Literature DB >> 24578887

Significance of CDKN2A gene A148T variant in patients with bladder cancer.

Edyta Borkowska1, Adam Jędrzejczyk2, Andrzej Kruk3, Michał Pietrusiński1, Magdalena Traczyk1, Marek Rożniecki4, Bogdan Kałużewski1.   

Abstract

OBJECTIVES: The A148T polymorphism of CDKN2A gene is observed in various neoplasms with the incidence rate of 3-35%, however, rather little is known either about the frequency of its occurrence or of its significance in urinary bladder carcinoma.
MATERIALS AND METHODS: DNA was isolated from blood of 156 patients with urinary bladder carcinoma (130 men). In histopathology, 84 cases were classified as G1, 42 as G2, and 30 as G3. The clinical stage was in 81 cases estimated at Ta and in 75 cases at T1-T4. A148T polymorphism was detected by the MSSCP technique and by sequencing.
RESULTS: A148T polymorphism was identified in 9/156 urinary bladder carcinoma cases (only in men). The obtained results were compared with the polymorphism incidence for the Polish population, estimated by Debniak et al. The occurrence in the group of the bladder cancer patients turned out higher (5.77%) from that in the control group (2.89%) (G test, table 2×2: NBLADDER CANCER = 156, NCONTROL = 1210, G = 4.298, p <0.05).
CONCLUSION: Summing up and taking into account the analysis of clinical parameters and the age of the disease occurrence, the A148T polymorphism of CDKN2A gene was identified in the study group only in men, in whom the disease was diagnosed above the age of 60, while the diagnosed neoplasms were in the majority of cases characterized by higher clinical stages and higher grades of malignancy. This has been the first study that attempted to show a potential association between A148T alterations and an increased risk for bladder cancer development.

Entities:  

Keywords:  CDKN2A, A148T polymorphism; bladder cancer

Year:  2011        PMID: 24578887      PMCID: PMC3921733          DOI: 10.5173/ceju.2011.03.art17

Source DB:  PubMed          Journal:  Cent European J Urol        ISSN: 2080-4806


INTRODUCTION

All genetic variations originate from mutations, which are defined as changes in DNA sequence. Mutations can affect either germline cells (the cells which produce gametes) or somatic cells (all the cells other than germline cells). In human genetics, the term “mutation” has often been reserved for DNA sequence changes that cause genetic diseases and are consequently relatively rare. DNA sequence variants, which are more common in populations (i.e., such sequence variants in which two or more alleles at locus demonstrate frequencies >1%), are said to be polymorphic (“having many forms”) [1]. Such loci (plural of locus) are termed polymorphisms, although nowadays, alleles with frequency <1% are often called polymorphisms as well. Urinary bladder cancer is a common malignant disease in Poland [2]. Many genetic and epigenetic alterations are supposed to contribute directly or indirectly to bladder tumor induction [3, 4]. Attempts are undertaken to classify tumors with regards to the molecular characteristics of changes in neoplastic cells in order to be able to identify the relationship between the type of these changes and clinical characteristics. Every type of cancer has biological subsets that differ in clinical behavior and response to treatment. Personalized cancer medicine is defined as treatment based on the molecular characteristics of a tumor from individual patient. Nowadays this branch of medicine has great potential in the therapy of many types of cancer. Somatic mutations of P53, Rb, FGFR3, CDKN2A, and Ras genes belong to the group of mutations that most frequently accompany the occurrence of urinary bladder carcinoma [3, 4, 5]. Some of the constitutive changes of the genes (germline), e.g., A72P polymorphism of P53 gene, were also analyzed with regards to the higher risk of neoplasm development [6]. There are also reports, indicating correlations between constitutive mutations of CDKN2A gene and breast cancer, melanoma cancer, nervous system tumours and squamous cell carcinoma of the head/neck region [7, 8, 9], but rather little is known either about the frequency of its occurrence or of its significance in urinary bladder carcinoma. Most frequently described polymorphisms of CDKN2A gene are the substitution of alanine to threonine in the second exon (A148T- rs 3731249) and the two, which occur in the 3′ untranslated region of CDKN2A: NT 500c >g and Nt540c >t [7]. The CDKN2A gene (OMIM 600160), localized at chromosome 9p21 encodes p16INK4a cyclin-dependent kinase inhibitor and p14AR activator of p53 [3]. Both gene products have an independent first exon (1-alpha exon and 1-beta exon, respectively), but share exons 2 and 3 and are translated in different reading frames. The genes are involved in the negative control of cell proliferation; p16INK4a produces a G1 cell-cycle arrest by inhibiting the phosphorylation process of retinoblastoma protein (RB), and p14ARF acts both at G1/S phases in a p53-dependent manner via binding and inhibiting MDM2 protein. There are three major mechanisms at the base of genetic inactivation of CDKN2A gene, including deletions of both alleles, deletion of one allele and mutation of the other allele or deletion or mutation of the first allele and hypermethylation of the second allele. Unlike other suppressor genes, which most often undergo inactivation in result of point mutations, deletions are the most frequent mechanisms by which CDKN2A gene is inactivated. Regarding urinary bladder carcinoma, homozygotic deletions at 9p21 locus (CDKN2A) are found in approximately 20-30% of cases, while the loss of heterozygosity may be observed even in 60% of cases [3, 8]. The aim of our study was to characterize A148T polymorphism of CDKN2A gene in bladder cancer patients.

