Y Feng1, J Zhu2, C Ou3, Z Deng4, M Chen3, W Huang5, L Li6. 1. 1] State Key Laboratory of Oncology in South China, Sun Yat-sen University Cancer Center; Collaborative Innovation Center for Cancer Medicine, 651 Dongfeng Road East, Guangzhou 510060, PR China [2] Department of Surgery, the Fourth Affiliated Hospital of Guangzhou Medical University, Guangzhou 511447, PR China. 2. Department of Pathology, First Affiliated Hospital of Sun Yat-Sen University, Guangzhou 510080, PR China. 3. Department of Cardiology, Zhujiang Hospital of Southern Medical University, Guangzhou 510280, PR China. 4. Department of Surgery, Affiliated Xixiang People's Hospital of Guangdong Medical College, Shenzhen 518102, PR China. 5. 1] State Key Laboratory of Oncology in South China, Sun Yat-sen University Cancer Center; Collaborative Innovation Center for Cancer Medicine, 651 Dongfeng Road East, Guangzhou 510060, PR China [2] State Key Laboratory of Targeted Drug for Tumors of Guangdong Province, Guangzhou Double Bioproduct Inc, Guangzhou 510060, PR China. 6. State Key Laboratory of Oncology in South China, Sun Yat-sen University Cancer Center; Collaborative Innovation Center for Cancer Medicine, 651 Dongfeng Road East, Guangzhou 510060, PR China.
Abstract
BACKGROUND: Recent studies have reported miR-145 dysregulated in colorectal cancer (CRC). In this study, miR-145 profiles were compared between CRC and corresponding non-tumour tissues. METHODS: The expression levels of miR-145 were analysed in CRC cell lines and tumour tissues by real-time PCR. A luciferase reporter assay confirmed direct targets. The functional effects of miR-145 were examined in transfected CRC cells in vitro and in vivo using established assays. RESULTS: Downregulation of miR-145 was detected in most primary CRC tumours, and was significantly correlated with a more aggressive phenotype of CRC in patients. In CRC cell lines, ectopic overexpression of miR-145 inhibited cell proliferation, motility and invasion in vitro. Stable overexpression of miR-145 suppressed tumour growth and pulmonary metastasis in vivo. Further studies indicated that miR-145 may directly interact with the 3'-untranslated region (3'-UTR) of Fascin-1 messenger RNA (mRNA), downregulating its mRNA and protein expression levels. In clinical specimens, Fascin-1 expression was negatively correlated with miR-145 expression. CONCLUSIONS: MiR-145 has a critical role in the inhibition of invasive and metastatic capacities of CRC, probably through directly targeting Fascin-1. This miRNA may be involved in the development and progression of CRC.
BACKGROUND: Recent studies have reported miR-145 dysregulated in colorectal cancer (CRC). In this study, miR-145 profiles were compared between CRC and corresponding non-tumour tissues. METHODS: The expression levels of miR-145 were analysed in CRC cell lines and tumour tissues by real-time PCR. A luciferase reporter assay confirmed direct targets. The functional effects of miR-145 were examined in transfected CRC cells in vitro and in vivo using established assays. RESULTS: Downregulation of miR-145 was detected in most primary CRC tumours, and was significantly correlated with a more aggressive phenotype of CRC in patients. In CRC cell lines, ectopic overexpression of miR-145 inhibited cell proliferation, motility and invasion in vitro. Stable overexpression of miR-145 suppressed tumour growth and pulmonary metastasis in vivo. Further studies indicated that miR-145 may directly interact with the 3'-untranslated region (3'-UTR) of Fascin-1 messenger RNA (mRNA), downregulating its mRNA and protein expression levels. In clinical specimens, Fascin-1 expression was negatively correlated with miR-145 expression. CONCLUSIONS:MiR-145 has a critical role in the inhibition of invasive and metastatic capacities of CRC, probably through directly targeting Fascin-1. This miRNA may be involved in the development and progression of CRC.
