Tipachai Vatanavicharn1, Adisak Prapavorarat2, Phattarunda Jaree2, Kunlaya Somboonwiwat2, Anchalee Tassanakajon2. 1. Applied Analytical Chemistry Research Unit, Department of Chemistry, Faculty of Science, King Mongkut's Institute of Technology Ladkrabang, Bangkok, Thailand. 2. Center of Excellence for Molecular Biology and Genomics of Shrimp, Department of Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok, Thailand.
Abstract
Suppression subtractive hybridization of Penaeus monodon hemocytes challenged with white spot syndrome virus (WSSV) has identified the viral responsive gene, PmVRP15, as the highest up-regulated gene ever reported in shrimps. Expression analysis by quantitative real time RT-PCR revealed 9410-fold up-regulated level at 48 h post WSSV injection. Tissue distribution analysis showed that PmVRP15 transcript was mainly expressed in the hemocytes of shrimp. The full-length cDNA of PmVRP15 transcript was obtained and showed no significant similarity to any known gene in the GenBank database. The predicted open reading frame of PmVRP15 encodes for a deduced 137 amino acid protein containing a putative transmembrane helix. Immunofluorescent localization of the PmVRP15 protein revealed it accumulated around the nuclear membrane in all three types of shrimp hemocytes and that the protein was highly up-regulated in WSSV-infected shrimps. Double-stranded RNA interference-mediated gene silencing of PmVRP15 in P. monodon significantly decreased WSSV propagation compared to the control shrimps (injected with GFP dsRNA). The significant decrease in cumulative mortality rate of WSSV-infected shrimp following PmVRP15 knockdown was observed. These results suggest that PmVRP15 is likely to be a nuclear membrane protein and that it acts as a part of WSSV propagation pathway.
Suppression subtractive hybridization of Penaeus monodon hemocytes challenged with white spot syndrome virus (WSSV) has identified the viral responsive gene, PmVRP15, as the highest up-regulated gene ever reported in shrimps. Expression analysis by quantitative real time RT-PCR revealed 9410-fold up-regulated level at 48 h post WSSV injection. Tissue distribution analysis showed that PmVRP15 transcript was mainly expressed in the hemocytes of shrimp. The full-length cDNA of PmVRP15 transcript was obtained and showed no significant similarity to any known gene in the GenBank database. The predicted open reading frame of PmVRP15 encodes for a deduced 137 amino acid protein containing a putative transmembrane helix. Immunofluorescent localization of the PmVRP15 protein revealed it accumulated around the nuclear membrane in all three types of shrimp hemocytes and that the protein was highly up-regulated in WSSV-infected shrimps. Double-stranded RNA interference-mediated gene silencing of PmVRP15 in P. monodon significantly decreased WSSV propagation compared to the control shrimps (injected with GFP dsRNA). The significant decrease in cumulative mortality rate of WSSV-infected shrimp following PmVRP15 knockdown was observed. These results suggest that PmVRP15 is likely to be a nuclear membrane protein and that it acts as a part of WSSV propagation pathway.
White spot syndrome, caused by the white spot syndrome virus (WSSV), is the most serious viral disease in penaeid shrimps causing 100% mortality post infection [1]. In the last two decades outbreaks of this virus in commercial shrimp aquaculture farms have been reported in Asia and America [1]–[7]. WSSV has bacilliform, enveloped, non-occluded virions containing a double stranded (ds)DNA genome [8]–[10]. The virus has a wide host range, where more than 93 species of arthropods have been reported as hosts or carriers of WSSV [11]. The mechanism of WSSV infection and propagation in the host cell remains unknown in spite of its severe impact on the shrimp farming and that understanding of the virus-host interaction is likely to be the key point in developing strategies to prevention of this disease outbreak.The invasion of WSSV into the penaeid shrimps affects their immune defense responses. The molecular changes associated at the gene transcript and protein expression levels in the shrimp immune system have been investigated using expressed sequenced tag (EST) [12]–[13], DNA microarray [14]–[18] and proteomic [19]–[20] analyses. The, up-regulated gene transcripts or proteins have been further characterized for their potential role in both the cellular and humoral immunity (defense responses) of shrimps in response to WSSV infection. These were found to include the antimicrobial peptides, prophenol oxidase (proPO) system, oxidative stress, proteinases and proteinase inhibitors [21]. Moreover, three of the major immune responses (phagocytosis, apoptosis and the proPO cascade) have been compared to study their role in the antiviral defense system [22].The novel proteins that are up-regulated in shrimps following WSSV infection are typically viewed as interesting molecules to characterize their function in the shrimp immune system. For example, the novel viral responsive protein, hemocyte homeostasis-associated protein (HHAP), was found to be highly up-regulated at both the transcript and protein levels in WSSV-infected shrimp hemocytes. Silencing of this gene in Penaeus monodon (PmHHAP) by dsRNA-interference (RNAi) caused damage to shrimp hemocytes and a severe decrease in their numbers, suggesting the important role of PmHHAP in hemocyte homeostasis [23]. Suppression subtractive hybridization (SSH) and microarray analyses (our unpublished data) of WSSV-challenged P. monodon hemocytes identified the novel viral responsive protein (VRP) PmVRP15 as one of the most highly up-regulated genes in the acute phase of WSSV-infected hemocytes. Herein, we attempt to characterize the function of PmVRP15 from P. monodon by RNAi-mediated gene silencing. Fluorescence-labeling along with confocal laser scanning microscopy (CLSM) was used to examine the localization of PmVRP15 in shrimp hemocytes. Overall, the likely importance of this novel protein in promoting viral propagation was suggested.
