Literature DB >> 24552154

Clinical relevance of the cagA, tnpA and tnpB genes in Helicobacter pylori.

Amin Talebi Bezmin Abadi, Ashraf Mohhabati Mobarez, Marc J M Bonten, Jaap A Wagenaar, Johannes G Kusters1.   

Abstract

BACKGROUND: Numerous proteins have been proposed as virulence factors for the gram negative gastric bacterium Helicobacter pylori but only for a few this has unequivocally been demonstrated. The aim of the current study was to evaluate the association of the putative virulence factors tnpA and tnpB (no cagA) with H. pylori associated gastroduodenal diseases.
METHODS: A PCR based assay was used to determine the presence of the tnpA and tnpB genes, as well as of cagA, in 360H. pylori strains isolated from H. pylori infected patients.
RESULTS: Of 360 H. pylori culture positive patients (196 men, 164 women; average age 42.1 years (range 17-73), 95 had gastritis, 92 had gastric ulcers, 108 had duodenal ulcers, and 65 had gastric cancer. Using the gastritis group as a reference a significantly aberrant gene distribution was observed for the tnpA (Relative risk: 1.45; 95% CI 1.04-1.93), the cagA (Relative risk: 1.81; 95% CI 1.44-2.29), but not the tnpB gene in the gastric cancer group.
CONCLUSIONS: The increased incidence of the tnpA gene in gastric cancer patients suggests a role of the tnpA gene in the development of H. pylori induced gastric cancer.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24552154      PMCID: PMC3938475          DOI: 10.1186/1471-230X-14-33

Source DB:  PubMed          Journal:  BMC Gastroenterol        ISSN: 1471-230X            Impact factor:   3.067


Background

Helicobacter pylori is the most prevalent pathogenic microorganism colonizing the gastric mucosa of humans. Infection rates range between 85-95% in developing countries and 30-50% in developed countries [1]. Colonization always results in acute gastritis and chronic gastritis when left untreated [2]. Additional complications such as gastric ulcers (GU), duodenal ulcers (DU), or gastric cancer (GC) may develop in some of these H. pylori infected patients [3]. The outcome of the infection is determined by both the duration of infection and environmental, host, and bacterial factors [4]. H. pylori strains display extensive genetic variability with considerable variation in the presence of virulence factors, which is thought to cause the many different clinical presentations of H. pylori infections [5-7]. The CagA protein is a commonly accepted virulence factor and the cagA gene is often used as a marker for the presence of the cag (cytotoxin-associated gene) pathogenicity island (cagPAI) [4]. Patients infected with H. pylori strains that carry cagA have a higher risk for developing peptic ulcer and gastric cancer [8]. Other virulence determinants located on the cagPAI such as cagE, cagG, cagH, cagI, cagL, and cagM are required for cagPAI mediated NF-κB induction, and cagT and cagY are required for the formation of a needle-like structure that serves to inject cagA into the host cell [9,10]. Although these factors play a critical role in the pathogenesis of H. pylori, their association with specific disease outcomes is not as obvious as with cagA. It has been reported that in some H. pylori strains the cagPAI is split into two separate regions due to the integration of the IS605 insertion sequence [10]. The putative IS605 transposases (tnpA and tnpB) that can mediate this cagPAI disruption [10] might affect the virulence of H. pylori[11], but the exact biological role and clinical relevance of these two determinants is poorly studied. Iran is a developing country with a high prevalence of H. pylori, among both symptomatic and asymptomatic individuals, and with a prevalence as high as 95% in the northern part of the country [12,13]. This high prevalence is coupled to an even higher rate of H. pylori induced peptic ulcer disease and gastric cancers [14]. This makes it an ideal geographically confined region to study the effect of genetic variation of this gastric pathogen on infection associated disorders. In this study we determined associations of the presence of tnpA and tnpB and clinical manifestations of H. pylori infections in patients from the North of Iran.

Methods

Patients

All patients suspect of a H. pylori infection that visited the Tooba Medical Center, in Sari, Iran for endoscopic examination between May 2008 and October 2010 were invited to participate in this study. Patients participating in this study underwent routine gastroscopic examination. The standard number of gastric biopsy samples for patients’ suspect of Helicobacter infection was obtained for routine culture and histological investigations and no extra samples were taken for this study. One of the gastric biopsy samples was sent to the pathology lab where it was tested by routine histopathological techniques and evaluated by standard criteria. Histology grading was performed by the updated Sydney criteria [15]. The other routinely obtained biopsy samples were used for microbiological culture and Rapid Urease Test (RUT), as described below. Ages below 16 years were excluded due to ethical considerations. Also antibiotic use within four months prior to endoscopy, or use of anti-secretory drugs within one month before endoscopy were used as exclusion criteria. This study was approved by the local ethics committee of Tarbiat Modares University, as no extra biopsy samples were needed for this study and that the obtained data could not be traced back to the patient level.