MATERIAL AND METHODS

DNA from 84 subjects was analyzed, all of them patients of the Department of Urology, The J.P. II Regional Hospital in Bełchatów, and from 72 patients of the “Urologists M. Rozniecki and Partners” Department of Urology in Łask with diagnosed tumor of the urinary bladder (130 men and 26 women, 32-86 year old, the mean age: 62.3 years). The patients were informed about the study goal and provided written consents to participate. A detailed medical history was obtained from all the enrolled participants, taking into account the effect of risk factors on neoplastic disease progression. All the identified neoplasms were assessed by two histopathologists for staging and grading according to WHO Histopathological Classification [10]. The mean observation period per individual patient was 32 months (16-59). The number of recurrence cases amounted to 59/156 (38%). See Tables 1 and 2 for data of the analyzed material.
Table 1

Clinical data of the bladder cancer group (the dark blue color designates the cases in which A148T polymorphism of CDKN2A gene was found)

No.DNAGender/AgeStage/GradeRecurrence (time after diagnosis in months)No.DNAGender/ AgeStage/ GradeRecurrence
1151M/44Ta/G1Yes/1881141M/56T1/G2No
2166M/66Ta/G1Yes/5,1282153M/43/T1G2No
3168M/51Ta/G1No83154M/81T1/G2Yes
4169M/47Ta/G1Yes/8,1884162M/73T1/G2Yes
5171M/65Ta/G1No85L1M/62T1/G3No
6175M/32Ta/G1No86L2M/82Ta/G2No
7178M/66Ta/G1No87L3M/57T1/G2Yes/1
8182M/84Ta/G1No88L4M/53Ta/G1Yes/1
9187M/82Ta/G1No89L5M/77T1/G2Yes/3
10188M/54Ta/G1Yes/1690L6M/62Ta/G2Yes/6
11189M/63Ta/G1Yes/17,1991L7F/59Ta/G1No
12190M/70Ta/G1Yes/1192L8M/73T3/G2No
13192M/67Ta/G1No93L9M/78Ta/G1No
14193M/83Ta/G1No/D94L10F/68T1/G2Yes/1
15195M/60Ta/G1Yes/9,1795L11M/61T1/G2No
16196M/77Ta/G1No96L12M/60Ta/G1No
17197M/76Ta/G1No97L13M/41Ta/G1Yes/4
18198M/53Ta/G1Yes/398L14M/59Ta/G1No
19203M/61Ta/G1No99L15M/77Ta/G2No
20204M/75Ta/G1Yes/15100L16F/82Ta/G1No
21206M/71Ta/G1No101L17M/85Ta/G3No
22209M/58Ta/G1No102L18M/68T1/G3Yes/3
23210M/58Ta/G1Yes/4103L19M/57Ta/G1Yes/7