Materials and Methods
Animal cultivation
Specific pathogen free black tiger shrimps, P. monodon, of about 20- and 3-g body weight, were obtained from a commercial shrimp farm in Nakhon Si Thammarat Province, Thailand. The animals were reared in laboratory tanks at ambient temperature (28±4°C), and maintained in aerated water with a salinity of 20 ppt for at least 7 d before use.
Identification of a full-length cDNA of PmVRP15 using 5′ Rapid Amplification of cDNA End (5′ RACE)
The partial sequence of the PmVRP15 cDNA was initially obtained from the SSH library of WSSV-challenged P. monodon hemocytes, and then extended by 5′ RACE. The hemolymph of ∼20 g body weight shrimps was drawn from the ventral sinus using a sterile 1-mL syringe with 150 μL of 10% (w/v) sodium citrate solution. The hemolymph was immediately centrifuged at 5000×g for 5 minutes at 4 °C to separate the hemocytes (pellet) from the plasma (supernatant). Total RNA was isolated from the hemocytes using the TRI Reagent (Molecular Research Center) according to the manufacturer's protocol. A full-length cDNA of PmVRP15 was determined using The SMART RACE cDNA Amplification Kit (Clontech) and the GSP-RACE primer (Table 1), according to the manufacturer's instruction. The RACE product was purified using a NucleoSpin Extract II kit (Clontech) according to manufacturer's protocol, and cloned into the RBC T&A Cloning Vector (RBC Bioscience). Then, the recombinant plasmid was transformed into Escherichia coli DH5α competent cells (RBC Bioscience). The positive clones were commercially sequenced by Macrogen INC., South Korea. The nucleotide sequences of SSH clone and RACE fragment were then assembled and searched against the NCBI database.
Table 1
Nucleotide sequences of the PCR primers used in this study.
Primer name
Sequence (5′→3′)
GSP-RACE
CGCCGCTCGCAGCTTCTTCTCTTGACAC
PmVRP15F
CGATCACCACTCTCGTTCTT
PmVRP15R
GTACTAACAGCGAACCCATC
PmVRP15-RTF
CGTCCTTCAGTGCGCTTCCATA
PmVRP15-RTR
ACAGCGACTCCAAGGTCTACGA
EF-1-F
GGTGCTGGACAAGCTGAAGGC
EF-1-R
CGTTCCGGTGATCATGTTCTTGATG
β-actin-F
GAACCTCTCGTTGCCGATGGTG
β-actin-R
GAAGCTGTGCTACGTGGCTCTG
rPmVRP15-NcoIF
ATCGCCATGGGCATGTTAACAGAGGACTTA
rPmVRP15-XhoIR
ATCGCTCGAGATGCTCTACTGACATGTTGTG
GFP-F
ATGGTGAGCAAGGGGGAGGA
GFP-R
TTACTTGTACAGCTCGTCCA
GFP-FT7
GGATCCTAATACGACTCACTATAGGATGGTGAGCAAGGGGGAGGA
GFP-RT7
GGATCCTAATACGACTCACTATAGG TTACTTGTACAGCTCGTCCA
PmVRP15- T7-F
GGATCCTAATACGACTCACTATAGGCGCGACCGAGCCAAGAG
PmVRP15- T7-R
GGATCCTAATACGACTCACTATAGGTGAGCTGACGGAAGGCC
PmVRP15-F
TCACTCTTTCGGTCGTGTCG
PmVRP15-R
CCACACACAAAGGTGCCAAC
VP28-qrt-F
GGGAACATTCAAGGTGTGGA
VP28-qrt-R
GGTGAAGGAGGAGGTGTTGG
ie1-qrt-F
AGCAAGTGGAGGTGCTATGT
ie1-qrt-R
CCATGTCGATCAGTCTCTTC
477-qrt-F
GGCCAAGTCATGGAGATCTA
477-qrt-R
CCATCCACTTGGTTGCAGTA
Analysis of PmVRP15 transcript expression in shrimp tissues
PmVRP15 transcript expression levels in different tissues were qualitatively assayed by reverse transcriptase-PCR (RT-PCR). The different tissues of ∼20 g body weight shrimps such as antennal gland, epipodite, eye stalk, gill, heart, hemocytes, hepatopancreas, intestine and lymphoid, were collected from uninfected shrimps, and then total RNA was extracted from each tissue using the TRI Reagent (Molecular Research Center). After DNase I (Fermentas) treatment, the total RNA (1 μg) was first converted to single-stranded (ss)cDNA with the ImPromp-II reverse transcription system (Promega) according to the manufacturer's instruction. Then, in the second stage, PmVRP15 transcript levels in each tissue were identified by PCR using 1 μL of the cDNA as a template with the PmVRP15F/R primers (Table 1). The EF-1α gene fragment was amplified using the EF-1-F/R primers (Table 1) as an internal control. The PCR thermal cycling conditions consisted of 94°C for 3 min, followed by 35 (for PmVRP15) or 27 (for EF-1α) cycles of 95°C for 30 s, 58°C for 30 s and 72°C for 30 s, and then a final extension at 72°C for 5 min. The PCR product was resolved by 1.5% (w/v) agarose-TBE gel electrophoresis and visualized by uv-transillumination following staining with ethidium bromide.