Microbiological analysis

One of the biopsy samples was routinely tested by the gastroenterologist by Rapid Urease Test; and if positive a second sample was obtained and placed in 200 μl sterile thioglycolate (Merck, Germany) broth and then immediately shipped to the diagnostic laboratory for routine culture. Upon arrival in the microbiology lab this sample was immediately grinded and 100 μl of the resultant homogenate was inoculated on a Colombia agar (Merck, Germany) plate supplemented with 7% defibrinated sheep blood (Jihad Daneshgahi, Tehran, Iran), 10% Fetal Calf Serum (FCS) and antibiotics (DENT, Supplement, Oxoid) [15]. Plates were incubated at 37°C, in 10% CO2 conditions provided by incubator (Binder, USA) and high humidity until typical H. pylori colonies appeared or for a maximum of 7 days if no suspect colonies were observed. Colony shape, morphology in microscopic examination, routine biochemical tests such as urease, catalase and oxidase tests were performed for identification of H. pylori strains.

DNA extraction and PCR

Bacterial DNA was extracted from single colonies of H. pylori using a commercially available kit (ExiPrep™ Bacteria Genomic DNA Kit, Bioneer, Daejeon, South Korea). Genotyping was performed by PCR, using specific primers for cagA, tnpA and tnpB as previously described (Table 1). In addition a glmM PCR (Table 1) was carried out [16], both as an additional control for H. pylori identification and quality check of the isolated DNA (positive PCR control). The PCR amplified fragments were size separated on 2% agarose gel (Sinagene, Tehran, Iran) and the ethidium bromide stained DNA was visualized using UV illumination.
Table 1

Primers used in this study

Primers5′-3′ SequenceReference
glmM
AAGCTTTTAGGGGTGTTAGGGGTTT
[20]
AAGCTTACTTTCTAACACTAACGC
 
tnpA
ATCAGTCCAAAAAGTTTTTTCTTTCC
[13]
TAAGGGGGTATATTTCAACCAACCG
 
tnpB
CGCTCTCCCTAAATTCAAAGAGGGC
[13]
AGCTAGGGAAAAATCTGTCTATGCC
 
cagA ATAATGCTAAATTAGACAACTTGAGCGA
[5]
TTAGAATAATCAACAAACATCACGCCAT 
Primers used in this study

Statistical analysis

The chi-square and Fisher exact test was used to test for the association between patient demographics, H. pylori genotypes, and disease groups. A P value of less than 0.05 was accepted as statistically significant. Microsoft Excel 2010 was used to calculate the P values, odds ratio (OR) and 95% confidence interval (95% CI).

Results

376 patients suspect for H. pylori infection (positive RUT test) were enrolled, but H. pylori specific growth was not observed from the biopsy specimen in 16 of them. The remaining 360 patients that were H. pylori culture positive (96%) comprised 95 patients with gastritis (G), 92 with gastric ulcer (GU), 108 with duodenal ulcer, and 65 with gastric cancer (GC) (Table 2). The average age was 42.1 years (range 17 to 73 year) and there were slightly more men (n = 196) than women (n = 164). Detailed demographic data of dyspeptic patients according to age, disease symptoms, and histological findings are shown in Table 2. There were slightly more males with duodenal ulcers, and less with gastric ulcers, but there were no statistically significant associations between age, gender, histopathological findings, and H. pylori associated disease groups.
Table 2

Detailed demographic data of dyspeptic patients according to the age and pathologic findings

Disease typeSample sizeMale (%)Pathology findingsAge range detailed data for each disease groups
<3031-4041-5051-60>60
G
95
51 (53.6)
Mild (n = 14)
6
7
1
0
0
Moderate (n = 67)
33
26
6
2
0
Atrophic (n = 20)
8
5
6
1
0
GU
92
38 (41.3)
Mild (n = 15)
2
3
4
4
2
Moderate (n = 84)
7
12
21
11
33
Atrophic (n = 13)
0
2
2
6
3
DU
108
72 (66)
Mild (n = 23)
4
5
5
6
3
Moderate (n = 57)
6
18
13
12
8
Atrophic (n = 23)
6
7
7
6
4
GC6535 (53.8)Mild (n = 7)
0
0
1
2
4
Moderate (n = 47)
0
0
17
16
14
Atrophic (n = 11)00614
Detailed demographic data of dyspeptic patients according to the age and pathologic findings