24211M/54Ta/G1No104L20F/61T1/G1No
25219M/55Ta/G1No105L21F/83Ta/G1No
26220M/67Ta/G1No106L22M/62T2/G2Yes/3
27221F/53Ta/G1No107L23M/41Ta/G1Yes
28226M/52Ta/G1No108L24M/63Ta/G2Yes/3
29228M/67Ta/G1No109L25M/67Ta/G3Yes
30234M/67Ta/G1No110L26F/57Ta/G1No
31238M/73Ta/G1No111L27M/53T1/G2No
32235M/52Ta/G1No112L28M/73T1/G3Yes
33240M/83Ta/G1No113L29F/54T1/G2No
34241M/78Ta/G1Yes/12114L30F/50Ta/G1No
35242M/61Ta/G1No115L31M/61Ta/G1Yes/2
36247M/59Ta/G1Yes/6116L32F/44Ta/G1No
37249M/61Ta/G1No117L33M/81Ta/G1No
38251F/73Ta/G1Yes/3,9118L34M/66Ta/G2Yes/6
39255M/56Ta/G1No119L35M/67Ta/G1Yes/24
40165M/55Ta/G2Yes/5,9,14/D120L36M/52T1/G2Yes/9
41170M/74Ta/G2No121L37M/79Ta/G1No
42184M/60Ta/G2Yes/1122L38M/62Ta/G1Yes/3
43232M/73Ta/G2No123L39M/67T1/G3Yes/12
44245M/73Ta/G2Yes/5124L40M/70Ta/G1Yes/3
45212M/80T1/G1No125L41M/74Ta/G1Yes/1
46214F/45T1/G1No126L42M/58Ta/G1Yes/3
47222M/71T1/G1No/Dacc127L43F/69Ta/G1Yes/2
48223M/70T1/G1No/Dint128L44M/68Ta/G1Yes/2
49244M/77T1/G1No129L45M/62Ta/G1Yes/3
50248M/62T1/G1No/Dint130L46M/72Ta/G1Yes/3
51173M/86T1/G2No131L47M/54Ta/G2Yes/3
52179M/84T1/G2Yes/20132L48F/62T1/G1No
53202M/71T1/G2Yes133L49F/60Ta/G1Yes/3
54218M/72T1/G2Yes/4/D134L51F/58Ta/G1No
55227M/80T1/G2No/D135L52F/78Ta/G1Yes/1
56231M/57T1/G2No136L53F/77T1/G3No
62237M/60T1/G2Yes/3/D137L54M/67T1/G3Yes/3
57252M/83T1/G2No138L56F/75T1/G1No
58205M/53T1/G3No139L57M/58T1/G1No
59215M/84T1/G3Yes/6/D140L58M/64T1/G1No
60243M/72T1/G3No/D141P2M/66Ta/G2No
61256M/68T1/G3No142P3F/76Tis/G3No
62217M/83T2/G1Yes/1/D143P4M/75T1/G1Yes
63185K/76T2/G2No/D144P5F/57T1/G2Yes
64191M/82T2/G2No/D145P6M/72T2/G2No
65199M/82T2/G2No/D146P7M/64T2/G3No
66200M/55T2/G2No/D147P8M/72T2/G3No
67208aF/78T2/G2No/D148P9M/76T1/G1No
68177M/65T2/G3No/D149P11M/49T2/G3No
69180M/76T2/G3No/D150P13F/45T1/G1No
70183F/61T2/G3Yes/12151P20M/54T1/G1Yes
71201M/74T2/G3No/D152P23M/66T2/G3Yes
72186M/67T2/G3No153P24M/76T1/G1Yes
73213M/77T2/G3No154P25M/72T2/G2Yes
74230F/88T2/G3No/D155P26M/65T2/G3Yes
75239F/62T2/G3No156P28F/61T2/G2Yes
76253M/73T2/G3No
77254M/72T2/G3No
78208F/75T3/G3No/D
80207M/81T4/G3No

