Literature DB >> 24553608

Molecular typing of Giardia duodenalis isolates from nonhuman primates housed IN a Brazilian zoo.

Érica Boarato David1, Mariella Patti2, Silvana Torossian Coradi2, Teresa Cristina Goulart Oliveira-Sequeira1, Paulo Eduardo Martins Ribolla1, Semíramis Guimarães1.   

Abstract

Giardia infections in captive nonhuman primates (NHP) housed at a Brazilian zoo were investigated in order to address their zoonotic potential. Fresh fecal samples were collected from the floors of 22 enclosures where 47 primates of 18 different species were housed. The diagnosis of intestinal parasites after concentration by sedimentation and flotation methods revealed the following parasites and their frequencies: Giardia (18%); Entamoeba spp. (18%); Endolimax nana (4.5%); Iodamoeba spp. (4.5%); Oxyurid (4.5%) and Strongylid (4.5%). Genomic DNA extracted from all samples was processed by PCR methods in order to amplify fragments of gdh and tpi genes of Giardia. Amplicons were obtained from samples of Ateles belzebuth, Alouatta caraya, Alouatta fusca and Alouatta seniculus. Clear sequences were only obtained for the isolates from Ateles belzebuth (BA1), Alouatta fusca (BA2) and Alouatta caraya (BA3). According to the phenetic analyses of these sequences, all were classified as assemblage A. For the tpi gene, all three isolates were grouped into sub-assemblage AII (BA1, BA2 and BA3) whereas for the gdh gene, only BA3 was sub-assemblage AII, and the BA1 and BA2 were sub-assemblage AI. Considering the zoonotic potential of the assemblage A, and that the animals of the present study show no clinical signs of infection, the data obtained here stresses that regular coproparasitological surveys are necessary to implement preventive measures and safeguard the health of the captive animals, of their caretakers and of people visiting the zoological gardens.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24553608      PMCID: PMC4085826          DOI: 10.1590/S0036-46652014000100007

Source DB:  PubMed          Journal:  Rev Inst Med Trop Sao Paulo        ISSN: 0036-4665            Impact factor:   1.846


INTRODUCTION

Today, in view of the increasing interest for biodiversity conservation, wildlife species have been subject to many investigations; however the search for knowledge goes beyond the behavioral and ecological aspects of these animals and includes research on their infectious diseases and their role in public health. For this purpose, studies have been carried out on the occurrence of enteric parasites in a range of wild mammals' species, many of them kept in zoological gardens, conservation parks or sanctuaries, where captivity may raise their exposure to conditions that facilitate the spread of these pathogens[4,5,7,9,19,21]. In this context, it is important to stress that a wide range of captive species may be important reservoirs for zoonotic parasites acting as potential sources of human and animal infections and environmental contamination. The enteric protozoan Giardia duodenalis (syn. G. intestinalis, G. lamblia) is one of the most common pathogens of zoonotic importance that infect humans and domesticated animals, in addition to many other mammalian wildlife species, including free-living and captive animals[1]. Currently, genetic analyses have shown that human and animal isolates can be clustered into at least eight groups, referred to as genotypes A to H[17,23], but only assemblages A and B are known to infect humans, as well as a variety of other mammals. Based on the data on the prevalence of giardiasis in different hosts and on existing knowledge of the genotypes of G. duodenalis, THOMPSON proposed the existence of transmission cycles that keep the infection among the mammals[31]. Even so, it has not been fully elucidated how these cycles interact and how often the transmission of zoonotic assemblages occurs. Despite the interest of researchers, as yet, genotyping data from wildlife mammals' species are scarce. Lately, APPELBEE et al. highlighted that the infection of free-living and captive wildlife mammals by both host-adapted and zoonotic isolates of Giardia can provide insights into the host range and zoonotic potential of this parasite[1]. An overview of recent studies enables us to ascertain that almost all mammalian orders include free-living and captive species that can harbor Giardia isolates[2,18,26]. Among these groups, Giardia isolates have been obtained from nonhuman primates' species, however, until now, few studies have addressed the molecular characterization of these isolates and discussed their role in public health[3,5,15,20,22,32]. Thus, we focused our attention here to verify the occurrence of the Giardia infection in nonhuman primates' fauna of the Bauru Municipal Zoological Garden (São Paulo State, Brazil).

