Literature DB >> 24627865

Identification and cloning of putative water clarification genes of Moringa peregrina (Forssk.) Fiori in E. coli Xl1 blue cells.

Reihaneh Ghodsi1, Hamid Mirmohammad Sadeghi2, Gholamreza Asghari3, Sepideh Torabi1.   

Abstract

BACKGROUND: Water purification processes include the use of chemical compounds despite the concern that they may induce diseases. An ecological solution to this dilemma can come from the use of plant seeds for this purpose. Moringa peregrina (Forssk.) Fiori seeds have water clarification ability. Therefore, the aim of this work was to look for certain water clarification genes in M. peregrina.
MATERIALS AND METHODS: After preparation of M. peregrina callus, mRNA was extracted from these cells. After application of reverse transcriptase, the obtained cDNA (s) were used for PCR amplification of the desired genes using primers based on MO2.1 gene of Moringa oleifera. DNA amplification products were cloned in E. coli Xl1 blue cells and DNA sequences were compared with Mo1,2 gene in M. oleifera.
RESULTS: We obtained 3 PCR products (approximately 200, 300, and 400 bps).
CONCLUSION: After comparison of the sequences of 300bp band obtained from M. peregrina with Mo1,2 gene in M. oleifera, it seems that 300bp band is a good candidate to investigate regarding its potential flocculent activity.

Entities:  

Keywords:  Flocculent activity; Moringa peregrina; genes cloning

Year:  2014        PMID: 24627865      PMCID: PMC3950800          DOI: 10.4103/2277-9175.125807

Source DB:  PubMed          Journal:  Adv Biomed Res        ISSN: 2277-9175


INTRODUCTION

More than 3.5 million people die each year from water-related diseases; 84 percent of them are children and 98 percent of the total deaths occur in the developing world.[1] Nowadays a variety of water purification processes exist including the building of complex engineering solutions that typically require the use of a chemical purification process. The most common type of water treatment systems used in drinking water facilities is the processes of coagulation and flocculation to remove the organic and inorganic particles from water before the disinfection process.[2] Modern systems typically use chemical compounds like alum and ferric salts to change the water from a liquid to a semi-solid in a process called coagulation.[3] However, the use of these chemicals may induce Alzheimer or other diseases.[45] An ecological, economical, and sustainable solution to this dilemma can come from the seeds of a Moringa species commonly known as the miracle tree. Moringa is the sole genus in the flowering plant family Moringaceae. The 13 species it contains are from tropical and subtropical climates and range in size from tiny herbs to massive trees.[6] The Moringa tree has a wide range of use in the areas of agriculture, health, and industry for developing countries. Moringa serves as a medicinal plant, animal fodder, and a food source for humans. However, the Moringa tree is most praised for its nutritional abilities. Just about every part of the Moringa can be consumed and it contains some concentrations of vitamins and minerals.[78] The most widely known species is Moringa oleifera, a multi-purpose tree native to the foothills of the Himalayas in northwestern India.[9] M. peregrina (Forssk.) Fiori is also widely grown, but to a much lesser extent than M. oleifera in Saudi Arabia, India and south of Iran.[10] Moringa oleifera contains small storage proteins capable of flocculating particles in suspension in water that can be used for water treatment.[11] Preliminary studies have suggested that the active components are water-soluble cationic peptides with molecular masses ranging from 6to 16 kDa. The coagulating activity associated with M. oleifera Lam. seed extracts had indicated the activity of low molecular weight proteins. The sequence of one of these proteins has been determined and shown to be a positively charged 6-kDa polypeptide (around 200bp), called MO2.1. It acts as a water clarification agent.[1213] Flo is also an antibacterial peptide isolated from seeds of a tropical tree (Moringa oleifera Lam.). The amino acid sequence of Flo and its sub-fragments were based on Moringa oleifera Lam. seed component MO2.1. Flo has antibiotic activity that leads to growth inhibition and killing of bacteria, including antibiotic-resistant human pathogens. (Swiss-Prot primary accession number: P24303). Moringa peregrina seeds also have shown coagulating activity[14] and antioxidant activity.[15] Its antioxidant activity has been reported to be related to flavoniod and glucosinolates of the plant[16] but seed's protein seems to be responsible for coagulating activity. In the present study, the presence of MO2.1 protein in Moringa peregrina was studied. Also, the DNA sequences of M. peregrina, using primers based on MO2.1 of M. oleifera, were amplified, and the DNA amplified products were cloned in E. coli Xl1 blue cells and DNA sequences were compared with M. oleifera.