PmVRP15 mRNA expression in unchallenged- and WSSV-challenged shrimp hemocytes
WSSV was prepared from the gills of WSSV-challenged P. monodon as previously described [24], and then diluted in lobster hemolymph medium (LHM). Then 100 μL of the diluted WSSV suspension (∼80 viral copies/μL) was injected into each shrimp (∼20 g body weight), a viral dose that had been previously determined as that which would induce a cumulative mortality of ∼50% within 3 d post-injection. Control shrimps were likewise injected but with 100 μL of virus-free LHM. Hemocytes of shrimps (three individuals each) were collected at 24, 48 and 72 h post-infection (hpi) as above. PmVRP15 transcript levels were then assayed by quantitative real time RT-PCR (qRT-PCR) as follows. Total RNA was then extracted from the hemocytes and used to synthesize sscDNA as above, whilst the qRT-PCR was performed with an equal amount of cDNAs in an iCycler iQ Real-Time Detection system using an IQ SYBR Green Supermix (Bio-Rad) and the PmVRP15-RTF/R and β-actin-F/R primers (Table 1). Thermal cycling was performed as 95°C for 9 min, 40 cycles of 95°C for 30 s, 60°C for 30 s and 72°C for 45 s. The results are presented as the average relative expression ratio of PmVRP15 transcript levels in the hemocytes of the sample (WSSV-challenged) shrimp versus the control (unchallenged) shrimp, after normalization to the transcript levels of the reference gene, β-actin. These relative expression ratios of PmVRP15 gene were calculated as previously described [25].
Production of recombinant (r)PmVRP15 (as a r(His)6-PmVRP15 chimera) in E. coli
The cDNA encoding for PmVRP15 was PCR amplified from the P. monodon hemocyte cDNA as above using the gene specific primers PmVRP15-NcoI/XhoI primers (Table 1) that contain 5′ flanking sequences with a NcoI and XhoI restriction site, respectively. The PCR product was double digested with NcoI and XhoI (New England Biolabs) and cloned in frame into the likewise double digested pET22-b. The ligation mixture was transformed into E. coli stain XL-1-blue. A single ampicillin resistant clone was selected, cultured and the recombinant plasmid was extracted and retransformed into the expression host, E. coli stain BL21(DE3). The recombinant plasmid was sequenced to confirm the correctness of the sequences. Then a selected recombinant clone in the expression host was cultured and induced with 1 mM IPTG for 4 h to over-produce the r(His)6-PmVRP15. The cell pellet was collected by centrifugation at 8000×g for 10 min, resuspended in phosphate buffered saline (PBS pH 7.4) and sonicated with a Bransonic 32 (Bandelin) for 4 min. Inclusion bodies were collected by centrifugation at 10,000 rpm for 20 min to remove the supernatant. The inclusion body pellet was then dissolved in 8 M urea in PBS. The r(His)6-PmVRP15 protein was purified using a Nickel-NTA column (GE healthcare), as per the manufacturer's protocol, and the resulting eluate dialyzed against distilled water. The protein was analyzed using SDS-PAGE, with the protein concentration determined using the Bradford method [26].
Rabbit serum and anti-PmVRP15 immune serum
Rabbit polyclonal antiserum against the purified r(His)6-PmVRP15 protein (2 mg) was prepared commercially by the Biomedical Technology Research Unit, Faculty of Associated Medical Sciences, Chiang Mai University, Thailand.
Western-blot analysis of PmVRP15 protein in control and WSSV-infected P. monodon hemocytes
Hemocytes were collected from 48 hpi saline- or WSSV- injected shrimps as above. The hemocytes were homogenated in PBS and centrifuged to collect the supernatant. The protein concentration of the hemocyte lysate (HLS) was measured by the Bradford method [26]. Seventy μg of HLS protein (per lane) was subjected to SDS-PAGE (12% (w/v) acrylamide resolving gel) resolution, transferred to nitrocellulose membrane and then the PmVRP15 and β-actin protein was detected by Western-blot analysis using purified rabbit polyclonal anti-rPmVRP15 and mouse anti-actin (Millipore) antibodies. The positive band was detected by secondary antibodies conjugated with horseradish peroxidase (brown color) for mouse antibody or alkaline phosphatase (purple color) for rabbit antibody.
Immunolocalization of PmVRP15 protein in P. monodon hemocytes
The hemolymph was collected from control and WSSV-injected shrimps at 6, 24 and 48 hpi, as well as from moribund shrimps, and immediately fixed by incubation in 4% (w/v) paraformaldehyde at room temperature for 10 min. The fixed hemocytes were washed in PBS (centrifugation stage at 800×g at 4°C for 10 min) and resuspended in PBS. About 106 hemocytes were attached onto each SuperFrost microscope slide by centrifugation at 1000×g for 10 min. Slides were blocked in 10% (v/v) fetal bovine serum in PBS at room temperature for 1 h and then probed with purified rabbit polyclonal antibody specific to PmVRP15 and purified mouse monoclonal antibody specific to VP28 (WSSV capsid protein) for 1 h at room temperature and washed three times in 0.05% (v/v) Tween-20 in PBS to remove non-specific binding. The Alexa 488-conjugated goat anti-rabbit IgG and Alexa 568-conjugated goat anti-mouse IgG secondary antibodies (Invitrogen) were applied to the slides and incubated at room temperature for 1 h. The slides were then washed three times as above, incubated with TO-PRO-3 iodide (Molecular Probes) to stain the nuclear DNA and then washed once with PBS. Mounting medium, ProLong Gold antifade (Molecular Probes), was applied and the slides were examined by CLSM (Olympus). Bright field and fluorescence images were collected for the analyses.