MATERIALS AND METHODS

Study site and sampling

The Bauru Municipal Zoological Garden, located in the city of Bauru in São Paulo State, covers an area of 43.5ha and houses 880 animals of 210 species, comprising mammals, birds and reptiles. Before the start of the study, approval was obtained from the Research Ethics Committee at Sacred Heart University (105/10 CEP-USC) as well as by the zoo's administration. From September to November 2009, fecal samples from forty-seven primates of 18 species, belonging to three families of New World monkeys (Atelidae, Callitrichidae and Pitheciidae) and one of Old World (Cercopithecidae) were analyzed. The animals were either kept individually (five animals) or in monospecific groups of 2-7 individuals (42 animals) sharing the same enclosures (Table 1).
Table 1

Intestinal parasites identified in nonhuman primates at Bauru zoo and G. duodenalis PCR analysis

Primate specieCommon nameNo. of animals (no. enclosures)Coprological analysis Giardia PCR
Alouatta caraya Black howler monkey4 (1) Giardia, Entamoeba spp+
Alouatta fusca Brown howler monkey3 (1) Giardia +
Alouatta seniculus Red howler monkey4 (2) Giardia, Entamoeba spp, Endolimax nana +
Ateles belzebuth White-fronted spider monkey2 (1) Giardia, Iodamoeba bütschilii +
Ateles fusciceps Brown-headed spider monkey2 (1)--
Ateles paniscus Red-faced spider monkey5 (1)Oxyurid eggs-
Callicebus nigrifrons Black-fronted titi monkey2 (1)--
Callithrix argentata Silvery marmoset2 (1)--
Callithrix geoffroyi Geoffroy's tufted-ear marmoset1--
Lagothrix lagotricha Woolly monkey5 (3)--
Leontopithecus chrysomelas Golden-headed lion tamarin7 (2)--
Leontopithecus rosalia Golden lion tamarin2 (1)Strongyle-type eggs-
Mandrillus sphinx Mandrill2 (1) Entamoeba spp-
Papio hamadryas Hamadryas baboon1--
Papio papio Guinea baboon2 (1)--
Saguinus bicolor Brazilian bare-faced tamarim1--
Saguinus fuscicollis Brown-headed tamarin1--
Saguinus melanoleucus White saddleback tamarin1 Entamoeba spp-

- negative samples

- negative samples Due to the group housing, all the feces discharged by the animals in each pen were recovered from the floor and pooled in labeled plastic vials containing 2.5% potassium dichromate. For those animals kept alone in the enclosure, individual sampling was possible. Collection of stool was carried out in the morning, after the feeding of animals, on three alternate days. The samples were assessed for helminthes and protozoans by conventional coprological techniques of spontaneous sedimentation and centrifuge-flotation with zinc sulfate, according to SLOSS et al. [27]. For Cryptosporidium diagnosis, a part of each stool sample was previously concentrated by centrifugation (500 xg, 10 min) and the sediment obtained was used to prepare smears stained by a modified Ziehl-Neelsen technique[13]. An aliquot of this sediment was also stored at -20 °C for subsequent DNA extraction.

DNA extraction

The genomic DNA was extracted using the QIAamp® Stool Mini Kit (Qiagen, Germany) following the manufacturer's instructions. Prior to extraction, the samples were subjected to three freeze/thaw cycles as follows: two cycles in liquid nitrogen for five min and at 70 °C for five min and concluding in liquid nitrogen for five min and thawed at 95 °C for five min. For molecular characterization of Giardia, DNA was extracted from all the samples regardless the coprological diagnosis.

