock Center, Bloomington IN). y flies were also from Bloomington IN. All constructs were injected into w embryos by BestGene, typically resulting in 2–6 independent transgenic lines.

Web Resources

Predictions of transcription factor binding sites used JASPAR [56]. Phylogenetic conservation employed the Whole Genome rVISTA browser [57]. EST mapping was according to the UCSC Genome Browser database [58]. Predicted promoter consensus sequences used Suite for Computational Identification of Promoter Elements (SCOPE) [34]. Genomes of reference were Drosophila BDGP R5/dm3 and human GRCh37releases.