Production of PmVRP15 and GFP dsRNA
The dsRNA specific to the PmVRP15 gene transcript was prepared using the PmVRP15-recombinant plasmid as a template for producing the sense and anti-sense DNA templates by in vitro transcription. DNA templates containing the T7 promoter sequence at the 5′-end were generated by PCR using the oligonucleotide primers PmVRP15-T7-F and PmVRP15-R (Table 1) for the sense strand template, and PmVRP15-F and PmVRP15-T7-R (Table 1) for the antisense strand template. In addition, dsRNA of the green fluorescent protein (GFP), the negative control, was prepared from the pEGFP-1 vector (Clontech) as the PCR template using the GFP-FT7 and GFP-R primers (Table 1) for the sense strand template, and the GFP-F and GFP-RT7 primers (Table 1) for the antisense strand template. The PCR was performed at 94°C for 3 min, followed by 30 cycles of 94°C for 30 s, 58°C for 30 s and 72°C for 30 s, and then a final extension at 72°C for 5 min. Each template was in vitro transcribed using the T7 RiboMAX Express RNAi System (Promega), according to the manufacturer's instruction, to produce the two complementary ssRNAs. Then, equal amounts of each of the complementary ssRNAs were mixed together and incubated at 70°C for 10 min, and slowly cooled down at room temperature to allow annealing to form dsRNA. The respective PmVRP15 or GFP dsRNA solution was treated with 2 units (U) of RQ1 RNase-free DNase (Promega) at 37°C for 30 min, and then purified by standard phenol-chloroform extraction.
PmVRP15 gene knockdown in hemocyte of WSSV-infected shrimp
P. monodon shrimps of approximately 3 g body weight were divided into two groups of three individuals each. The first (control) group was injected with 10 μg/g shrimp of GFP-dsRNA, whilst the second group (PmVRP15 knockdown) was injected with 10 μg/g shrimp PmVRP15-dsRNA. After 24 h, 10 μg/g shrimp PmVRP15-dsRNA or dsGFP was mixed with 30 μL of the 10,000-fold diluted WSSV solution (a dose that causes 100% mortality of shrimps in 3 dpi) and injected into the respective groups of shrimps. Hemocytes of individual shrimps were collected at 24 hpi, and total RNA was extracted as above and treated with 1 U of RQ1 RNase-free DNase (Promega) to remove any residual DNA contamination. An equal amount of DNA-free total RNA from three shrimps was pooled and from this 1 μg of total RNA was used for the first stage RT-PCR cDNA synthesis using the RevertAid First Strand cDNA Synthesis kit (Thermo Scientific).To confirm the PmVRP15 gene transcript knockdown, RT-PCR was performed. The PmVRP15-F/R primers (Table 1) were used (100 nM) along with the EF-1α gene as an internal control using the EF-1-F/R primer pair (Table 1). The PCR conditions were 94°C for 1 min, followed by 27 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s, and then a final extension at 72°C for 5 min. The PCR products were analyzed by 1.5% (w/v) agarose gel electrophoresis.The hemocyte of WSSV-infected PmVRP15 gene knockdown shrimp and of the control was collected from 5 individuals. After protein extraction, protein lysate from each individual were pooled. PmVRP15 protein expression after PmVRP15 gene knockdown was checked using SDS-PAGE (15% (w/v) acrylamide resolving gel) and western blot analysis.
WSSV gene expression analysis of PmVRP15 knockdown P. monodon hemocytes infected with WSSV
WSSV-infected shrimp hemocyte after PmVRP15 gene knockdown or GFP gene knockdown was prepared as above. The expression level of representative WSSV gene transcripts of the immediate-early, early and late viral infection phases was then evaluated in the hemocytes by qRT-PCR.The qrt-PCR was then performed on the BioRad CFX96 Real-Time PCR system to evaluate the degree of the respective gene transcripts. Reactions were prepared in a total volume of 15 μL containing 7.5 μL SsoFast EvaGreen Supermix (Bio-Rad) and 1 μL cDNA template and 100 nM (for WSSV genes) or 400 nM (for EF-1α gene) forward and reverse primers.For the expression level of the three WSSV transcripts (ie-1, wsv477 and vp28), the qrt-PCR was performed using the specific primer pairs ie1-qrt-F/R, 477-qrt-F/R and VP28-qrt-F/R, respectively (Table 1), along with the EF-1α gene as a reference gene using the EF-1-F/R primers. The PCR conditions were 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 60°C (for all WSSV genes) or 58°C (for EF-1α) for 30 s and 72°C for 30 s. Three replicate qrt-PCR reactions were performed per sample. The 2−ΔΔ method was used to calculate the relative expression ratio [25]. All samples were normalized relative to the reference EF-1α transcript levels in the same cDNA sample.
Effect of PmVRP15 gene silencing on cumulative mortality of WSSV-infected shrimp
To study the involvement of PmVRP15 gene in WSSV infection in shrimp, the percentage of cumulative mortality of WSSV-infected PmVRP15 knockdown shrimp was compared with WSSV infected GFP knockdown shrimp, control group. Ten P. monodon shrimps of approximately 3 g body weight per group were injected with PmVRP15 dsRNA or GFP dsRNA as above. The dosage of WSSV used in this experiment causes 100% mortality of shrimps in 4 dpi. The shrimp mortality was observed every 3 h after WSSV infection. This experiment was done in triplicate. Moreover, after WSSV infection, shrimp hemocyte was collected at 24, 36, 48 and 60 hpi. Total RNA was extracted. After DNase treatment and cDNA synthesis, PmVRP15 gene expression was investigated by RT-PCR in order to determine PmVRP15 gene recovery.