Colorectal cancer (CRC) is one of the most common malignancies worldwide (Weitz ), with a high capacity for tumour migration and invasion. The development of CRC from normal epithelial cells to malignant carcinomas is believed to be a multistage process involving genetic changes, leading to the activation of oncogenes and inactivation of tumour suppressor genes. Although migration and invasion have been acknowledged as the most lethal attributes of solid tumours, the underlying molecular mechanisms are largely unknown. Therefore, the identification of novel molecules that are differentially expressed in CRC cells may provide insights into the mechanisms involved.Recently, the categories of cancer-related genes have been expanded to include microRNAs (miRNAs) (Esquela-Kerscher and Slack, 2006; Medina and Slack, 2008; Visone and Croce, 2009). This large family of highly conserved small non-coding RNAs may regulate a vast number of protein-coding genes, including oncogenes and tumour suppressor genes, which suggests that miRNAs can function as tumour suppressors or oncogenes. Many miRNAs are highly tissue-specific and important for cell development and differentiation. As such, the aberrant expression of miRNAs can lead to cellular dedifferentiation, oncogenesis, cancer metastasis and tumour invasion (Esquela-Kerscher and Slack, 2006). The first report of the involvement of an miRNA in CRC appeared in 2003, when Michael found the reduced accumulation of miR-145 in colorectal neoplasia compared with normal mucosa . Since then, there have been frequent reports of aberrant miRNA expression in CRC (Akao ; Lanza ; Asangani ; Yang ), suggesting a close correlation between miRNAs and the development, progression, metastasis, and prognosis of CRC. MiR-145 has been found to be downregulated in CRC, and has therefore been proposed as a metastasis-suppressor miRNA (Luo ). MiR-145 has mostly been reported as downregulated among the 164 miRNAs that have been identified as dysregulated, and has been reported to regulate a set of metastatic genes that includes ADAM17 (Lu ), Fascin-1 (Liu ), and mucin 1 (MUC1) (Sachdeva and Mo, 2010). Despite an increasing number of studies on the biogenesis and mechanisms of miR-145 in the pathogenesis of CRC, the mechanisms of miR-145 dysregulation are still unclear.
Materials and Methods
Cell culture and transfection
Five human CRC cell lines (SW480, HT29, LS174T, SW620, and LoVo) and the humanembryonic kidney cell line, 293T, were acquired from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and grown in Dulbecco's modified Eagle's medium (DMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Hy-Clone, Logan, UT, USA). Two normal colon epithelial cell lines (FHC and NCM460) were grown in DMEM:F12 (GIBCO, Grand Island, NY, USA) supplemented with 10% FBS, or in M3:10TM medium (INCELL, San Antonio, TX, USA) supplemented with 10% FBS, respectively.The miRNAs and siRNAs were purchased from GenePharm (Shanghai, China) and transfected into the cells with Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol.
Human colorectal tumour tissue specimens
Forty-three of fresh CRC tissue samples (14 colon and 29 rectum) from CRC patients, and their matched normal mucosal tissues (>5 cm laterally from the edge of tumour region) were embedded, snap-frozen, and preserved at −80 °C. The samples had been clinically and histopathologically diagnosed at the First Affiliated Hospital of Sun Yat-sen University (Guangzhou, China) between January 2009 and October 2011. The histology of the disease was determined according to World Health Organization criteria. Histologically, all tumours were adenocarcinomas. No patient received neo-adjuvant therapy. Ethical approval for this study was obtained from the Institutional Research Ethics Committee.
Total RNA extraction and miRNA detection
Total RNA, including the small RNA fraction, was extracted from cultured CRC cells and tissues with TRIZOL Reagent (Invitrogen). Quantitative PCR (qPCR) was performed to detect the expression levels of miRNA and messenger RNA (mRNA). For the detection of miR-145, reverse transcription was performed using the One Step PrimeScript miRNA cDNA Synthesis Kit (Perfect Real Time, TaKaRa, Dalian, China). U6 snRNA was used for normalisation. For Fascin-1 mRNA detection, reverse transcription was performed using the PrimeScript RT Master Mix (Perfect Real Time, TaKaRa). Quantitative PCR was performed using SYBR Premix Ex Taq II (TliRNaseH Plus) (TaKaRa) in the LightCycler 480 (Roche Diagnostics, Indianapolis, IN, USA); β-actin mRNA was used for normalisation. Forward and reverse primers for Fascin-1 (78 bp) and β-actin (88 bp) were 5′-ATGTTGCCCAGGTTGAACTC-3′ and 5′-TCACACCTGAAATCCCAACA-3′, and 5′-GGCCGAGGACTTTGATTGCACATT-3′ and 5′-AGGATGGCAAGGGACTTCCTGTAA-3′, respectively. The qPCR results were analysed relative to miRNA or mRNA expression levels by converting CT (cycle threshold) values to fold changes.