PCR assays and sequencing

Molecular analysis was carried out by amplifying gdh and tpi fragment genes. A nested PCR procedure was used to amplify a 530 bp region of the tpi fragment using the primers AL3543 and AL3546 for the first step, and AL3544 and AL3545 for the second one[29]. For gdh, a semi-nested PCR was used to amplify a 432 bp fragment with the primers GDHeF and GDHiR in the primary reaction and GDHiF and GDHiR in the secondary[25] one. In all PCR reactions, positive (DNA from axenic Giardia culture) and negative controls were included. The amplified products were submitted to 1.5% agarose gel electrophoresis, stained with ethidium bromide. Bands of the predicted sizes were excised from agarose gel, then, DNA was purified using the Ultrafree® DA kit (Millipore Corp., USA) and sequenced in both directions in Macrogen Inc. (Seoul, Korea). The nucleotide sequences obtained were manually corrected and multiple alignments for each locus were performed using CLUSTAL X version 1.8[30] and queried against known sequences of GenBank database using BLAST. The phenetic analyses were performed with the MEGA software (http://www.mega-software.net) and the sequences obtained in the present study were deposited in the GenBank data base under accession numbers JN172997-JN172999 for gdh sequences, and JN410841-JN410843 for tpi sequences. The DNA sequences were translated into amino acids using the online software Emboss gui - European Molecular Biology Open Software Suite (http://bips.u-strasbg.fr/EMBOSS/).

RESULTS AND DISCUSSION

The microscopic examination of stool samples revealed that enteric parasites pathogenic and/or non pathogenic were detected in samples from 36% (8/22) of the enclosures. Among the 18 species of primates, intestinal parasites were found in feces from animals belonging to the genera Ateles, Alouatta, Leontopithecus, Mandrillus and Saguinus (Table 1). Giardia cysts were found in the feces collected in four enclosures (18%) where animals of the following species were kept: Ateles belzebuth, Alouatta seniculus, Alouatta caraya and Alouatta fusca (Table 1). Other intestinal protozoa were identified and their frequencies were as following: Entamoeba spp (18%), Iodamoeba butschlii (4.5%) and Endolimax nana (4.5%). No Cryptosporidium oocysts were found on fecal smears of all assessed samples. Parasitism by helminthes was detected in animals from two enclosures, whose fecal samples were positive for strongylid and oxyurid nematodes eggs (Table 1). The occurrence of both protozoa and helminthes have been reported in captive nonhuman primates of different regions[5,7,9,16,19,24], with the predominance of the former[7,19,20]. According to some authors, the most frequent occurrence of protozoa infections can be explained by factors such as the short prepatent period, being immediately infective when excreted and the low infective dose required[19] for infection. Besides, the restricted and collective environments conditions where the animals are kept facilitate protozoan transmission, because these organisms can be acquired through direct contact, which may be favored by primates' highly social nature. In the present study, besides the occurrence of the protozoa Giardia and species of amoebae, the detection of oxyurid eggs reinforces these aspects, since unlike most other nematodes, this helminth is already able to infect the host when passed in feces. Likewise as previously reported in the literature[5,19], herein, Giardia and Entamoeba spp. were the most frequent parasites diagnosed in NHP. Nevertheless, the clinical relevance of these infections is difficult to ascertain, especially regarding to Entamoeba, because several species are considered non-pathogenic[5]. So, the known species considered pathogenic for NHP include E. histolytica and its virulent variant E. nuttalli [5]. However, through direct microscopic identification of the parasite, it is impossible to distinguish between E. histolytica and the non-pathogenic species E. dispar and E. moshkovskii, once these amoebae are morphologically indistinguishable. It is important to emphasize that, although Giardia and Entamoeba spp. are commonly found in stools of wild and captive NHP and can be a significant cause of diarrhea, in the present survey, all fecal samples had a normal consistency and animals showed no symptoms of infection, even when both protozoan were detected in animals kept in the same pen (Table 1). Given that Cryptosporidium is an important pathogenic protozoa that has been detected in a range of captive mammals' species [7,11,15,19,21,24], it was expected that this parasite could be detected in the animals of the present study. It is noteworthy that the occurrence of Cryptosporidium infection is still underestimated, since its diagnosis depends on the identification of oocysts in fecal smears stained, being a more laborious method that is generally not included in many surveys. This was not the point in our study since smears were prepared and examined, but a likely reason for negative results of Cryptosporidium could be the analysis of pooled stool samples, despite efforts to concentrate the material. Although the increasing interest to gain insight into the role of nonhuman primates as hosts of Giardia, molecular characterization of isolates from New World species is still limited, especially in Brazil, which is the world's richest country in primate species diversity. Herein, the four Giardia-positive samples produced PCR products of the expected size in the gdh and tpi genes, but no amplicon was obtained from the eighteen Giardia cyst-negative samples assessed. Clear sequences of amplicons were only obtained for the isolates from Ateles belzebuth (BA1), Alouatta fusca (BA2) and Alouatta caraya (BA3) (Tables 1 and 2). A comparison of these sequences with the homologous gdh and tpi deposited in GenBank showed that all three isolates were assigned to assemblage A (Table 2; Fig. 1). Taking as reference the comparative evaluation of G. duodenalis sequence data carried out by WIELINGA & THOMPSON, the alignment between these three sequences and other ones from humans and nonhuman primates revealed that in tpi locus, the isolates BA1 (JN410841), BA2 (JN410842), and BA3 (JN410843) were subtype AII, whereas in the gdh locus, only the isolate BA3 (JN172999) was classified as AII and the isolates BA1 (JN172997) and BA2 (JN172998) corresponded to sub-assemblage AI (Fig. 1; Table 2).
Table 2