Data analysis
Data were analyzed using the SPSS statistics 17.0 software (Chicago, USA) and are presented as the mean ±1 standard deviation (SD). Statistical significance of differences between means was calculated by the paired-samples t-test, where significance was accepted at the P<0.05 level.
Results
The full-length cDNA of PmVRP15 and sequence analysis
A partial sequence of the PmVRP15 cDNA was initially obtained from the SSH library of WSSV-challenged P. monodon hemocytes. The full-length cDNA of PmVRP15 was then obtained using 5′ RACE (GenBank accession code KF683338), and was found to contain 722 base pairs with a deduced complete open reading frame encoding for a predicted 137 amino acids whose predicted molecular mass of 15.036 kDa (Fig. 1). The size of the deduced PmVRP15 cDNA was confirmed by Northern blot analysis where the detected mRNA had a corresponding size of about 722 base pairs (data not shown). The BLAST homology search of the GenBank database using blastP program indicated that the putative predicted protein sequence of PmVRP15 has the highest similarity to a hypothetical protein AGAP000432-PA (XP_310667.1) from mosquito Anopheles gambiae with a significant E value of 2e−11, 35% identity and 58% similarity. Lower significant similarity of PmVRP15 with other five hypothetical proteins such as conserved hypothetical protein (XP_001849829.1) from Culex quinquefasciatus, GE16519 (XP_002099810.1) from Drosophila yakuba, GK10098 (XP_002071654.1) from Drosophila willistoni, hypothetical protein AaeL_AAEL014657 (XP_001649261.1) from Aedes aegypti, and PREDICTED protein C19orf12 homolog (XP_004536446.1) from Ceratitis capitata, was also found with the E value range from 10−8–10−5. Protein-structural analysis revealed a likely transmembrane helix of 23 amino acids (TMHMM Server v. 2.0, available on-line) [27] but with no predicted signaling domain (Simple Modular Architecture Research Tool (SMART), available on-line) [28].
Figure 1
The cDNA nucleotide and deduced protein amino acid sequences of PmVRP15 (GenBank accession code KF683338).
The putative start codon (ATG) is in bold, the asterisk indicates the stop codon (TAA, in bold italics), the potential transmembrane domain is boxed and the proposed polyadenylation site is underlined.
The cDNA nucleotide and deduced protein amino acid sequences of PmVRP15 (GenBank accession code KF683338).
The putative start codon (ATG) is in bold, the asterisk indicates the stop codon (TAA, in bold italics), the potential transmembrane domain is boxed and the proposed polyadenylation site is underlined.
PmVRP15 gene expression in P. monodon tissues
The tissue distribution of PmVRP15 transcripts in normal shrimps was examined by RT-PCR, where PmVRP15 transcripts were found in all tested tissues but was highly expressed in hemocytes followed by lymphoid tissue and then with moderate to low levels in the heart, gill, hepatopancreas and intestine, and low levels in the antennal gland, epipodite and eye stalk (Fig. 2).
Figure 2
PmVRP15 transcript expression analysis in various P. monodon tissues by RT-PCR.
The tissues examined were antennal gland (AN), epipodite (EP), eye stalk (ES), gill (G), heart (H), hemocyte (HC), hepatopancreas (HP), intestine (I) and lymphoid (L). EF1-α was used as the internal reference and PCR control.
PmVRP15 transcript expression analysis in various P. monodon tissues by RT-PCR.
The tissues examined were antennal gland (AN), epipodite (EP), eye stalk (ES), gill (G), heart (H), hemocyte (HC), hepatopancreas (HP), intestine (I) and lymphoid (L). EF1-α was used as the internal reference and PCR control.
Up-regulation of PmVRP15 in response to WSSV infection in P. monodon hemocytes
Our previous results from SSH and microarray analyses (unpublished data) of WSSV-challenged P. monodon hemocytes revealed that PmVRP15 is one of the most highly up-regulated genes in the acute phase of WSSV-infected hemocytes. Herein, PmVRP15 transcript levels in P. monodon hemocytes were evaluated by qRT-PCR. The results clearly confirmed that PmVRP15 transcripts were highly up-regulated in the shrimp hemocytes after WSSV challenge, increasing by about 3.6-, 9410- and 1351-fold at 24, 48 and 72 hpi, respectively, compared to that in unchallenged shrimp hemocytes (Fig. 3). Furthermore, the PmVRP15 protein level was up-regulated in WSSV-infected shrimp hemocytes, as determined by Western blot analysis using the polyclonal rabbit anti-rPmVRP15 antibody (Fig. 4), where the detected 15 kDa protein band corresponded to the predicted size of PmVRP15 protein. These results are consistent with a role for PmVRP15 in response to WSSV infection.
Figure 3
Up-regulation of PmVRP15 transcripts in response to WSSV infection.