D - death, Dacc - death in accident, Dint - death of intrinsic cause

Table 2

Division of studied material with regards to tumor staging and grading

Tumor stageTumor grade
Primary tumorsRecurrent tumorsPrimary tumorsRecurrent tumors
Tis 1
Ta 5328 G1 6123
T1 339 G2 2814
T2 187 G3 237
T3-T4 7
Total 112 44 112 44
Clinical data of the bladder cancer group (the dark blue color designates the cases in which A148T polymorphism of CDKN2A gene was found) D - death, Dacc - death in accident, Dint - death of intrinsic cause Division of studied material with regards to tumor staging and grading

DNA isolation

Blood samples (5 ml), collected onto EDTA3K (potassium versenate), were used as study material. A Roche MagNA Pure Compact automatic workstation was used to isolate DNA from 1 ml of anticoagulated blood (out of all samples) by means of a Nucleic Acid Isolation Kit I-Large Volume (cat. No. 03 730 972 001, Roche Diagnostic GmbH). The volume and purity of obtained DNA were determined by absorbance (A) measurements directly in aqueous solutions. The measurements were performed by an ND-1000 spectrophotometer in UV light (measurement of UV adsorbed by DNA bases). Nucleic acid concentration was determined by comparing measurement results for blind trial (distilled water) and absorbance levels of studied sample at wavelength of 260 nm (this wave length corresponds to the maximal absorption for nucleic acids). Purity was determined by calculation of A280/A260 coefficient. Absorbance at λ = 280 nm is characteristic for proteins and reflects protein- derived contaminations. The coefficient values above 1.7 were regarded satisfactory.

PCR conditions

PCR amplifications were performed as follows: 1 μl of template DNA (approx. 100 ng), 2.5 μl of 10 × reaction buffer (700 mM Tris-HCl, pH 8.3, 166 mM (NH4)2SO4, 25 mM MgCl2), 0.5 μl of 2,5 mM dNTPs (TaKaRa), 1 μl of each primer pair (5 pmol/ μl), 1.25 U of Taq DNA polymerase (Novazym), and 18.75 μl of distilled water in a total volume of 25 μl were used. The used primers included: 5′CCCAAGCTTGCATGGAGCCGGCGGCG3′ and 5′CGGGATCCCTTTCAATCGGGGATGT3′. The applied PCR procedure: preliminary denaturation for 10 minutes at 95°C, followed by 40 cycles of 30-second denaturation in 95°C, 30-second annealing in 58°C, and 30-second elongation in 72°C. The final elongation lasted 5 minutes at 72°C. All the reactions were referred to non-template controls. PCR reactions were carried out on BioRad iQ5 and LabCycler SensoQuest thermocyclers. PCR products of leukocytes (10 μl) were electrophoresed on 2.0% agarose gel and stained with ethidium bromide. The gels were evaluated by visual inspection in UV light.

MSSCP (Multitemperature Single Strand Conformation Polymorphism) conditions

The search for A148T polymorphism in exon 2 of CDKN2A gene was carried out by the MSSCP technique in two different temperature profiles (the first one at 23°C, for 120 minutes and the second one at 37°C for 40 minutes, 23°C for 25 minutes, and at 15°C for 25 minutes) and by the sequencing technique. Details of the MSSCP method were described in earlier reports [11]. PCR products were sequenced to rule out / confirm mutation or polymorphism, identified during electrophoresis (Genomed sp. z o.o.).

Statistics

The G test, based on the likelihood ratio, was applied. Like the chi-square (χ2) test, G test is used to assess the significance of differences in contingency tables. Both tests lead to the same conclusions when each cell of the contingency table has a sufficiently high number (O >10) of observations. However, while the chi-square test cannot be used for lower numbers in any cell, no such restrictions occur for G test. A null hypothesis of no effect cannot be rejected when G statistics is higher than the critical value G0,05 = 3.841 for 1 degree of freedom (table 2×2) [12].