Giardia duodenalis assemblage A: isolates, positions and breakdowns of intra-sub-assemblage substitutions in the gdh and tpi genes*

AssemblageIsolateGenBank™Host/CountryNucleotide position
gdh 237 246 249 258 270 309 372 390 396 510 522 525 531 534 570 603 621 633 636 666 672 < b>687 693 699 720 723 753 756 771 786 807 831 861 867 870 894 902 1080 1266
AIPortl 1M84604Human/Australia C CTCTCCTACGCCAC T CCTCCTCTTCCCCCCCTTTCCTG
SQ678,681FJ890951B.-c.squirrel monkey/The Netherlands---------T.................T.........--
NLH45AY826195Human/The NetherlandsT.............. C -----------------------
AIIBA1JN172997monkey/Brazil---------...... T ... T -------------------
BA2JN172998monkey/Brazil---------...... T ... C -------------------
BA3JN172999monkey/Brazil---------...... C T .. T -------------------
AIIINLR118Roe deer/The Netherlands.. C G C T A C G . C T T G T C . T C . T C T C C T .. A T ... C C ----

The isolates of the present study are highlighted in bold as well as the substitution patterns proposed by WIELINGA & THOMPSON (2007). Novel substitution positions are highlighted in bold italics. Nucleotide sequences identical to reference isolates are indicated by (.) And nucleotide sequences not available for comparison are indicated by (-).

Fig. 1

Dendrograms of Giardia duodenalis based on nucleotide sequences of gdh and tpi genes. Trees were constructed using the neighbor-joining method implemented by the computer program Mega 4.1. Bootstrap values were calculated by the analysis of 1000 simulations (only bootstrap values >50% are shown). The reference sequences for both genes are underlined.