Invasion and motility assays, and isolation of cell sublines
For the invasion assay, 1.0 × 105 cells were added to the upper chamber of each well of a 24-well Transwell polycarbonate membrane (8-μm pore size; Costar, Cambridge, MA, USA) coated with 30 mg cm−2 of Matrigel (BD Biosciences, San Jose, CA, USA). After samples were incubated for 16 h at 37 °C, cells on the upper membrane surface were removed, fixed, and stained with 0.2% crystal violet solution for 30 min. Invasive cells adhering to the undersurface of the filter were counted (five high-power fields per chamber) using an inverted microscope. The Transwell migration assay was performed in the same way as the invasion assay, but without the Matrigel coating.Subpopulations with low (L), middle (M), or high (H) invasive potential were isolated from SW620 and LoVo cell lines by repetitive Transwell assays (Wang ). After incubation for 36 h at 37 °C, the invasive cells on the underside of the membrane and the noninvasive cells on the top of the membrane were harvested aseptically and expanded for the next round of selection. After 10, 20 and 30 selection rounds, the cell sublines that had migrated through the membrane were designated SW620-L and LoVo-L; SW620-M and LoVo-M; and SW620-H and LoVo-H, respectively.
Cell proliferation analysis
Cells (1 × 103) were seeded in 96-well plates in triplicate, added with 3-(4,5-dimethylthiazole-2-yl)-2,5-biphenyl tetrazolium bromide (MTT) working solution, and incubated for 4 h at 37 °C. The medium was then removed and 200 μl of dimethyl sulphoxide was added to dissolve the formazan crystals. Cell viability was assessed for five consecutive days by absorbance at 570 nm using a microplate reader (model 680 Microplate Reader, Bio-Rad, Gaithersburg, MD, USA). All experiments were repeated three times and the averages were calculated.
Cell cycle analysis
Cells were transfected with either miR-145 or negative control miRNA. After culturing for 48 h, the cells were collected by trypsinisation, washed with ice-cold phosphate-buffered saline, and the fixed cells were incubated with DNA-binding dye propidium iodide (50 μg ml−1) and RNase (1.0 mg ml−1) for 30 min at 37 °C in the dark, and then analysed by flow cytometry (Becton Dickinson, Franklin Lakes, NJ, USA). Experiments were conducted in triplicate.
Luciferase assays
Fourteen vectors, including a full-length 3′-untranslated region (3′-UTR) of Fascin-1 (FSCN1) mRNA (position 51–1180) and four mutated full-length 3′-UTR of Fascin-1 mRNA in which putative miR-145-binding sites were deleted; putative miR-145-binding sites at the 3′-UTR of ADAM17, NEDD9, and MUC1 mRNA; the four putative miR-145-binding sites at the 3′-UTR of Fascin-1 and two mutants, were cloned downstream of a firefly luciferase cassette in pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA). The oligonucleotide sequences are listed in Table 1. Constructs were co-transfected into cells with either miR-145 or control miRNA (miRcontrol RNA) with Lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, cells were analysed for luciferase activity using a Dual-Glo Luciferase Assay System (Promega) and a MicroLumatPlus LB96V luminometer (Berthold, Oak Ridge, TN, USA). Normalised firefly luciferase activity (firefly luciferase activity/Renilla luciferase activity) for each construct was compared with that of the pmirGLO Vector no-insert control. For each transfection, luciferase activity was averaged from three replicates.
Table 1
Primer sequences referenced in the study
Name
Primers: 5′ NNN 3′
ADAM17 sense
CTAGCGGCCGCTTTATTTGTGATGACAACTGGAAG
ADAM17 antisense
TCGACTTCCAGTTGTCATCACAAATAAAGCGGCCGCTAGAGCT
NEDD9 sense
CTAGCGGCCGCACGGTTACTAAGGAAAACTGGAAG
NEDD9 antisense
TCGACTTCCAGTTTTCCTTAGTAACCGTGCGGCCGCTAGAGCT
MUC1 sense
CTAGCGGCCGCCGGGGATCCTG-AACTGGACG
MUC1 antisense
TCGACGTCCAGTT-CAGGATCCCCGGCGGCCGCTAGAGCT
Fascin-1 sense (full)
CTAGCGGCCGCCTTGCCTTTCAAACTGGAAACCG
Fascin-1 antisense (full)
TCGACGGGCTGCAGACTGAGTTATTTGCGGCCGCTAGAGCT
WT1 sense
CTAGCGGCCGCCCCCCTTGCCTTTCA-AACTGGAAG
WTI antisense
TCGACTTCCAGTT-TGAAAGGCAAGGGGGGCGGCCGCTAGAGCT
MTI sense
CTAGCGGCCGCCCCCCTTGCCTTTCA-GCACTAGAG
MTI antisense
TCGACTCTAGTGC-TGAAAGGCAAGGGGGGCGGCCGCTAGAGCT
WT2 sense
CTAGCGGCCGCCTGGGCGTGTAGTGTAACTGGAAG
WT2 antisense
TCGACTTCCAGTTACACTACACGCCCAGGCGGCCGCTAGAGCT
MT2 sense
CTAGCGGCCGCCTGGGCGTGTAGTGTGCACTGGAG
MT2 antisense
TCGACTCCAGTGCACACTACACGCCCAGGCGGCCGCTAGAGCT
WT3 sense
CTAGCGGCCGCTTTCACCCTAGCCTGACTGGAAGG
WT3 antisense
TCGACCTTCCAGTCAGGCTAGGGTGAAAGCGGCCGCTAGAGCT
WT4 sense
CTAGCGGCCGCATGATAGTAGCTTCAAACTGGAAG
WT4 antisense
TCGACTTCCAGTTTGAAGCTACTATCATGCGGCCGCTAGAGCT
Immunoblotting
Cells were harvested 72 h post transfection and lysed in RIPA buffer. Cell lysates were separated by electrophoresis on 12% SDS–polyacrylamide gels, transferred to PVDF membranes (Millipore, Billerica, MA, USA), and probed with primary antibodies: mouse to Fascin-1 (1 : 1000) (Abcam, Cambridge, MA, USA) and mouse to anti-β-actin (1 : 2000) (Cell Signaling Technology, Danvers, MA, USA). After washing, the membranes were incubated with secondary antibody HRP-conjugated goat anti-mouse (1 : 5000 dilution; Invitrogen) and visualised by enhanced chemiluminescence.
