Silencing alpha-fetoprotein inhibits VEGF and MMP-2/9 production in human hepatocellular carcinoma cell.

Alpha-fetoprotein not only serves as a diagnostic marker for liver cancer, but also posses a variety of biological functions. However, the role of Alpha-fetoprotein on tumor angiogenesis and cell invasion remains incompletely understood. In this study, we aimed to evaluate if Alpha-fetoprotein can regulate the major angiogenic factors and matrix metalloproteinases in human liver cancer cells. Alpha-fetoprotein silencing was achieved by Stealth RNAi. Expression of Alpha-fetoprotein was examined by a full-automatic electrochemistry luminescence immunity analyzer. Expression of VEGF, VEGFR-2, MMP-9, and MMP-2 was examined by Western blot and immunocytochemistry. Apoptosis was detected by TUNEL assay. Angiogenesis was detected by in vitro angiogenesis assay kit. Silencing of Alpha-fetoprotein led to an increased apoptosis, which was associated with a decreased expression of vascular endothelial growth factor, vascular endothelial growth factor receptor 2, matrix metalloproteinases-2/9. These results suggest that Alpha-fetoprotein may play a regulatory role on angiogenesis and cell invasion during liver cancer development.

Introduction

Human hepatocellular carcinoma (HCC) is the third most common cause of cancer-related death [1]. Many aberrantly regulated signaling pathways, such as PI3K/AKT/mTOR pathway, RAF/MEK/ERK pathway, WNT/β-Catenin pathway, and VEGF/VEGFR pathway, have been reported in HCC [2]–[4] and these molecular pathways may constitute ideal targets for HCC therapy and prevention.

Alpha-fetoprotein (AFP) is perhaps the best-defined tumor marker for HCC, and as such, it is still widely used in clinical setting as an adjuvant diagnostic and prognostic tool. Up to 70% of HCC cases exhibit elevated serum level of AFP [5], [6], but its pathophysiological functions in HCC is poorly defined. It is now known that AFP is not just a fetal form of carrier protein and a tumor marker, it is also critically involved in the regulation of several important cellular functions, such as cell growth, differentiation and apoptosis[7]–[10]. It has been reported that AFP could promote the proliferation of liver cancer cells [11], [12] and regulate apoptosis in HCC cells through Fas/FasL [13], Caspase-3 [6] and PI3K/AKT signaling pathways [14]. It’s clarified that PI3K/AKT pathway can be regulated in an autocrine manner by various growth factors, such as insulin-like growth factor (IGF) and vascular endothelial growth factor (VEGF) [15], [16]. However, the mechanism of AFP on regulating angiogenesis and tumor invasion in HCC is still unknown.

Angiogenesis is a critical process that is essential for all solid tumors to grow and metastasize. HCC is a highly vascular tumor in which angiogenesis plays an essential role for tumor progression and metastasis. Clinically, patients with advanced HCC usually die of tumor metastasis and recurrence even after curative resection. Active angiogenesis during HCC development and progression is likely due to the rich expression of pro-angiogenic factors such as VEGF [3] and its receptors (VEGFR-1, -2 and -3), all of which have been observed in ample abundance in HCC cell lines and the serum of HCC patients [3], [17]. Overexpression of VEGF was also observed in pre-cancerous conditions such as cirrhotic and dysplastic liver tissues, further suggesting a role for VEGF-mediated angiogenesis in liver cancer [18]. The rich expression of VEGF was not only associated with HCC development, but also correlated with HCC tumor grading [19].

VEGF signaling through VEGFR-2 is the major angiogenic pathway, and blockade of VEGF/VEGFR-2 signaling is the first antiangiogenic strategy for cancer therapy [20]. In this aspect, the multikinase inhibitor Sorafenib has demonstrated some therapeutic benefits for patients with advanced HCC [21], [22]. This agent has been shown to exert an anti-angiogenic role by targeting major receptors for VEGF (mainly VEGF-2 and VEGF-3). Sorafenib also blocks tumor cell proliferation by inhibiting RAF/MEK/ERK signaling pathway [23]–[25]. Although there were some studies mentioned that AFP, VEGF, MMP2 may associated with increased hepatoma cell infiltration and matastasis, but so far, no research studied on the regulation of VEGF/MMP-2/MMP-9 by AFP has been reported.