The isolates of the present study are highlighted in bold as well as the substitution patterns proposed by WIELINGA & THOMPSON (2007). Novel substitution positions are highlighted in bold italics. Nucleotide sequences identical to reference isolates are indicated by (.) And nucleotide sequences not available for comparison are indicated by (-). Interestingly, in regards to the analysis of polymorphisms in the nucleotide sequences (SNPs) obtained for the gdh gene, the BA2 (JN172998) isolate did show 100% homology with reference strains for sub-assemblage AI while the isolates BA1 (JN172997) and BA2 (JN172998) revealed at least one SNP (Table 2). Thus, the isolate BA1 showed one SNP at position 666, and the BA3 showed the same SNP at position 666 and a novel one at position 621(Table 2). Among the tpi sequences, the isolates BA2 (JN410842) and BA3 (JN410843) did show 100% homology with reference strains for sub-assemblage AII whereas the isolate BA1 (JN410841) reveled a novel SNP at position 107 (Table 2). In all sequences retrieved, nucleotide substitutions were characterized as transitions and the SPNs were synonymous, resulting in no change in the amino acids encoded. So, only in the tpi sequence of isolate BA1 (JN410841), a non-synonymous SNP in position 634 determined a change in the deduced amino acid sequence leading to a replacement of a serine by a phenylalanine. In the present study, the finding of infection within assemblage A, confirms previous reports that have detected the same genotype in either the gdh or the tpi locus[20,22] as well as in β-giardin[20,32] and SSUrRNA[12] genes. Additionally, in these studies, assemblage A subtypes were identified as either AI or AII. Recently, both assemblages A and B were found in New World monkeys[14,20,28,32], including species that live in South American forests[28,32]. In Brazil, the occurrence of genotype A in NHP was first reported by VOLOTÃO and colleagues, who detected only isolates belonging to the AI assemblage in samples from southern brown howler monkeys (Alouatta clamitans)[32]. In contrast, SOARES et al. recently identified assemblage B in all the samples from 20 howler monkeys Alouatta fusca housed in a wild animal center[27]. With respect to the separation of isolates into sub-assemblages, herein, the inconsistency observed among the loci assessed is not an unusual situation. According to authors BONHOMME et al., inconsistent results are sometimes generated when different loci are targeted, especially regarding the subtypes. Thus, in spite of the possibility of assemblage swapping, explaining different assemblages or sub-assemblages in different loci in the same isolate has not been an easy task. Despite the finding of two different sub-assemblages in the same isolate, as we can see, the infection of captive nonhuman primates within assemblage A has an epidemiological relevance, since this genetic group is zoonotic and the most common non-host specific assemblage in animals[10]. Concerning subtypes of this assemblage, AI and AII are the two most frequently involved in the infections, even though they appear to differ in host preference, since there is evidence that humans are more commonly infected with AII whereas animals are more commonly infected with AI[10]. However, both subgroups have been detected in humans and animals. Finally, despite the low number of tested isolates, the results presented herein outline some pertinent aspects about the occurrence of G. duodenalis assemblages in captive nonhuman primates' species and also provide insights for future elucidation of Giardia epidemiology in endemic areas. All things considered, this kind of investigation highlights the importance of coproparasitological surveys as part of practice in zoos in order to implement preventive measures and safeguard the health of captive animals and people near them (animal keepers and visitors). In this context, it is appropriate to take into account that the transmission of pathogens between humans and nonhuman species has to be considered in either direction, so that recognizing the links between human, animal and ecosystem health can provide an effective approach to understanding the transmission of pathogens among these hosts[8].
  32 in total

1.  Comparative evaluation of Giardia duodenalis sequence data.

Authors:  C M Wielinga; R C A Thompson
Journal:  Parasitology       Date:  2007-06-19       Impact factor: 3.234

2.  The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Authors:  J D Thompson; T J Gibson; F Plewniak; F Jeanmougin; D G Higgins
Journal:  Nucleic Acids Res       Date:  1997-12-15       Impact factor: 16.971

3.  Staining of cryptosporidia by a modified Ziehl-Neelsen technique.

Authors:  S A Henriksen; J F Pohlenz
Journal:  Acta Vet Scand       Date:  1981       Impact factor: 1.695

Review 4.  The zoonotic significance and molecular epidemiology of Giardia and giardiasis.

Authors:  R C Andrew Thompson
Journal:  Vet Parasitol       Date:  2004-12-09       Impact factor: 2.738

5.  Genotyping of Giardia intestinalis from domestic and wild animals in Japan using glutamete dehydrogenase gene sequencing.

Authors:  Tadashi Itagaki; Shizuka Kinoshita; Mikiko Aoki; Naoyuki Itoh; Hideharu Saeki; Naoto Sato; Junya Uetsuki; Shinji Izumiyama; Kenji Yagita; Takuro Endo
Journal:  Vet Parasitol       Date:  2005-11-05       Impact factor: 2.738

6.  Gastrointestinal protozoa in non-human primates of four zoological gardens in Belgium.

Authors:  Bruno Levecke; Pierre Dorny; Thomas Geurden; Francis Vercammen; Jozef Vercruysse
Journal:  Vet Parasitol       Date:  2007-07-25       Impact factor: 2.738

7.  Some gastro-intestinal parasites of zoonotic (public health) importance commonly observed in old world non-human primates in Kenya.