Immunohistochemistry and immunohistochemical staining
Detection of Fascin-1 was performed on 5-μm FFPE CRC tissue sections. Antigen retrieval was performed in Tris-EDTA buffer using the microwave protocol. Tissues were incubated with primary antibody mouse to Fascin-1 (1 : 250) (Abcam) at room temperature for 30 min, then stained using the EnVision Detection Kit, peroxidase/DAB, Rabbit/Mouse (Gene Tech, Shanghai, China). Immunohistochemical scores were allocated according to a semi-quantitative scale based on previous criteria (Hashimoto ). In each case, 10 high-power fields of representative areas were counted. The staining was evaluated independently by two pathologists and any discrepancies were resolved by consensus.
Lentivirus packaging and transduction
MiR-145 and control miRNA precursor sequences were amplified from human genomic DNA and cloned into the lentiviral vector pLVX-shRNA1 (Clontech Laboratories, Inc., Palo Alto, CA, USA). Virus packaging was performed in 293T cells. pLV-miR-145 or pLV-miR-control and Lenti-X HTX Packaging Kit (Clontech Laboratories, Inc.) were co-transfected using the Xfect transfection reagent according to the manufacturer's protocols. The SW620H cells were transduced with pLV-miR-145 or pLV-miR-control. Forty-eight hours after infection, 2 μg ml−1 of puromycin was added to the media for 2 weeks to select the cells infected with the lentivirus. The cell line that stably expressed miRNA-145 was named LV-miR145-SW620H, and the control vector cell line was named LV-miRcontrol-SW620H. Real-time PCR assays were used to detect the expression of miR-145 in the two stable cell lines as described above.
Proliferation and metastasis assays in vivo
Female athymic BABL/c nude mice (4–6 weeks old) were used under conditions approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University. To determine the proliferation capacity of LV-miR145-SW620H and LV-miRcontrol-SW620H in vivo, a total of 1 × 106 cells were injected subcutaneously into nude mice (n=8). Tumour volume (V) was calculated as follows: V=length × width2 × 0.5. To investigate experimental lung metastasis, tumour cell suspensions (1.5 × 106 cells per mouse) were injected into the lateral tail veins of each anaesthetised nude mouse (n=8). Six weeks after injection, the animals were killed; lungs were dissected and paraffin embedded, and 5-μm sections were stained with haematoxylin and eosin. The metastases were counted in a double-blind manner with the aid of a dissecting microscope as described previously (Huang ).
Statistical analysis
All data were analysed using Prism 5.0 software (GraphPad, La Jolla, CA, USA) and presented as mean±s.e. The significances of the observed differences were determined by the Student's t-test or by one-way analysis of variance. The relationship between miR-145 and Fascin-1 mRNA or protein was analysed by correlation coefficients and linear regression analysis. P<0.05 was considered statistically significant.
Results
MiR-145 is specifically downregulated in human metastatic CRC cell lines and colorectal tumours
SYBR green qPCR was performed to detect miR-145 levels in CRC cell lines and tissues. Expression levels of miR-145 were tested in seven human colonic cell lines: normal colon epithelial cell lines (FHC, NCM460); tumorigenic but non-metastatic CRC cell lines (HT29, LS174T, SW480); and metastatic tumour CRC cell lines (SW620, LoVo). The amplification efficiencies for each miR-145 and FSCN1 were >86.7% and 88.4%, respectively. All five CRC cell lines showed notably reduced levels of miR-145, whereas the two normal colon epithelial cell lines expressed high levels of miR-145 (Figure 1A). MiR-145 levels were specifically attenuated in metastatic CRC cells compared with tumorigenic non-metastatic CRC cells and normal colon epithelial cells (Figure 1A). MiR-145 levels in sublines derived from SW620 and LoVo cells reflected their capacity to metastasise: miR-145 expression was progressively reduced as their capacity to metastasise increased from SW620-L and LoVo-L cells to SW620-M and LoVo-M cells, to SW620-H and LoVo-H cells (Figure 1B).