In this study, we aim to investigate if AFP modulates the expression of VEGF and regulates angiogenesis.

Materials and Methods

Huh-7 cell line (AFP positive) was a gift from the Department of Cell Biology, Peking University Health Science Center. Monoclonal antibody against AFP (anti-AFP) was purchased from Sigma (St. Louis, USA). Dulbecco’s modified Eagle’s medium (DMEM) was purchased from Invitrogen (California, USA). Monoclonal antibodies against VEGF, VEGFR-2 (KDR), MMP-2, and MMP-9, as well as anti-β-actin were purchased from Abcam (Cambridge, MA, USA).

Methods

Design and synthesis of stealth RNAi against AFP

Three different RNAi sequences were designed and synthesized. These sequences were selected against the nucleotides 152–176 (HSS303-Stealth RNAi), 245–269 (HSS304- Stealth RNAi), and 546–570 (HSS202-Stealth RNAi) of the human AFP mRNA (GenBank Accession No. NM001134), according to the siRNA design guidelines [26]. Sequences of the three synthesized oligonucleotides are: HSS303: sense 5′-UAAACUUAUCUCUGCAGUACAUUGG-3′, anti-sense 5′-CCAAUGUACUGGAGAGAUAAGUUUA-3′; HSS304: sense 5′-AAUUGCAGUCAAUGCA UCUUUCACC-3′, anti-sense 5′-GGUGAAAGAUGCAUUGACUGCAAUU-3′; HSS202: sense 5′- AUAAGUGUCCGAUAAUAAUGUCAGC-3′, anti-sense 5′- GCUGACAUUAUUAUCGGAC ACUUAU-3′. These target sequences were submitted to a BLAST search to ensure that only the AFP gene was targeted.

Cell culture and transfection

Human HCC cell line Huh-7 cells were cultured in DMEM, and supplemented with 100 ml/L FCS at 37°C in a humidified atmosphere of 5% CO2. The culture medium was changed after 24 h. Synthesized Stealth RNAi against AFP were transfected into Huh-7 cells using the Lipofectamine™ RNAi Max transfection Agent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The transfection efficiency was optimized using BLOCK-IT™ Alexa Fluor Fluorescent control. Cells transfected with LP2000 or medium without Stealth RNAi were used as controls. The transfection efficiency of each duplex siRNA was confirmed by Roche E170 full-automatic electrochemistry luminescence immunity analyzer.

Apoptosis

Apoptosis was detected by TUNEL assay 48 h after in Huh-7 cells were transfected with AFP-siRNA, using an In Situ Cell Death Detection Kit (Roche, Branchburg, NJ, USA) according to the manufacturer’s instruction. The number of apoptotic bodies were counted and averaged from three visual fields.

Protein extraction and western blotting analysis

Cells treated as described above were harvested at 48 h, washed three times with PBS (pH 7.4, 0.15 M), and total protein was extracted in RIPA buffer. Approximately 60 µg of total protein of each group was subjected to SDS-PAGE and transferred to PVDF membrane. The membranes were blocked with 5% skim milk in TBST, and incubated with the primary antibody (dilution 1∶1000) in TBST containing 1% skim milk overnight at 4°C. After being washed for 3 times with TBST, the membranes were incubated with the horseradish peroxidase conjugated secondary antibody (1∶4000, Santa Cruz Biotech, USA) at room temperature for 2 h. The membrane was exposed using Enhanced Chemiluminescence reagent (Chemicon International, USA). To confirm equal protein loading, membranes were re-probed with anti-β-actin antibody (Santa Cruz Biotech) in 1∶2000 dilution.