Authors:  S M Muriuki; R K Murugu; E Munene; G M Karere; D C Chai
Journal:  Acta Trop       Date:  1998-08-15       Impact factor: 3.112

8.  Giardia duodenalis assemblages and Entamoeba species infecting non-human primates in an Italian zoological garden: zoonotic potential and management traits.

Authors:  Federica Berrilli; Cristina Prisco; Klaus G Friedrich; Pilar Di Cerbo; David Di Cave; Claudio De Liberato
Journal:  Parasit Vectors       Date:  2011-10-12       Impact factor: 3.876

Review 9.  Giardia and Cryptosporidium in mammalian wildlife--current status and future needs.

Authors:  Amber J Appelbee; R C Andrew Thompson; Merle E Olson
Journal:  Trends Parasitol       Date:  2005-08

10.  Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis.

Authors:  Irshad M Sulaiman; Ronald Fayer; Caryn Bern; Robert H Gilman; James M Trout; Peter M Schantz; Pradeep Das; Altaf A Lal; Lihua Xiao
Journal:  Emerg Infect Dis       Date:  2003-11       Impact factor: 6.883

View more
  6 in total

1.  Single and Synergistic Effects of Fenbendazole and Metronidazole Against Subclinical Infection by Giardia duodenalis in Non-Human Primates in a Zoological Garden in Southern Italy.

Authors:  Michele Capasso; Lavinia Ciuca; Isabel Guadano Procesi; Francesco Zinno; Federica Berrilli; Giuseppe Cringoli; Laura Rinaldi
Journal:  Front Vet Sci       Date:  2022-06-16

2.  Prevalence and Molecular Identification of Entamoeba spp. in Non-human Primates in a Zoological Garden in Nanjing, China.

Authors:  Xinchao Liu; Guangbin Bao; Menglong Yue; Yi Fang; Yueyue Gu; Wenchao Li; Youfang Gu; Wangkun Cheng; Mingmin Lu
Journal:  Front Vet Sci       Date:  2022-05-30

Review 3.  Giardiasis as a neglected disease in Brazil: Systematic review of 20 years of publications.

Authors:  Camila Henriques Coelho; Maurício Durigan; Diego Averaldo Guiguet Leal; Adriano de Bernardi Schneider; Regina Maura Bueno Franco; Steven M Singer
Journal:  PLoS Negl Trop Dis       Date:  2017-10-24

4.  Diversity, geographical distribution, and prevalence of Entamoeba spp. in Brazil: a systematic review and meta-analysis.

Authors:  Andernice Dos Santos Zanetti; Antonio Francisco Malheiros; Tatiane Amorim de Matos; Carolina Dos Santos; Paula Franciene Battaglini; Luciana Melhorança Moreira; Larissa Maria Scalon Lemos; Solange Kimie Ikeda Castrillon; Denise da Costa Boamorte Cortela; Eliane Ignotti; Omar Ariel Espinosa
Journal:  Parasite       Date:  2021-03-30       Impact factor: 3.000

5.  Cryptosporidium spp., Giardia intestinalis, and Enterocytozoon bieneusi in Captive Non-Human Primates in Qinling Mountains.

Authors:  Shuai-Zhi Du; Guang-Hui Zhao; Jun-Feng Shao; Yan-Qin Fang; Ge-Ru Tian; Long-Xian Zhang; Rong-Jun Wang; Hai-Yan Wang; Meng Qi; San-Ke Yu
Journal:  Korean J Parasitol       Date:  2015-08-25       Impact factor: 1.341

6.  Intestinal Protists in Captive Non-human Primates and Their Handlers in Six European Zoological Gardens. Molecular Evidence of Zoonotic Transmission.

Authors:  Pamela C Köster; Eva Martínez-Nevado; Andrea González; María T Abelló-Poveda; Hugo Fernández-Bellon; Manuel de la Riva-Fraga; Bertille Marquet; Jean-Pascal Guéry; Tobias Knauf-Witzens; Annika Weigold; Alejandro Dashti; Begoña Bailo; Elena Imaña; Aly S Muadica; David González-Barrio; Francisco Ponce-Gordo; Rafael Calero-Bernal; David Carmena
Journal:  Front Vet Sci       Date:  2022-01-04
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.