Figure 1
MiR-145 levels correlate inversely with metastatic capacity in CRC cell lines and CRC tissue. (A) RT–PCR data for miR-145 in seven human colorectal cell lines: U6 snRNA, loading control; NTC, no template control, n=3. (B) MiR-145 RT–PCR data in sublines with different metastatic capacity: U6 snRNA, loading control, n=3. (C) qPCR data for miR-145 levels in 43 pairs of primary CRC and matched normal colon epithelial tissues. (D) qPCR data of miR-145 levels in primary CRC (metastasis positive or metastasis free) lymph node and/or liver metastasis. The term; –ΔCt (–ΔCt=CtU6−CtmiR-145) is used to denote expression levels of miR-145. U6 snRNA was the internal normalised reference for miR-145. Error bars (s.d.) were calculated from triplicate samples.
The assay was extended to include miR-145 expression in the 43 primary CRC tissues (14 colon and 29 rectum) and their paired adjacent normal tissues. The results showed that miR-145 expression was significantly decreased in CRC tissues compared with the paired adjacent normal tissues (Figure 1C). Although the expression level of miR-145 in rectal cancer was slightly lower than that in colon cancer (Slattery ), there was no statistically significant difference between the two groups in our study. When the 43 tumours were stratified, based on clinical progression, miR-145 expression was found to be diminished in primary tumours that subsequently metastasised compared with those that did not metastasise (Figure 1D). The correlations between miR-145 expression level and CRC clinicopathological characteristics are summarised in Table 2.
Table 2
Clinicopathological parameters in clinical CRC cases
Variable
Cases (n)
%
Expression level of miR-145
P-value
Age (years)
<60
19
44.19
−10.54±1.96
0.614
⩾60
24
55.81
−10.22±2.14
Sex
Male
27
62.79
−10.16±2.35
0.418
Female
16
37.21
−10.69±1.42
Family history of CRC
Yes
6
13.95
−10.02±1.94
0.667
No
37
86.05
−10.41±2.09
Tumour location
Colon
14
32.56
−10.05±2.02
0.497
Rectum
29
67.44
−10.51±2.01
Lymph node metastasis
Yes
26
60.47
−11.29±1.54
0.000
No
17
39.53
−8.96±1.91
Abbreviation: CRC=colorectal cancer.
MiR-145 expression suppresses metastasis-relevant traits in vitro
Given the inverse correlation between miR-145 levels and malignant phenotype, the anti-metastatic roles of miR-145 in CRC were tested. SW620 and LoVo cells transfected with miR-145 mimics exhibited high levels of miR-145 compared with normal colon epithelial cells (FHC) (Figure 2A). The results showed that ectopic miR-145 significantly reduced cell proliferation (Figure 2B), migration, and invasion (Figure 2C), but did not affect cell cycle distribution in vitro (Figure 2D).
Figure 2
The effect of ectopic expression of miR-145 levels on cell proliferation, migration, invasion, and cell cycle distribution of CRC cell lines. Ectopic expression of miR-145 by transfecting miR-145 mimics into SW620 and LoVo cells (A) significantly inhibits cell proliferation (B) (*P<0.05), migration, and invasion (C) of SW620 and LoVo cell lines compared with scramble controls; however, it does not affect cell cycle distribution (D). Error bars (s.d.) were calculated from triplicate samples.
Inhibition of miR-145 promotes metastasis-relevant traits in vitro
It was then determined whether miR-145 prevented metastatic-relevant traits from being acquired by non-metastatic human CRC cells. MiR-145 was transiently inhibited in non-metastatic SW480 and HT-29 cells with antisense oligonucleotides (Figure 3A). The suppression of miR-145 enhanced cell migration, invasion (Figure 3B), and cell proliferation (Figure 3C), but not cell cycle distribution (Figure 3D).
Figure 3
The effect of inhibition of miR-145 levels on cell proliferation, migration, invasion, and cell cycle distribution of CRC cell lines. Inhibition of miR-145 expression by transfecting miR-145 inhibitors into SW480 and HT-29 cell lines (A) significantly stimulates cell migration, invasion, and cell proliferation (C), compared with scramble controls (*P<0.05); however, it does not affect cell cycle distribution (D). Error bars (s.d.) were calculated from triplicate samples.