Relative expression ratios, as determined by qRT-PCR, of PmVRP15 transcript levels in the hemocytes of WSSV-infected P. monodon were compared to those of the control (non-infected) shrimps and standardized against β-actin as the internal reference, at 24, 48 and 72 hpi with WSSV. The data represent the mean ±1 SD relative expression of PmVRP15 post-infection (solid bar, right) and the control (open bar, left), derived from three independent experiments. Means with an asterisk are significantly different (P<0.05, paired samples t-test). A relative expression ratio of <1, 1 and >1 mean that the gene expression level is down-regulated, the same or up-regulated, respectively, in the hemocytes of WSSV-infected shrimps compared to the uninfected control.
Figure 4
Western blot analysis of PmVRP15 native protein in control (NaCl) and WSSV- injected (WSSV) P. monodon hemocytes.
Hemocytes were collected at 48(HLS) was prepared and 70 μg of total HLS protein per track was subjected to duplicate SDS-PAGE resolution. Gels were then either stained with coomassie blue for total protein detection or subject to Western-blot analysis to detect PmVRP15 and β-actin using specific antibodies. M is the protein size markers.
Up-regulation of PmVRP15 transcripts in response to WSSV infection.
Relative expression ratios, as determined by qRT-PCR, of PmVRP15 transcript levels in the hemocytes of WSSV-infectedP. monodon were compared to those of the control (non-infected) shrimps and standardized against β-actin as the internal reference, at 24, 48 and 72 hpi with WSSV. The data represent the mean ±1 SD relative expression of PmVRP15 post-infection (solid bar, right) and the control (open bar, left), derived from three independent experiments. Means with an asterisk are significantly different (P<0.05, paired samples t-test). A relative expression ratio of <1, 1 and >1 mean that the gene expression level is down-regulated, the same or up-regulated, respectively, in the hemocytes of WSSV-infected shrimps compared to the uninfected control.
Western blot analysis of PmVRP15 native protein in control (NaCl) and WSSV- injected (WSSV) P. monodon hemocytes.
Hemocytes were collected at 48(HLS) was prepared and 70 μg of total HLS protein per track was subjected to duplicate SDS-PAGE resolution. Gels were then either stained with coomassie blue for total protein detection or subject to Western-blot analysis to detect PmVRP15 and β-actin using specific antibodies. M is the protein size markers.
Localization of PmVRP15 and VP28 in uninfected and WSSV-infected P. monodon hemocytes
The location of PmVRP15 and VP28 proteins in hemocytes and the potential cell type(s) that produce the protein was examined by CLSM using the antibodies specific to PmVRP15 and the WSSV late protein VP28 coupled with different fluorescence-conjugated secondary antibodies. Since PmVRP15 and VP28 were detected as green and red fluorescence, respectively, the accepted fraction of the emission spectra of TO-PRO-3, used to stain the nuclear DNA, was adjusted to show as blue. Three types of hemocytes (hyaline, semigranular and granular cells) were visible in the bright field image (Fig. 5A). In the uninfected (control) shrimp hemocytes, all three types of hemocytes were weakly positive for PmVRP15, and the protein was localized in the cytoplasm near to the nuclear membrane (Fig. 5B). In the WSSV-infected shrimps, the PmVRP15 protein expression level was hardly detected at 6 hpi but significantly up-regulated at 24 hpi (not shown) and 48 hpi (Fig. 5) and in the moribund shrimps (not shown). Interestingly, PmVRP15 and VP28 protein expression were found in the same hemocytes at the late infection phase (48 hpi) and the moribund stage of viral infection (Fig. 5 and not shown, respectively). Thus, the expression of PmVRP15 in P. monodon hemocytes appears to be linked to a response to the acute phase of WSSV infection.
Figure 5
CFLM-derived images of the uninfected (control) and WSSV-infected hemocytes at 48 hpi with WSSV.
Rabbit anti-rPmVRP15 and mouse anti-VP28 primary antibodies were detected with corresponding Alexa488 and Alexa568 secondary antibodies revealing PmVRP15 (green color) and VP28 (red color), respectively. Scale bars represent (A) 5 μm and (B) 2 μm. Nucleus was stained with TO-PRO-3 iodide and color was adjusted to blue. The bright field image showed hyaline cell (HC), semigranular cell (SGC) and granular cell (GC).
CFLM-derived images of the uninfected (control) and WSSV-infected hemocytes at 48 hpi with WSSV.
Rabbit anti-rPmVRP15 and mouse anti-VP28 primary antibodies were detected with corresponding Alexa488 and Alexa568 secondary antibodies revealing PmVRP15 (green color) and VP28 (red color), respectively. Scale bars represent (A) 5 μm and (B) 2 μm. Nucleus was stained with TO-PRO-3 iodide and color was adjusted to blue. The bright field image showed hyaline cell (HC), semigranular cell (SGC) and granular cell (GC).
Effect of PmVRP15 gene knockdown on viral propagation in P. monodon hemocytes
Since PmVRP15 transcripts and protein were found to be highly up-regulated in the hemocytes of WSSV-infected shrimps, then the potential importance of PmVRP15 in the shrimp's response to WSSV infection was evaluated using RNAi-mediated gene knockdown by injection of PmVRP15 dsRNA. Injection of dsRNA PmVRP15 specifically suppressed the PmVRP15 transcription levels in shrimp hemocytes at 24 hpi whereas the injection with GFP dsRNA had no effect on PmVRP15 mRNA expression levels (Fig. 6A). The suppression of PmVRP15 expression at the translational level was also confirmed. Twenty-four hour after knocking-down PmVRP15 gene in WSSV-infected shrimp, PmVRP15 protein expression level in the shrimp hemocyte lysate was compared with that of the control WSSV-infected shrimp with GFP dsRNA injection. The result showed that PmVRP15 protein expression level in WSSV-challenge shrimp was significantly decreased after PmVRP15 gene silencing (Fig. 6B).