Total RNA extraction and real-time PCR analysis

Total RNA was isolated by using Trizol (Sigma, USA) extraction according to the manufacturer’s instructions. The total RNA was performed for reverse transcription using Prime Script™ RT reagent Kit (TaKaRa Bio Inc, Japan). Gene cDNA was detected using SYBR Premix Ex Taq™ (TaKaRa Bio Inc, Japan) in ABI 7500 Real-Time PCR (USA). The primers used were: for AFP, forward, TGCAGCCAAAGTGAAGAGGGAAGA; reverse, CATAGCGAGCAGCCCAAAGAAGAA; for VEGF, forward, TGCAGATTATGCGGATCAAACC; reverse, TGCATTCACATTTGTTGTGCTGTAG; for VEGFR-2, forward, TCCCGTTAGAAGAACCAGAAGT, reverse, TGAGGCAAGAACCATACCACT; for MMP-2, forward, TCTCCTGACATTGACCTTGGC, reverse, CAAGGTGCTGGCTGAGTAGATC; for MMP-9, forward, TTGACAGCGACAAGAAGTGG, reverse, GCCATTCACGTCGTCCTTAT; for GAPDH, forward, AGGGCTGCTTTTAACTCTGGT, reverse, CCCCACTTGATTTTGGAGGGA.

Transwell invasion assay

Invasion assays were performed using a Transwell chamber. Cells were re-suspended in culture medium containing 5% FCS and were added to each upper chamber at a concentration of 2.5×104 cells/well. The 10% FCS culture medium was added to the lower chamber as the chemoattractant. The chambers were incubated in a humidified culture incubator at 37°C, 5% CO2 atmosphere. After an overnight incubation, cells remained in the upper chamber membrane were removed and the cells in the lower chamber were counted under microscopy.

Angiogenesis

Angiogenesis assays were performed using an In Vitro Angiogenesis Assay Kit (MILLIPORE International, Inc. Cat. No. ECM625, Billerica, MA USA) according to kit protocol. Huh-7 cell line was seeded in 24-well plate, and transfected with LP2000+AFP-siRNA and LP2000 alone, and without any reagents (control). Approximately 48 hours after transfection, the AFP level in supernatant was detected by Roche E170 full-automatic electrochemistry luminescence immunity analyzer to confirm effective gene silencing. The supernatant of each group was used as conditioned medium to incubate the human umbilical vein endothelial cells (HUVECs). HUVECs were seeded in 24-well plate (1×104 cells per well). Angiogenesis was detected at 8 hours and photographs were taken under phase contrast microscopy.

Statistical analysis

All data were expressed as mean ± standard deviation and statistically analyzed by the t test with SPSS 13.0 software.

Results

Silencing of AFP Promotes Cell Apoptosis in Huh-7 Cells

Several sequences of AFP-siRNA were tested in our preliminary studies, and HSS202 was found to exert most effective silencing effect (Fig. 1). Thus, this sequence was used in the subsequent experiments.

Figure 1

Optimization and verification of the transfection efficiency of AFP-siRNA by BLOCK- IT Alexa Fluor Fluorescent control.

Huh-7 cells were transfected with control siRNA, or vehicle control (LP2000), or AFP-siRNA for 24 h, 48 h, and 72 h. A, Huh-7 cells were transfected with control vector alone. More than 70% of cells were successfully transfected. B. The silencing effect was tested by Roche E170 full-automatic electrochemistry luminescence immunity analyzer. C. The AFP expression level was detected by Real-Time PCR. Compared with control group, AFP level was silenced by using AFP-siRNA. D. AFP expression was detected by Western blot.

The effect of AFP silencing on apoptosis in Huh-7 cells was detected by a TUNEL assay. As shown in Figure 2, abundant apoptotic cells were observed in Huh-7 cells 48 h after they were transfected with AFP-siRNA (Fig. 2, F). Approximately 48, 73 and 238 apoptotic bodies were observed in the control, LP2000 control, and AFP-siRNA transfected groups respectively (table not shown).

Figure 2

Effect of AFP silencing on apoptosis of Huh-7 cells.

Cells were transfected with control siRNA, or vehicle control (LP2000), or AFP-siRNA for 48 hours. Apoptosis was detected by TUNEL assay. Cells were viewed under a phase contrast (A, C, E) and confocal microscopy (B, D, F). Compared with negative control group (A and B) and LP2000 group (C and D), cells transfected with AFP-siRNA (E and F) showed abundant apoptosis.