MiR-145 directly regulates Fascin-1 in CRC cells
MiR-145 may impair the metastatic capacity of CRC cells by regulating metastatic-related genes; therefore, miRNA-PicTar and TargetScan algorithms were used to predict the functional target genes of miR-145. Four metastatic-related genes were selected based on their 3′-UTR to test using the luciferase assay: ADAM17; NEDD9; Fascin-1; and mucin 1 (MUC1). MiR-145 only significantly repressed the luciferase activity of full-length 3′-UTR of Fascin-1 mRNA in SW620 cells (Figure 4A). To determine the specific sites targeted by miR-145, the four putative miR-145-binding sites at the 3′-UTR of Fascin-1 were cloned downstream of a firefly luciferase cassette. The luminescence intensity was significantly decreased in miR-145 transfectants with two putative miR-145 sites (positions 116–122 and 377–383, respectively); however, by mutating the two miR-145-binding sites, the repressive effect of miR-145 was abolished (Figure 4B). In addition, we constructed four mutated vectors in which the putative sites targeted by the miR-145 were deleted, and the results of the luminescence intensity were in accordance with the above results (Figure 4C). Furthermore, the ectopic expression of miR-145 resulted in significantly reduced Fascin-1 mRNA and protein levels in SW620 and LoVo cells, whereas the inhibition of miR-145 in SW480 and HT-29 cells significantly raised Fascin-1 mRNA and protein levels in both cell lines (Figure 4D and E).
Figure 4
Detection of target genes regulated by miR-145 in CRC cell lines. (A) Luciferase activity after transfection with the four wild-type 3′-UTR constructs, miR-145, or miR-control. (B) miR-145-binding sites in the 3′-UTR region of Fascin-1;luciferase activity after transfection with mutant 3′-UTR constructs in Fascin-1. The no-insert control (NO), wild-type (WT), and mutated-type (MT) constructs are highlighted with the seed region underlined, and base substitutions are highlighted as bold text. (C) Luciferase assays using the mutated vectors in which the specific sites targeted by the miR-145 were deleted. MiR-145 expression levels affect Fascin-1 protein (D); and mRNA expression (E), in CRC cell lines. Error bars (s.d.) were calculated from triplicate samples. *P<0.05.
To determine whether miR-145 reduced the migration and invasion capacity of CRC in a Fascin-1-dependent manner, the effect of siRNA targeting of Fascin-1 was examined. The results showed that suppression of Fascin-1 expression by siRNA reduced Fascin-1 protein levels, cell proliferation, invasion, and migration (Figure 5A–C), which is consistent with the inhibitory effects induced by downregulation of miR-145. Furthermore, when SW620 cells were treated with Fascin-1 siRNA in combination with miR-145 mimics (Figure 5A–C), synergistic inhibitory effects were observed compared with treatments with either Fascin-1 siRNA or miR-145 mimics alone. By using an expression construct that encoded the entire Fascin-1-coding sequence, but lacked the 3′-UTR, mRNA that was resistant to miRNA-mediated suppression was produced.
Figure 5
Functional effects of Fascin-1 expression on SW620 cells. (A) Effective suppression of Fascin-1 protein expression by Fascin-1 siRNA and miR-145 mimics, both individually and combined. (B) Significant inhibition of cell growth, migration, and invasion of SW620 cells compared with negative controls. (*P<0.05) (C) The synergistic inhibitory effect induced by the combination of Fascin-1 siRNA and miR-145 mimics compared with their individual effects ( × 100 magnification) (*P<0.05). (D) Co-transfection of pcDNA-Fascin-1 and miR-145 mimics into SW620 cells significantly rescues migration and invasion of SW620 cells after suppression of miR-145 (*P<0.05).
These results showed that the overexpression of Fascin-1 protein with pcDNA-Fascin-1 greatly enhanced the migration and invasion of SW620 and LoVo cells (Figure 5D), and, as predicted, the co-transfection of pcDNA-Fascin-1 and miR-145 mimics into SW620 and LoVo cells significantly rescued miR-145-suppressed migration and invasion.
Inverse correlation of expression between miR-145 and Fascin-1
To confirm the relationship between miR-145 and Fascin-1 expression, miR-145 and Fascin-1 mRNA expression and protein levels were investigated in the seven CRC cell lines and 43 primary CRC and paired adjacent normal tissues. As predicted, the mRNA levels of Fascin-1 were negatively correlated with miR-145 levels (Figure 6A). Correlation analysis of the Fascin-1 protein score with miR-145 expression suggested an inverse relationship (Figure 6B); however, miR-145 dysregulation could not account for the high expression level of Fascin-1 in some CRC cells.