Figure 6
The PmVRP15 gene silencing in P. monodon hemocytes.
(A) Transcriptional level of PmVRP15 transcripts after 24 h post-WSSV infection and -PmVRP15 gene knockdown in the P. monodon hemocytes was determined by RT-PCR using gene specific primers. The control was shrimp that was injected with GFP dsRNA. Three individuals were used for each group and each experiment was performed in triplicate. (B) Protein expression level of PmVRP15 was detected in both groups to confirm the success of PmVRP15 knockdown. Hemocytes were collected at 24 h after PmVRP15 gene knockdown in WSSV-infected shrimp, 70 μg of total HLS protein was analyzed by SDS-PAGE and western blot analysis using antibody specific to PmVRP15 and β-actin protein, an internal control.
The PmVRP15 gene silencing in P. monodon hemocytes.
(A) Transcriptional level of PmVRP15 transcripts after 24 h post-WSSV infection and -PmVRP15 gene knockdown in the P. monodon hemocytes was determined by RT-PCR using gene specific primers. The control was shrimp that was injected with GFP dsRNA. Three individuals were used for each group and each experiment was performed in triplicate. (B) Protein expression level of PmVRP15 was detected in both groups to confirm the success of PmVRP15 knockdown. Hemocytes were collected at 24 h after PmVRP15 gene knockdown in WSSV-infected shrimp, 70 μg of total HLS protein was analyzed by SDS-PAGE and western blot analysis using antibody specific to PmVRP15 and β-actin protein, an internal control.The transcript expression level of representative WSSV genes for the three stages of WSSV infection; namely ie-1 (very early stage), wsv477 (early stage) and vp28 (late stage), was determined after PmVRP15 knockdown in WSSV-infected shrimp by qRT-PCR. The transcript expression level of all three viral genes tested was considerably decreased in the PmVRP15 knockdown shrimps (by 83.5%, 85.5% and 94.8% for ie-1, wsv477 and vp28, respectively) compared to the control shrimps (Fig. 7). The decrease in WSSV transcript levels suggested that PmVRP15 might participate in the WSSV propagation process.
Figure 7
The effect of PmVRP15 gene silencing on WSSV propagation in P. monodon hemocytes.
Transcript expression level of the WSSV genes: ie-1, wsv477 and vp28, in PmVRP15 gene-silenced P. monodon hemocytes were determined by qRT-PCR. Data are shown as the mean ±1 SD of three replicates and as the fold change of ie-1, wsv477 and vp28 after normalization to the EF-1α transcript levels (grey bar). The control group (GFP-dsRNA injected) are shown in the black bars.
The effect of PmVRP15 gene silencing on WSSV propagation in P. monodon hemocytes.
Transcript expression level of the WSSV genes: ie-1, wsv477 and vp28, in PmVRP15 gene-silenced P. monodon hemocytes were determined by qRT-PCR. Data are shown as the mean ±1 SD of three replicates and as the fold change of ie-1, wsv477 and vp28 after normalization to the EF-1α transcript levels (grey bar). The control group (GFP-dsRNA injected) are shown in the black bars.
Cumulative mortality of P. monodon shrimp after PmVRP15 gene knockdown
As stated above, after PmVRP15 gene knockdown in WSSV-infected shrimp, the expression level of representative WSSV genes was significantly decreased suggesting the involvement of PmVRP15 in the WSSV propagation. PmVRP15 gene was silenced in WSSV-infectedP. monodon and the mortality of shrimp was observed in parallel to those silenced with GFP dsRNA. The cumulative mortality result showed that, after 66–102 hours post-WSSV infection, mortality rate of PmVRP15 knockdown group was 50% lower than that of control group (The shrimp mortality reached 100% at 90 hpi) (Fig. 8A). However, after 102 hpi, the cumulative mortality of PmVRP15 knockdown shrimp was gradually increased and reached 100% at 144 hpi (6 dpi). Due to the fact that PmVRP15 gene is highly up-regulated after WSSV infection, here, the PmVRP15 gene recovery after PmVRP15 dsRNA and WSSV injection was determined. Figure 8B showed that PmVRP15 gene was recovered for about 50% at 36 hpi and to the same level as in the control at 60 hpi. According to the results, we confirmed that the absence of PmVRP15 gene in shrimp affected the mortality of WSSV-infected shrimp.
Figure 8
The involvement of knockdown PmVRP15 gene in WSSV infection in shrimp.
(A) Cumulative mortality of WSSV-infected PmVRP15 gene knockdown shrimp (black line) was compared with that of the control, WSSV-infected GFP gene knockdown shrimp (Grey line). Data are shown as the mean ±1 S.D. and are derived from three independent repeats. (B) After knockdown PmVRP15 gene in WSSV-infected shrimp, PmVRP15 gene recovery was observed after WSSV infection at 24, 36, 48 and 60 hpi.
The involvement of knockdown PmVRP15 gene in WSSV infection in shrimp.
(A) Cumulative mortality of WSSV-infected PmVRP15 gene knockdown shrimp (black line) was compared with that of the control, WSSV-infected GFP gene knockdown shrimp (Grey line). Data are shown as the mean ±1 S.D. and are derived from three independent repeats. (B) After knockdown PmVRP15 gene in WSSV-infected shrimp, PmVRP15 gene recovery was observed after WSSV infection at 24, 36, 48 and 60 hpi.