PCR screening of tnpA, tnpB and cagA

The overall prevalence of the tnpA, tnpB, and cagA genes were 47.5%, 13.1%, and 59.2%, respectively, and the prevalence of these genes in the four disease groups is listed in Table 3. No significant associations were observed between the presence of the tnpA, tnpB and cagA genes and histological findings. Statistical analysis did however reveal a significant association between the presence of the cagA gene and GC [Relative risk: 1.81; 95% CI 1.44-2.29], and a weak, but significant correlation was observed between the presence of the cagA gene and DU [Relative risk: 1.30; 95% CI 1.01-1.69] and the tnpA gene with GC [Relative risk: 1.45; 95% CI 1.04-1.93] (Table 3). No significant association was observed for tnpB and gastroduodenal diseases.
Table 3

Prevalence of the , , and genes in the four patient groups

Disease groups tnpA
tnpB
cagA
PositivesRelative risk95% CIPositivesRelative risk95% CIPositivesRelative risk95% CI
Gastritis (n = 95) (Control group)
40 (42.1%)
Reference
16 (16.8%)
Reference
45 (47.4%)
Reference
Gastric ulcer (n = 92)
48 (52.2%)
1.23
0.97-1.61
10 (10.9%)
0.64
0.30-1.34
45 (48.9%)
1.03
0.76-1.39
Duodenal ulcer (n = 108)
44 (40.7%)
0.96
0.69-1.34
11 (10.2%)
0.59
0.29-1.22
67 (62%)
1.30
1.01-1.69
Gastric cancer (n = 65)39 (60.0%)1.451.04-1.9310 (15.4%)0.910.44-1.8856 (86.2%)1.811.44-2.29
Prevalence of the , , and genes in the four patient groups

Discussion and conclusions

To our knowledge, this is the largest study (n = 360) investigating the distribution of the H. pylori virulence tnpA, tnpB and cagA in dyspeptic patients. In the first study on tnpA and tnpB by Matter et al.[11], 63% of 215 clinical H. pylori isolates were tnpA positive and 13.5% were positive for tnpB, with a statistically significant association between peptic ulcer disease (PUD) and tnpA positive strains. This association was not apparent for tnpB. In the current study there was a similar prevalence of tnpA and tnpB [171/360; 47.5% and 47/360; 13.1%, for tnpA and tnpB respectively], and a similar association between cagA and gastric cancer patients as observed in a preliminary study by Matter et al.[11]. Unfortunately in their study the associations of tnpA and tnpB with H. pylori associated disease types were not determined. In a more recent but smaller study Matter et al. investigated associations between presence of tnpA and tnpB and gastric cancer in Brazilian patients with gastric cancer (n = 34) and gastritis (n = 34) [17]. The patient population studied here is from the North of Iran (state of Mazandaran), and has been reported to not only have a very high H. pylori infection rate but also a very high rate patients suffering from H. pylori induced disease [18] This high H. pylori prevalence facilitates the collection of a large number of strains from a well defined, small geographical region and this facilitated a study on the putative association between the presence of tnpA/B and the clinical outcome of the H.pylori infection. The prevalence of tnpA and tnpB among gastric cancer and gastritis patients in the Iranian population included in the current study was 42.1% and 60.0% for tnpA, and 16.8% and 15.4% for tnpB, respectively, which, again, was comparable to the findings in the Brazilian population with gastric cancer or gastritis (29.4% and 73.5% for tnpA; and 2.9% and 5.9% for tnpB, respectively). Kersulyte et al.[19] also reported a higher frequency of tnpA in Peruvian gastric cancer strains than in gastritis strains (9/14 (46%) versus 15/45 (33%), respectively). Although the observed associations between tnpA and gastric cancer are similar in the populations in Peru, Brazil and Iran [11,19], there are striking differences for associations of cagA with disease status between these populations. We observed a clear association between the presence of cagA and gastric cancer in the Iranian population, while Matter et al.[11] did not observe such an association in Brazil. While most studies report an association between the presence of cagA and gastric cancer some studies do not observe this association [20,21]. In this particular case it may be due to the low number of patients included in their study (n = 64; versus 160 in our study). After the recognition of H. pylori as an important gastric pathogen [21], many attempts have been made to identify H. pylori virulence factors predicting clinical outcome as this might assist physicians in prediction of disease progression [22]. When using the gastritis group as controls for gene distribution we observed an increased prevalence of the tnpA and cagA genes in the gastric cancer group. To our knowledge this study represents the largest cohort tested thus far for the prevalence of tnpA for an association with the various H. pylori infection associated disease groups. While it is tempting to conclude from the increased prevalence of tnpA and cagA in the gastric cancer group that these genes may serve as useful biomarkers for gastric cancer one cannot draw that conclusion from a cross-sectional study like ours. Also our study design did not include a questionnaire on the disease history of our patients and hence we are unable to correlate clinical symptoms such as bleeding, reflux, abdominal pain etc. with the presence/absence of these virulence factors. A large prospective cohort study would be required to establish reliable positive and negative predictive values of these putative biomarkers. Due to the long time between infection and cancer development such a study would require long follow-up times, and since only few infected individuals develop cancer a large study cohort would be required. In addition there are ethical issues with such a study as the hypothesis to be tested is that patients infected with tnpA positive H. pylori strains are more prone to developing gastric cancer than patients infected with tnpA negative strains. In order to test this hypothesis one must establish the presence of the tnpA H. pylori strain at the start of the study while refraining from eradication of these potentially carcinogenic strains for a long period of time. In spite of the shortcomings of our cross-sectional study it provides strong indications for the clinical relevance of the tnpA gene of H. pylori strains isolated from the Iranian population where the prevalence of H. pylori is relatively high [13] and this high prevalence is coupled to a high incidence of H. pylori induced peptic ulcer disease and gastric cancers [23]. In conclusion tnpA but not tnpB is clearly associated with a more severe disease outcome of Hc pylori infections. As such tnpA could be a valuable novel biomarker but clearly further studies are required to confirm these results especially since at present no obvious biological explanation for a GC inducing function of this putative transposase can be provided.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