Figure 6
(A) Inverse correlation between miR-145 expression and Fascin-1 mRNA levels in CRC cell lines and tissues ( (B) Inverse relationship between miR-145 expression and Fascin-1 protein levels (r=−0.758; P<0.001). Error bars (s.d.) were calculated from triplicate samples.
MiR-145 inhibits CRC growth and metastasis in vivo
To further investigate the contribution of miR-145 in vivo, a lentivirus vector was constructed to mediate the expression of miR-145, and two stable cell lines were established named LV-miR145-SW620 and LV-miRcontrol-SW620. These cell lines were injected subcutaneously into the flanks of nude mice, and tumour progression was observed over time. After 6 weeks, the mice in both groups were moribund as a result of primary tumour burdens. The volumes of the tumours resulting from LV-miR145-SW620 injection were significantly smaller than those resulting from LV-miRcontrol-SW620 injection (Figure 7A). In addition, immunohistochemistry analyses revealed that tumours from LV-miR145-SW620 cells had reduced Fascin-1 levels compared with LV-miRcontrol-SW620 cells (Figure 7B). Examination of the lungs clearly revealed that the number of mice with lung metastases was lower in the group implanted with SW620 cells expressing miR-145 compared with the group implanted with control SW620 cells (Figure 7C). These observations were consistent with our in vitro results.
Figure 7
Antitumour effects of miR-145 overexpression on CRC xenografts. (A) Overexpression of miR-145 inhibits CRC growth in vivo, (n=8; **P=0.0034). (B) Immunohistochemistry was used to examine the expression of Fascin-1 in tumours either with overexpression of miR-145 or with negative control ( × 200 magnification). (C) HE staining of lung tissue isolated from nude mice that had been subcutaneously injected with either LV-miR145-SW620 or LV-miRcontrol-SW620 ( × 100 magnification). The metastasis nodules are indicated by arrows. The table gives the incidences of metastasis in mice that had received subcutaneous tail injections of each cell line. Error bars (s.d.) were calculated from triplicate samples.
Discussion
In this study, the qPCR validation results showed that miR-145 was significantly downregulated in CRC cell lines, SW480, SW620, and LoVo, and moderately downregulated in HT2 and LS174T compared with the normal colon epithelial cell lines, FHC and NCM460. MiR-145 expression was significantly decreased in CRC tissues compared with the paired adjacent normal tissues, in which the mean expression of the miR-145 presented in CRC tissue samples was not completely incorporated in that of CRC cell lines. In addition, the downregulation of miR-145 was greater in lymph node and liver metastases than in primary CRC tumours. Statistical analyses revealed that miR-145 downregulation was significantly correlated with tumour progression in CRC patients. Furthermore, ectopically expressed miR-145 inhibited cell growth, migration, and invasion without significantly affecting cell cycle distribution in SW620 and LoVo cells; whereas, knockdown of endogenous miR-145 significantly enhanced these effects. By using a luciferase reporter assay, miR-145 was shown to suppress cell migration and invasion, and appeared to be associated with silencing of Fascin-1. Regulatory analysis further confirmed that, as a negative regulator of Fascin-1, miR-145 directly targeted Fascin-1, resulting in decreased Fascin-1 mRNA and protein levels, both in vitro and in clinical specimens. On the basis of these findings, we hypothesise that miR-145 directly regulates Fascin-1, and that Fascin-1 has oncogenic activity in CRC and may be involved in aggressive behaviour of CRC. In addition, loss of miR-145, which is an endogenous Fascin-1 inhibitor, may promote aberrant expression of Fascin-1, increasing its abundance and contributing to the invasive and viability properties of CRC. In summary, these data suggested that miR-145 could be exploited for designing novel strategies against CRC metastasis in the future.Most deaths from cancer are caused by complications arising from metastasis; therefore, targeting metastatic disease might be a potential anticancer strategy. To date, studies on tumour invasion and metastasis have revealed that miRNAs have a vital role in negatively regulating oncogenes and tumour suppressors (Lim ; Dalmay and Edwards, 2006). For example, miR-9 directly represses the anti-metastatic gene E-cadherin, leading to tumour invasion and metastasis (Ma ). Similarly, miR-183 represses osteosarcoma invasion and metastasis, in part by regulating Ezrin (Zhu ). In CRC, there have been several studies examining the expression patterns of miRNAs and its role in invasion and metastasis (Asangani ). By targeting