RESULTS

Common polymorphic variants of CDKN2A gene were found in our study at codon 148 in exon 2 (Ala148Thr) in 9 cases (Tab. 3, Fig. 1). All the confirmed cases were first identified by the MSSCP technique and then verified by sequencing. A full conformability of results was attained in both techniques. The obtained frequencies were compared with the control group from the Polish population, examined by Debniak and colleagues, and a significant difference was found in the prevalence of A148T polymorphism in the bladder cancer group (G test, Table 2 ×2: NBLADDER CANCER = 156, NCONTROL = 1210, G = 4.298, p <0.05) [13]. No differences were observed in the frequencies of Nt500c >g alleles or in the frequencies of Nt540c >t alleles, either in the bladder cancer group or in the reference control group. We used the data for the control group, published by other authors, because they were obtained in studies on a large number of subjects (i.e., 1210) for the Polish population, and by researchers, who are unquestionable authorities in the studies on hereditary predispositions to neoplasm development, including the A148T variant of CDKN2A gene.
Table 3

Frequencies of CDKN2A variants in controls and in the bladder cancer group

CDKN2ADebniak et.al (n=1210) controlsThis study (n=156)G test (table 2×2)
A148TA/A 0 (0%) A/G 35 (2.89%) G/G 1175 (97.1%) Allele A frequency 1.5%A/A 1 (0.64%) A/G 8 (5.13%) G/G 147 (94.23%) Allele A frequency 3.2%G= 4.298p<0.05
Fig. 1

Results of electrophoresis (MSSCP) of CDKN2A gene exon 2 and of sequentioning of particular codon 148 variants. The black arrow designates the G/G (Ala/Ala) homozygotic system, the blue arrow – the heterozygotic A/G (Thr/Ala) system and the red arrow – the homozygotic A/A (Thr/Thr) system.

Frequencies of CDKN2A variants in controls and in the bladder cancer group Results of electrophoresis (MSSCP) of CDKN2A gene exon 2 and of sequentioning of particular codon 148 variants. The black arrow designates the G/G (Ala/Ala) homozygotic system, the blue arrow – the heterozygotic A/G (Thr/Ala) system and the red arrow – the homozygotic A/A (Thr/Thr) system. The incidence rates of particular variants in codon 148 of CDKN2A gene in various neoplasms, found in the Polish population. The occurrence of adenine instead of guanine in codon 148 is associated with the change of the coded amino acid - alanine (CGG) - to threonine (CGA). n- the number of studied subjects controls - a control group for the Polish population, consisting of 500 newborns and 710 adult; „significant” - designates a group of neoplasms, in which the percent of the threonine-encoding variant was statistically significantly higher than in the control population; „not significant” - designates a group of neoplasms in which the distribution of incidence of the threonine-encoding variant is not different from that in the general population. Based on the study by Dębniak et al. 2006 [31].

DISCUSSION

CDKN2A gene inactivation is one of the genetic events, leading to urinary bladder cancer development [3]. According to published reports, 14-39% of homozygotic deletions are found in urinary bladder cancer, as well as approximately 12% of hemizygotic deletions of the gene and about 3% of mutations [5, 14]. For comparison, in renal cancer homozygotic deletions are observed even in 56%, while hypermethylation in 23% of the diagnosed cases [15]. However, because CDKN2A gene inactivation plays the key role in the molecular mechanism of urinary bladder cancer development, as designed by Goebell et al. in 2010, our interest focused on the constitutional mutations of that gene. The A148T variant is broadly cited as a common polymorphism, following functional studies, which indicate that these amino acid substitutions do not affect the ability of P16 to precipitate with CDK4/ CDK6 proteins [13]. Variable frequencies of CDKN2A germline muta tions and polymorphism have been reported in different collections of melanoma families in Sweden, Poland, Great Britain, and Brazil [16-20]. The incidence rates of these changes are also higher in cases of liver carcinoma, nervous system tumors, and pancreatic or breast cancers. See Table 5 for exemplary data.
Table 5