MATERIALS AND METHODS

The cDNA(s) coding for putative water clarification genes were amplified by RT-PCR from poly-A RNAs purified from callus of M. peregrina. M. peregrina seeds were provided by Kerman Jahad Keshavarzi Research Center. The fresh callus of Moringa peregrina was obtained using seedling on Murashige and Skoog media[17] Callus was crushed in liquid nitrogen and mRNA was extracted using the “PLANT Rneasy kit”(QIAGEN, Germany) and cDNA was prepared by “RevertAid™ First strand cDNA synthesis kit”(Fermentas, Poland). Primers were designed based on the sequence of MO2.1 protein in NCBI. The sequences of forward and reverse primers were 5′–CAG GGA CCT GGT CGG CAG CCG GAC TTT CAG-3′ and 5′- TTA GGT GCT AGG TAT ATT GGA TGC CAC TCG GTA-3′, respectively. PCR conditions were as follows: 94°C, 30 s; 36°C, 30s; 72°C, min; 30, cycle. Three DNA fragments of around 200 bp, 300bp, and 400bp were amplified. After extraction of these fragments from agarose gel, they were cloned in pTZ57R/T vector using “InsTAclone™ PCR cloning kit”(Fermentas, Poland. Subsequently, the prepared plasmids by “Gene JET™ plasmid, miniprepkit” (Fermentas, Poland) were sent for sequencing (Kowsar Biotech, Iran).

RESULTS

mRNA was isolated from Moringa peregrina [Figure 1] and after preparation of cDNA, PCR amplification of putative water clarification genes was performed using specific primers as described in Materials and Methods. As presented in Figure 2 three bands of approximately 200, 300, and 400 bps can clearly be seen. After cloning of these fragments into pTZ57R plasmid, their presence was confirmed by double digestion with sac1 and sma1 restriction enzymes [Figures 3 and 4].
Figure 1

Electrophoresis of the prepared mRNA from f Moringa peregrina. 5 μl of the product was electrophoresed on 1% agarose gel Lane 1: DNA size marker. Lane 2, 3, 4, 5,: mRNA samples

Figure 2

Electrophoresis of the obtained PCR products. 3μl of the product was electrophoresed on 0.8% agarose gel. In lanes 6 and 7 three bands of approximately 200, 300, and 400 bp bands can be observed Lane 1: DNA size marker. Lanes 2-7: PCR product sample. Lane 1: DNA size marker. Lanes 2-7: PCR product sample

Figure 3

pTZ57R plasmids obtained after ligation with the obtained PCR fragments (lanes 1-5). 5 μl of each plasmid was loaded on 0.8% agarose gel and electrophoresed

Figure 4

Double digestion of the recombinant pTZ57R plasmids with sac1 and sma1 restriction enzymes. 5 μl of each sample was loaded on 0.8% agarose gel and electrophoresed. Three bands of about 200 bp and 300bp ana 400bp were observed after digestion. Lane 1: DNA size marker. Lane 2, 3 and 4: Recombinant pTZ57R plasmids Digested with SacI and SmaI restriction enzymes

Electrophoresis of the prepared mRNA from f Moringa peregrina. 5 μl of the product was electrophoresed on 1% agarose gel Lane 1: DNA size marker. Lane 2, 3, 4, 5,: mRNA samples Electrophoresis of the obtained PCR products. 3μl of the product was electrophoresed on 0.8% agarose gel. In lanes 6 and 7 three bands of approximately 200, 300, and 400 bp bands can be observed Lane 1: DNA size marker. Lanes 2-7: PCR product sample. Lane 1: DNA size marker. Lanes 2-7: PCR product sample pTZ57R plasmids obtained after ligation with the obtained PCR fragments (lanes 1-5). 5 μl of each plasmid was loaded on 0.8% agarose gel and electrophoresed Double digestion of the recombinant pTZ57R plasmids with sac1 and sma1 restriction enzymes. 5 μl of each sample was loaded on 0.8% agarose gel and electrophoresed. Three bands of about 200 bp and 300bp ana 400bp were observed after digestion. Lane 1: DNA size marker. Lane 2, 3 and 4: Recombinant pTZ57R plasmids Digested with SacI and SmaI restriction enzymes After sequencing these fragments, only 300bp band showed some homology with MO2.1 sequence (60%homology) while 200 and 400bp bands did not show any similarities with MO2.1 sequence MO1,2 sequence: CAGGGACCTGGTCGGCAGCCGGACTTTCAGCGTTGCTGCCAACAGCTGCGGAACATATCTCCTCCTTGCAGGTGCCCATCACTCAGGCAAGCAGTACAGTTGACACACCAGCAGCAGGGACAGGTGGGTCCTCAGCAGGTAAGGCAGATGGTACCGAGTGGCATCCAATATACCTAGCACCTAA.