Impact of AFP Silencing on the Expression of VEGF and VEGFR-2 in Huh-7 Cell

In order to investigate the possible role of AFP on tumor angiogenesis, we examined the effect of AFP silencing on the expression of two major angiogenesis related factors including VEGF and VEGFR-2 (KDR). As shown in Fig. 3, inhibition of AFP by its specific siRNA led to a marked down-regulation of VEGF and VEGFR-2 (Fig. 3, C and D) in Huh-7 cells, as detected by Western blot analysis, and verified by immunocytochemistry and Real-Time PCR (Fig. 3, A and B). A quantitative analysis of the immunofluorescence staining data by electrochemistry luminescence showed that AFP-siRNA significantly reduced the expressions of VEGF and VEGFR-2 (mean density 12.44 and 48.17, respectively) compared to the cells without AFP silencing (79.15 and 127.42, respectively) (Table1).

Figure 3

Effect of AFP silencing on the expression of VEGF and VEGFR-2 (KDR) in Huh-7 cells.

Cells were transfected with control siRNA, vehicle control (LP2000) and AFP-siRNA for 24, 48, and 72 hours, and the expression of VEGF (A, C, a) and VEGFR-2 (B, D, a) was examined by Real-Time PCR and Western blot. Fluorescent staining of VEGF (Cb, Cc) and VEGFR-2 (Db, Dc) following transfection with control siRNA (Cb, Db) or AFP-siRNA (Cc, Dc) are shown. Quantitative analysis of VEGF (Cd, Ce) and VEGFR-2 (Dd, De) are shown as the mean fluorescent intensity.

Impact of AFP Silencing on the Expression of MMP-2 and MMP-9 in Huh-7 Cell Line

To clarify the possible role of AFP on tumor invasion, we examined the effect of AFP silencing on the expressions of two extracellular matrix metalloproteases MMP-2 and MMP-9, which are closely related to tumor invasion. As shown in Fig. 4, silencing of AFP inhibited the expression of MMP-9 and MMP-2 at the protein level (A, E), and this was associated with a reduced invasive ability of Huh-7 cells, as detected by a transwell invasion assay (B, C, D), and quantitatively expressed in Table 2.

Figure 4

Effect of AFP silencing on the expression of MMP-9 and MMP-2, and the invasive ability of Huh-7 cells.

Cells were transfected with control siRNA, vehicle control (LP2000) and AFP-siRNA. The expression of MMP-9 and MMP-2 was examined by Western blot (A) and Real-Time PCR (E). Impact of AFP-siRNA silencing on the invasive ability of Huh-7 cells was examined by chamber invasion assay. Transfection of Huh-7 cells with AFP-siRNA led to a decreased cell invasion (D) compared to cells transfected with control siRNA (B) or LP2000 (C).

Table 2

AFP silencing inhibits the invasive ability of Huh-7 cells.

	Control	LP2000	AFP-siRNA
Invaded cells	378.70±34.10	352.00±38.10	246.40±18.45*

Analyzed by Independent-Samples t-test.

*Indicate statistically significant difference (P<0.001).

Impact of AFP Silencing on Angiogenesis of Human Umbilical Vein Endothelial Cells (HUVECs)

In order to detect the effect of AFP Huh-7 cell line’s angiogenesis function by using in vitro Angiogenesis Assay Kit, collected Huh-7 cells (treated with AFP-siRNA) medium has been used for HUVECs culture. No apparent angiogenesis was observed in the HUVECs incubated with conditioned medium derived from AFP-siRNA treated Huh-7 cells (Fig. 5).

Figure 5

Effect of AFP silencing on angiogenesis of human umbilical vein endothelial cells (HUVECs).

HUVECs were cultured on ECMatrixTM gel (MILLIPORE International, Inc. Cat. No. ECM625, Billerica, MA USA) in the presence of conditioned medium derived from Huh-7 cells transfected with or without AFP-siRNA. A: Huh-7 cells without transfection (15 angiogenic networks per average 3 views); B: Huh-7 cells transfected with LP2000 as vehicle controls (12 angiogenic networks per average 3 views); C: Huh-7 cells transfected with LP2000+AFP-siRNA (no angiogenic networks were observed). Scale bars: 100 µm.

Discussion

AFP is not only serves as a valuable tumor maker for patients with liver cancer, but it also possess important regulatory effect for several important biological processes such as cell differentiation, proliferation and apoptosis in embryogenesis and tumor growth [10]. Our data show that silencing of AFP enhances apoptosis of Huh-7 cells, suggesting that under the physiological condition, AFP is essential for the maintenance of homeostasis. Previous studies have showed that AFP could regulate cell proliferation and apoptosis, and thus plays a role in liver cancer formation [11], [12], [14].