Genotypes and allele frequencies of the A148T allele in different populations

Geographic originStudy populationGenotypeFrequency of A148T gene CDKN2A polymorphismReference
1.North-Western ItalyMelanoma families n = 145/14 (35.7%)Chiorzo et al. (1999) [22]
2.French and Italian populationItalian melanoma patients n = 119Italian controls n = 121French melanoma patients n = 500French controls n = 143A/AG/AG/GA/AG/AG/GA/AG/AG/GA/AG/AG/G6.72%1 (0.84%)14 (11.76%)104 (87.40%)6.2%1 (0.83%)13(10.74%)107 (88.43%)3.4%1 (0.2%)32 (6.4%)467 (93.4%)4.2%0 (0.0%)12 (8.4%)131 (91.6%)Spica et al. (2006) [24]
3.UKAtypical nevus/Familial melanoma n = 488Population-based sample n = 599A/AG/AG/GA/AG/AG/G0/488 (0.0%)24/488 (4.9%)464/488 (93.0%)0/599 (0.0%)31/599 (5.2%)568/599 (94.8%)Bertram et al. (2002) [23]
4.SwedenHereditary melanoma n = 1089.3% in patients sampleErlandson et al. (2007) [25]
5.SpainPatients with more than one primary cutaneous melanoma n = 104Spanish controls n = 11013.40%5.45%Puig et al. (2005) [26]
6.SpainBreast cancer and cutaneous melanoma n = 312/31 (6.4%)Nagore et al. (2009) [27]
7.PolandLarynx cancer n = 39017/390 (4.4%)Kiwerska et al. (2007) [28]
8.Sweden (Stockholm County)Bladder cancer n = 16710/167 (6%)Sakano et al. (2003) [29]
In Poland, the incidence of CDKN2A variant - an alanine to threonine substitution at codon 148 (A148T) - has been estimated for approximately 3 to 3.5% of the population [13, 21]. Recent studies have shown that A148T polymorphism is in linkage disequilibrium with a second alteration in the CDKN2A promoter (P-493 variant), which appears to affect gene expression [13]. In the Polish control population, the frequency of A148T changes in 1,210 control samples (500 newborns and 710 adults) was assessed by Debniak et al. at 2.89%. The same research team studied the incidence of A148T variant of CDKN2A gene (see their report of 2007) in the Polish population of patients with breast cancer (young women), colon, lung, melanoma, prostate, bladder, kidney, stomach, pancreas and thyroid cancers (see Figure 1 for a partial presentation of results) [13, 30, 31]. Significant differences were found for the first four neoplasms in the above list, indicating that the carrier state of the variant may be associated with an increased risk of tumor development. The results, obtained for a group of 223 urinary bladder carcinoma cases (3.1%) did not differ from those for the control group [13]. It should be emphasized that those patients came from the Pomeranian Region while in our study patients from the Lodz Voivodeship (central Poland) prevailed (131/156). The results of our study (5.77%) indicate that, regarding the Polish population (Łódź Macroregion), A148T variant seems to be associated with an increased bladder cancer risk. However, it should eventually be justified to refer to the comparison of results in the study group with those in the control group, representative for the studied region. The frequency of variant A148T found by us in patients with bladder cancer is similar to the results published in the work of Sakano et al. (6%) for patients with bladder cancer in the population of Stockholm county in Sweden [29]. However, the result cannot be compared with a general population as the authors do not specify what is the frequency of this variant in the population of Swedes. The obtained results should by all means be confirmed in a study on a larger population, representing the Łódź Macroregion, especially that the results of studies on other neoplasms differ among populations or even within the same population, when differentiated for example by age (the groups of patients below and above the age of 50 years). Breast cancer can be an example, the results for which were different from those in the control group in the group of women below 50, while no differences in the incidence rates were observed between the control group and the group of women above 50 [31]. In case of the studied group, 8 out of 9 A148T polymorphism cases of CDKN2A gene were identified in men at the age above 60 years at diagnosis (data specified in Table 4). No recurrence was observed in 7 out of 9 diagnosed cases. In 6/9 cases, there were neoplasms in high clinical stage; while in 5/9 cases there were tumors with high malignancy grade (G2-G3). Summing up and taking into account the analysis of clinical parameters and the age of disease occurrence, A148T polymorphism of CDKN2A gene was found in the studied group only in men, in whom the disease was diagnosed at the age above 60 years, while the diagnosed neoplasms were in the majority of cases characterized by higher clinical stage and higher grade of malignancy, as well as by a low percentage of recurrence. Nevertheless, this has been the first study that attempted to show a potential association between A148T alterations and an increased risk for bladder cancer development.
Table 4