Discussion
To study the mechanism of WSSV infection and propagation, an understanding of the immune response of shrimps is an important key. PmVRP15 transcripts were found in all tissues examined of uninfected P. monodon shrimps, but were mainly expressed in the hemocytes. Hemocytes are the major immune cells of shrimps and play an essential role in both the cellular and humoral immune responses. Three different types of hemocytes (granular, semigranular and hyaline cells) have been classified in shrimp hemolymph [29]–[30]. In crustaceans, specific (but partially overlapping) functions have been attributed to the different hemocyte types, such as phagocytosis in hyaline cells, encapsulation, phagocytosis, ProPO system and cytotoxicity in semigranular cells, and the ProPO system and cytotoxicity in granular cells [31]. In contrast, the PmVRP15 protein was located in all three types of hemocytes, suggesting that PmVRP15 may have a more constitutive or broad immune based function. Upon WSSV infection, the expression of PmVRP15 transcripts and protein were both up-regulated in P. monodon hemocytes, exclusively within WSSV-infected ones.From the SSH analysis (our unpublished data), PmVRP15 transcripts appeared to be highly expressed in the acute phase of WSSV-infectedP. monodon hemocyte; however, the function of its gene product have not been characterized. Interestingly, several hemocyte proteins were found to be significantly altered in their expression levels in the different stages of virus infection, including both well-characterized proteins and those of currently unknown function [21]. Several cognate immunity proteins involved in viral defense responses have been found to be up-regulated in the early phase of viral infection, such as the antimicrobial peptides ALFPm3, Peneidin5 and hemocyanin [21], [32]–[34]. During the acute phase of WSSV infection, the host immune responses and mechanism(s) used are not yet fully understood, but several host proteins have previously been identified that show altered expression levels, including the scavenger receptor [35] and transglutaminase [36] amongst others. Recently, the unknown function PmHHAP, which is highly up-regulated in viral infected shrimps, was identified and characterized as a novel responsive protein that plays an important role in hemocyte homeostasis [23].Nuclear membrane proteins have been reported in many vertebrates to act as a path of infection for viruses, such as influenza virus [37] and herpes virus [38]–[39]. However, such protein functions remain unknown in invertebrates. Herein, we found that the expression of PmVRP15 was mainly located at the nuclear membrane of P. monodon hemocytes. Moreover, hemocytes that were infected with WSSV also expressed PmVRP15 at high levels. It would be interesting to study how a severe WSSV infection can stimulate PmVRP15 expression. In addition, the data presented here may represent the first report linking a correlative relationship between a potential P. monodon nuclear membrane protein (PmVRP15) and WSSV infection. However, an actual direct causative role, and the mechanism of such, remains to yet be established.In the acute viral infection phase, the host cells not only express defensive molecules that play a role in protecting the host cell against the virus, but the virus uses the host machinery to express viral proteins for propagation, including the immediate early, early and late genes [40]. At this stage the host cell loses the ability to regulate gene expression and is seconded to perform virus multiplication. Although cell death by apoptosis is one last line of host defense, whereby the infected cell is self-signaled for destruction to prevent viral replication and so to protect against viral spread to other cells, some viral proteins can inhibit the apoptosis system, including in WSSV the anti-apoptosis protein-1, AAP-1 [41] and WSSV222 [42]. The high expression level of PmVRP15 found here in WSSV-infectedP. monodon hemocytes is in agreement with (but not conclusive for) that PmVRP15 is up-regulated to mediate viral propagation in the acute phase of infection, since PmVRP15 gene knockdown resulted in a significant decrease in viral gene expression, as observed for ie-1 (an immediate early gene), wsv477 (an early gene) and vp28 (a late gene) transcripts and in the delay of shrimp death upon WSSV infection. Additionally, PmVRP15 protein was found to be localized near the nuclear membrane in the cytoplasm of WSSV-infected hemocytes which coupled with the predicted presence of transmembrane domain, suggests it may function at least in part as a nuclear membrane (or proximally related membrane) protein. If so, this is in accord with the notion that the host machinery was used to transport the viral components in the host cell, as found in the transmembrane protein PmRab7 [43]. The interaction of viral and host proteins is a potentially important key to answer the function of PmVRP15 in WSSV-infected cells, and could initially be addressed by, for example, using co-immunoprecipitation or the yeast two-hybrid screening assays. Nevertheless, the mechanism of control of expression (transcriptional control) of the PmVRP15 gene would also be interesting to elucidate, including characterization of the promoter. These aspects are now under investigation in an attempt to reveal the mechanism and regulation of PmVRP15 in WSSV propagation in P. monodon hemocytes.
Conclusion
The cDNA of a novel viral responsive gene from the black tiger shrimp (P. monodon), PmVRP15, was cloned and sequenced to acquire the full-length cDNA coding sequence. Expression analysis showed PmVRP15 transcripts were mainly found in hemocytes and along with the PmVRP15 protein were highly up-regulated in WSSV-infected hemocytes. PmVRP15 protein was localized at or near the nuclear membrane of uninfected and WSSV-infected shrimp hemocytes. After RNAi-mediated PmVRP15 suppression, WSSV propagation and shrimp mortality were markedly decreased. The function of PmVRP15 is unknown but it possibly plays a role in WSSV propagation in shrimp hemocyte.