Angiogenesis is essential for the initiation, progression, and metastasis of many solid tumors including liver cancer. Numerous angiogenic factors such as vascular endothelial growth factor (VEGF) and its receptors (VEGFR-1, VEGFR-2), PDGFs, placental growth factors, transforming growth factor (TGF), basic fibroblast growth factor, Epidermal Growth Factor (EGF), hepatocyte growth factor (HGF), angiopoietins and interleukin 4 and interleukin 8 are involved in the regulation of tumor angiogenesis [27], [28], among which VEGF signaling through VEGFR-2 is the major angiogenic pathway in many cancer types. As such, blockade of VEGF/VEGFR-2 signalling is the first antiangiogenic strategy for cancer therapy. Guo and its colleagues also found expression of angiogenesis factors (MMPs and VEGF) in HCC tissues could be regarded as a clinical indicator in estimating the prognosis of HCC patients [29].

Previous studies by others have demonstrated that AFP itself may stimulate angiogenesis and induce metastasis of liver cancer [9], [30]. Increased serum AFP concentration was correlated with an enhanced VEGF-A protein expression in HCC tissue [2]. AFP was also reported as a pro-angiogenesis factor, possibly in a VEGF dependent manner [30], [31]. In our study, silencing of AFP expression significantly reduced the expression levels of VEGF and VEGFR-2 (KDR) in Huh-7 cells. By in vitro angiogenesis assay, we observed that silencing of AFP led to a reduced angiogenic ability of HUVECs. We postulate that AFP secreted by liver cancer cells may stimulate the tumor cells to produce VEGF which can then act on VEGFR-2, leading to increased tumor angiogenesis.

Extracellular matrix forms a part of the body’s defense network. Degradation of important components of the extracellular matrix by metalloproteinases contributes to tumor invasion and distant metastasis. Previous studies have showed that VEGF secreted by the tumor cells could induce the expression of plasminogen activators and matrix metalloproteinases, contributing to the degradation of basement membranes [32]. In our study, silencing of AFP caused a reduced expression of MMP-9 and MMP-2 in Huh-7 cells, further supporting the notion that in liver cancer, AFP not only contributes to angiogenesis, but may also play a role in tumor invasion.

Previous studies by others have demonstrated that AFP itself may stimulate angiogenesis and induce metastasis of liver cancer [9], [29]. Increased serum AFP concentration was correlated with an enhanced VEGF-A protein expression in HCC tissue [2]. AFP was also reported as a pro-angiogenesis factor, possibly in a VEGF dependent manner [29], [30]. In our study, silencing of AFP expression significantly reduced the expression levels of VEGF and VEGFR-2 (KDR) in Huh-7 cells. By in vitro angiogenesis assay, we observed that silencing of AFP led to a reduced angiogenic ability of HUVECs. We postulate that AFP secreted by liver cancer cells may stimulate the tumor cells to produce VEGF which can then act on VEGFR-2, leading to increased tumor angiogenesis.

Extracellular matrix forms a part of the body’s defense network. Degradation of important components of the extracellular matrix by metalloproteinases contributes to tumor invasion and distant metastasis. Previous studies have showed that VEGF secreted by the tumor cells could induce the expression of plasminogen activators and matrix metalloproteinases, contributing to the degradation of basement membranes [31]. In our study, silencing of AFP caused a reduced expression of MMP-9 and MMP-2 in Huh-7 cells, further supporting the notion that in liver cancer, AFP not only contributes to angiogenesis, but may also play a role in tumor invasion.

Table 1

AFP silencing reduced the expression of VEGF and VEGFR2 (KDR) in Huh-7 cells, as detected by the fluorescent level.

Protein	Transfection	Pixel	Mean fluorescence
VEGF	Control	2531.00	79.15
	AFP/siRNA	2509.00	12.44*
VEGFR2(KDR)	Control	3451.00	127.42
	AFP/siRNA	5551.00	48.17*

Analyzed by Independent-Samples t-test.

*Indicates statistically significant difference (P<0.05).