Prevalence of A148T variant of CDKN2a gene vs. clinical data

N (%)A148T (+) N (%)
Sex:
Male130 (83.3)9 (6.9)
Female26 (16.7)0 (0.0)
Age:
≤6045 (28.8)1 (2.2)
≥61111 (71.2)8 (8.1)
Grade:
I84 (53.8)4 (4.8)
≥II72 (46.2)5 (6.9)
Stage:
Ta81 (51.9)3 (3.7)
≤T175 (48.1)6 (8.0)
Local recurrence:
Positive59 (37.8)2 (3.3)
Negative97 (62.2)7 (7.2)
Prevalence of A148T variant of CDKN2a gene vs. clinical data Genotypes and allele frequencies of the A148T allele in different populations

CONCLUSION

Studies on genetic predispositions to neoplasm development allow to distinguish the group of subjects with an increased risk for neoplastic changes vs. the general population. The more we learn about human genetics and human variations, the more apparent it becomes that our individual make-up has a noticeable impact on the risk of cancer development and finally on the effectiveness of therapeutic medications. A148T variant of CDKN2A gene seems to be associated with an increased risk for developing bladder cancer. Nevertheless, according to Debniak et al. (2005), it does not imply that A148T polymorphism is associated with an increased risk of the diseases alone but it rather suggests the existence of some interactive modifiers that, when grouped together, may trigger the malignancy process. The study was approved by the Ethics Committee of the Medical University of Łódź (Permission no RNN/66/02/KE). This work was supported by the State Committee for Scientific Research, Poland (KBN grant No 2P05C 076 30).
  26 in total

1.  CDKN2A common variant and multi-organ cancer risk--a population-based study.

Authors:  Tadeusz Debniak; Rodney J Scott; Tomasz Huzarski; Tomasz Byrski; Andrzej Rozmiarek; Boguslaw Debniak; Bohdan Górski; Cezary Cybulski; Krzysztof Medrek; Marek Mierzejewski; Bartłomiej Masojc; Joanna Matyjasik; Elzbieta Złowocka; Urszula Teodorczyk; Marcin Lener; Ewa Klujszo-Grabowska; Katarzyna Nej-Wołosiak; Ewa Jaworowska; Dorota Oszutowska; Anna Szymańska; Jolanta Szymańska; Jennifer Castaneda; Thierry van de Wetering; Janina Suchy; Grzegorz Kurzawski; Oleg Oszurek; Steven Narod; Jan Lubinski
Journal:  Int J Cancer       Date:  2006-06-15       Impact factor: 7.396

2.  CDKNA2A mutation analysis, protein expression, and deletion mapping of chromosome 9p in conventional clear-cell renal carcinomas: evidence for a second tumor suppressor gene proximal to CDKN2A.

Authors:  P Schraml; K Struckmann; R Bednar; W Fu; T Gasser; K Wilber; J Kononen; G Sauter; M J Mihatsch; H Moch
Journal:  Am J Pathol       Date:  2001-02       Impact factor: 4.307

3.  An assessment of the CDKN2A variant Ala148Thr as a nevus/melanoma susceptibility allele.

Authors:  Chandra G Bertram; Rupert M Gaut; Jennifer H Barrett; Elizabeth Pinney; Linda Whitaker; Faye Turner; Veronique Bataille; Isabel Dos Santos Silva; Anthony J Swerdlow; D Timothy Bishop; Julia A Newton Bishop
Journal:  J Invest Dermatol       Date:  2002-10       Impact factor: 8.551

4.  The prevalence of CDKN2A germ-line mutations and relative risk for cutaneous malignant melanoma: an international population-based study.