Cloned sequence

CAGGGACCTGGTCGGCAGCCGGACTTTCAGTGANNNNNNNNNNATAGCATCTGAATGATGCCACAGGGTTTTGAGAACANATTCACTTCCTTCACTGCTGGATTTTAGCAACTCCACACCCAAGTAACATCTGCAAAATATGTAAAAAATGATCTTTCCAACCATGAAGGAAAATAAACCTGCAGTTTTCTTTCACAAGCAACAAATAAAGGAAAGAGTCTCTAGCATTCCTAAAGTACAAGTAGATTATAAAGTGCCACGACCACTTCTCAAGGTCAGATATCCATAAGCTTTTGTGTGATTACTTGTAAATAGGTGTATCATGTGAACAAAGAAAATTAANAAAAAAGAAGGTGCTATACCGATAGCTCTGGCAAATCCAACGAGCAAGTGTCTGAGCTTCAGGAGTACCGAGTGGCATCCAATATACCTAGCACCTAA.

DISCUSSION

Moringa is the sole genus in the Moringaceae plant family and contains several species including M. Olifera and M. peregrina. A protein with high flocculant activity was identified by Gassenschmit et al., 1995. Several proteins fraction with flocculent activity were identified but only one of them, Mo1,2, was entirely sequenced.[18] Short amino acid sequences of two other proteins, Mo1,3 and mo1,4, were also determined. Broin et al., cloned and expressed the recombinant protein MO (2.1), in Escherichia coli.[13] This protein, MO (2.1) had a flocculent activity as assessed by different methods. This suggests that several protein families with flocculent activity can be identified in Moringa genus.[19] In the present study we decided to search for a similar protein in M. peregrina. We obtained three PCR products from Moringa peregrina and compared their sequences with the flocculent protein, Mo1,2, in Moringa oleifera. One of the open reading frames (ORF) of the 300bp band seemed to have approximately 60% homology with Mo1,2, sequence. Other ORFs for the 300 and well as 200 and 400 kb bands did not lead to a meaningful coding sequence.

CONCLUSION

It can be concluded from this study that based on the homology found between the 300bp band and Mo1,2, it is possible that this fragment codes for a protein with flocculent activity in Moringa peregrina. Further experiments are required to examine this finding.
  8 in total

Review 1.  Aluminium as a risk factor in Alzheimer's disease, with emphasis on drinking water.

Authors:  T P Flaten
Journal:  Brain Res Bull       Date:  2001-05-15       Impact factor: 4.077

2.  Isolation and characterization of a flocculating protein from Moringa oleifera Lam.

Authors:  U Gassenschmidt; K D Jany; B Tauscher; H Niebergall
Journal:  Biochim Biophys Acta       Date:  1995-04-13

3.  Expression of a plant-derived peptide harboring water-cleaning and antimicrobial activities.

Authors:  M Suarez; J M Entenza; C Doerries; E Meyer; L Bourquin; J Sutherland; I Marison; P Moreillon; N Mermod
Journal:  Biotechnol Bioeng       Date:  2003-01-05       Impact factor: 4.530

4.  Flocculent activity of a recombinant protein from Moringa oleifera Lam. seeds.

Authors:  M Broin; C Santaella; S Cuine; K Kokou; G Peltier; T Joët
Journal:  Appl Microbiol Biotechnol       Date:  2002-08-23       Impact factor: 4.813

5.  Isolation and characterization of coagulant extracted from Moringa oleifera seed by salt solution.

Authors:  T Okuda; A U Baes; W Nishijima; M Okada
Journal:  Water Res       Date:  2001-02       Impact factor: 11.236

6.  Geographical relation between Alzheimer's disease and aluminum in drinking water.

Authors:  C N Martyn; D J Barker; C Osmond; E C Harris; J A Edwardson; R F Lacey
Journal:  Lancet       Date:  1989-01-14       Impact factor: 79.321

7.  Determination of volatile glucosinolate degradation products in seed coat, stem and in vitro cultures of Moringa peregrina (Forssk.) Fiori.

Authors:  S Dehshahri; S Afsharypuor; G Asghari; A Mohagheghzadeh
Journal:  Res Pharm Sci       Date:  2012-01

8.  Antioxidant activity of methanolic leaf extract of Moringa peregrina (Forssk.) Fiori.

Authors:  S Dehshahri; M Wink; S Afsharypuor; G Asghari; A Mohagheghzadeh
Journal:  Res Pharm Sci       Date:  2012-04
  8 in total
  1 in total

1.  Genetic diversity of Moringa peregrina species in Saudi Arabia with ITS sequences.

Authors:  Abdullah Alaklabi
Journal:  Saudi J Biol Sci       Date:  2014-10-18       Impact factor: 4.219

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.