PDCD4, miR-21 has been demonstrated to enhance CRC cellular invasion, intravasation, and metastasis; and miR-135a was found to promote growth and invasion of CRC by targeting metastasis suppressor 1 in vitro (Zhou ). In addition, novel miRNAs were identified in clinical CRC samples by serial analysis of gene expression, which showed that miR-145 was steadily downregulated throughout CRC succession, from adenomatous to cancer, by these deregulated miRNAs (Cummins ). Consistent with these reports, our results showed that miR-145 downregulation was greater in metastases than in primary CRC tissue, indicating a potential role for miR-145 in tumour invasion and metastasis.Clinically, Fascin-1 has a central role in the invasive phenotype of several carcinomas (Hashimoto ) and its protein has recently been proposed as a novel biomarker for aggressive tumour behaviour (Hashimoto ). In agreement, our study showed an increased level of Fascin-1 in more metastatic CRC compared with less metastatic CRC, but the precise mechanism of Fascin-1-mediated metastasis is still unknown. By analysing miR-145 expression levels in different CRC cell lines in this present study, miR-145 was shown to be expressed at low levels in high-invasive cells and at high levels in low-invasive cells; conversely, Fascin-1 protein levels displayed the opposite expression pattern. It is probable that the upregulation of Fascin-1 by suppression of miR-145 contributed to tumour progression in CRC. Fascin-1 regulation by miR-145 was also examined in CRC cell lines by western blotting and the luciferase reporter assay. Paradoxically, it was found that in CRC cell lines, the specific sites targeted by miR-145 were not consistent with previous reports from oesophageal squamous cell carcinoma (Kano ) and bladder cancer (Chiyomaru ), in which miR-145 interacted with two putative miR-145 sites at positions 377–383 and 1140–1146. In our study, luminescence intensity was significantly decreased in miR-145 transfectants with two putative miR-145 sites at positions 116–122 and 377–383. As a result, we speculate that there are other target genes that interact competitively with miR-145 in CRC cell lines. These will need further investigation.In agreement with previous reports showing an inhibitory effect of miR-145 (Sachdeva and Mo, 2012) on tumour growth, a growth reduction of SW620 cells upon transient miR-145 transfection was observed. This implied that miR-145 possessed a tumour suppressor function both in vitro and in vivo. On the basis of these findings, we suggest that miR-145 may have a role in the modulation of CRC metastases, acting as a metastamir, by targeting Fascin-1. Our data implicate Fascin-1 in progression of CRC to a more invasive phenotype; therefore, the restoration of miR-145 expression could have important implications for clinical management of CRC. Although it is not yet clear whether Fascin-1 is itself subject to miRNA regulation, our study has established post-transcriptional regulation of Fascin-1 by miR-145.In conclusion, miR-145 was found to suppress the invasion and metastasis of CRC by functioning as a tumour suppressor through the direct repression of Fascin-1. It may have potential therapeutic value in the treatment of CRC.
Authors: Jordan M Cummins; Yiping He; Rebecca J Leary; Ray Pagliarini; Luis A Diaz; Tobias Sjoblom; Omer Barad; Zvi Bentwich; Anna E Szafranska; Emmanuel Labourier; Christopher K Raymond; Brian S Roberts; Hartmut Juhl; Kenneth W Kinzler; Bert Vogelstein; Victor E Velculescu Journal: Proc Natl Acad Sci U S A Date: 2006-02-27 Impact factor: 11.205
Authors: Lee P Lim; Nelson C Lau; Philip Garrett-Engele; Andrew Grimson; Janell M Schelter; John Castle; David P Bartel; Peter S Linsley; Jason M Johnson Journal: Nature Date: 2005-01-30 Impact factor: 49.962
Authors: Martha L Slattery; Erica Wolff; Michael D Hoffman; Daniel F Pellatt; Brett Milash; Roger K Wolff Journal: Genes Chromosomes Cancer Date: 2010-12-16 Impact factor: 5.006
Authors: Michael Z Michael; Susan M O' Connor; Nicholas G van Holst Pellekaan; Graeme P Young; Robert J James Journal: Mol Cancer Res Date: 2003-10 Impact factor: 5.852
Authors: Yosuke Hashimoto; Marek Skacel; Ian C Lavery; Abir L Mukherjee; Graham Casey; Josephine C Adams Journal: BMC Cancer Date: 2006-10-09 Impact factor: 4.430
Authors: Giovanni Lanza; Manuela Ferracin; Roberta Gafà; Angelo Veronese; Riccardo Spizzo; Flavia Pichiorri; Chang-gong Liu; George A Calin; Carlo M Croce; Massimo Negrini Journal: Mol Cancer Date: 2007-08-23 Impact factor: 27.401
Authors: Zhiqiang Ye; Ning Shen; Yimin Weng; Kai Li; Liu Hu; Hongyin Liao; Jun An; Libao Liu; Sen Lao; Songwang Cai Journal: Cancer Biol Ther Date: 2015-05-11 Impact factor: 4.742