Authors:  Marianne Berwick; Irene Orlow; Amanda J Hummer; Bruce K Armstrong; Anne Kricker; Loraine D Marrett; Robert C Millikan; Stephen B Gruber; Hoda Anton-Culver; Roberto Zanetti; Richard P Gallagher; Terence Dwyer; Timothy R Rebbeck; Peter A Kanetsky; Klaus Busam; Lynn From; Urvi Mujumdar; Homer Wilcox; Colin B Begg
Journal:  Cancer Epidemiol Biomarkers Prev       Date:  2006-08       Impact factor: 4.254

5.  A search for CDKN2A/p16INK4a mutations in melanocytic nevi from patients with melanoma and spouse controls by use of laser-captured microdissection.

Authors:  Hao Wang; Richard B Presland; Michael Piepkorn
Journal:  Arch Dermatol       Date:  2005-02

6.  Role of the CDKN2A locus in patients with multiple primary melanomas.

Authors:  Susana Puig; Josep Malvehy; Cèlia Badenas; Anna Ruiz; Dolores Jimenez; Francisco Cuellar; Antoni Azon; Urbá Gonzàlez; Teresa Castel; Antoni Campoy; Josep Herrero; Rosa Martí; Joan Brunet-Vidal; Montserrat Milà
Journal:  J Clin Oncol       Date:  2005-05-01       Impact factor: 44.544

7.  Measurement of relative copy number of CDKN2A/ARF and CDKN2B in bladder cancer by real-time quantitative PCR and multiplex ligation-dependent probe amplification.

Authors:  Joanne S Aveyard; Margaret A Knowles
Journal:  J Mol Diagn       Date:  2004-11       Impact factor: 5.568

8.  CDKN2A common variants and their association with melanoma risk: a population-based study.

Authors:  Tadeusz Debniak; Rodney J Scott; Tomasz Huzarski; Tomasz Byrski; Andrzej Rozmiarek; Bogusław Debniak; Elzbieta Załuga; Romuald Maleszka; Józef Kładny; Bohdan Górski; Cezary Cybulski; Jacek Gronwald; Grzegorz Kurzawski; Jan Lubinski
Journal:  Cancer Res       Date:  2005-02-01       Impact factor: 12.701

9.  CDKN2A germline mutations in U.K. patients with familial melanoma and multiple primary melanomas.

Authors:  R M MacKie; N Andrew; W G Lanyon; J M Connor
Journal:  J Invest Dermatol       Date:  1998-08       Impact factor: 8.551

10.  Some molecular and clinical aspects of genetic predisposition to malignant melanoma and tumours of various site of origin.

Authors:  Tadeusz Debniak
Journal:  Hered Cancer Clin Pract       Date:  2007-06-15       Impact factor: 2.857

View more
  5 in total

1.  Molecular subtyping of bladder cancer using Kohonen self-organizing maps.

Authors:  Edyta M Borkowska; Andrzej Kruk; Adam Jedrzejczyk; Marek Rozniecki; Zbigniew Jablonowski; Magdalena Traczyk; Maria Constantinou; Monika Banaszkiewicz; Michal Pietrusinski; Marek Sosnowski; Freddie C Hamdy; Stefan Peter; James W F Catto; Bogdan Kaluzewski
Journal:  Cancer Med       Date:  2014-08-20       Impact factor: 4.452

2.  AUTHOR'S REPLY.

Authors:  Paweł Grzegółkowski; Krystian Kaczmarek; Artur Lemiński; Marcin Słojewski
Journal:  Cent European J Urol       Date:  2017-03-14

3.  Who needs numbers more: patients or doctors?

Authors:  Marcin Słojewski
Journal:  Cent European J Urol       Date:  2013

4.  CDKN2A Polymorphism in Melanoma Patients in Colombian Population: A Case-Control Study.

Authors:  Jose D Tovar-Parra; Luz D Gutiérrez-Castañeda; Sebastián R Gil-Quiñones; Jhon A Nova; Leonardo Pulido
Journal:  Biomed Res Int       Date:  2020-10-10       Impact factor: 3.411

5.  Integrative genomic analysis focused on cell cycle genes for MYC-driven aggressive mature B-cell lymphoma.

Authors:  Takahisa Yamashita; Claudia Vollbrecht; Burkhard Hirsch; Karsten Kleo; Ioannis Anagnostopoulos; Michael Hummel
Journal:  J Clin Exp Hematop       Date:  2020
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.