ATBA, JGK and AMM build the strain collection, collected the patient status data, carried out the molecular genetic studies, performed the initial statistical analyses, and drafted the manuscript. ATBA, JGK, JAW and MJB participated in the design of the study, the drafting of the mansuscirpt and assisted with the statistical analysis. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-230X/14/33/prepub
  23 in total

1.  Antibiotic resistance of Helicobacter pylori in Mazandaran, North of Iran.

Authors:  Amin Talebi Bezmin Abadi; Ashraf M Mobarez; Tarang Taghvaei; Lutz Wolfram
Journal:  Helicobacter       Date:  2010-12       Impact factor: 5.753

Review 2.  Pathogenesis of Helicobacter pylori infection.

Authors:  Daniela Basso; Mario Plebani; Johannes G Kusters
Journal:  Helicobacter       Date:  2010-09       Impact factor: 5.753

3.  High correlation of babA 2-positive strains of Helicobacter pylori with the presence of gastric cancer.

Authors:  Amin Talebi Bezmin Abadi; Tarang Taghvaei; Ashraf Mohabbati Mobarez; Giuseppina Vaira; Dino Vaira
Journal:  Intern Emerg Med       Date:  2011-05-22       Impact factor: 3.397

4.  Infection with Helicobacter pylori strains lacking dupA is associated with an increased risk of gastric ulcer and gastric cancer development.

Authors:  Amin Talebi Bezmin Abadi; Tarang Taghvaei; Lutz Wolfram; Johannes G Kusters
Journal:  J Med Microbiol       Date:  2011-09-08       Impact factor: 2.472

5.  Low frequency of cagA-positive Helicobacter pylori strains isolated from Iranian patients with MALT lymphoma.

Authors:  Amin Talebi Bezmin Abadi; Ali Ghasemzadeh; Ashraf Mohabati Mobarez
Journal:  Intern Emerg Med       Date:  2011-04-02       Impact factor: 3.397

6.  The association of dupA and Helicobacter pylori-related gastroduodenal diseases.

Authors:  N R Hussein
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2010-04-25       Impact factor: 3.267

Review 7.  Helicobacter pylori colonization of the human gastric epithelium: a bug's first step is a novel target for us.

Authors:  Bor-Shyang Sheu; Hsiao-Bai Yang; Yu-Chun Yeh; Jiunn-Jong Wu
Journal:  J Gastroenterol Hepatol       Date:  2010-01       Impact factor: 4.029

8.  Conversion of Helicobacter pylori CagA from senescence inducer to oncogenic driver through polarity-dependent regulation of p21.

Authors:  Yasuhiro Saito; Naoko Murata-Kamiya; Toshiya Hirayama; Yusuke Ohba; Masanori Hatakeyama
Journal:  J Exp Med       Date:  2010-09-20       Impact factor: 14.307

Review 9.  Gastric cancer in Iran: epidemiology and risk factors.

Authors:  Reza Malekzadeh; Mohammad H Derakhshan; Zinab Malekzadeh
Journal:  Arch Iran Med       Date:  2009-11       Impact factor: 1.354

10.  Helicobacter pylori cagA status and peptic ulcer disease in Iran.

Authors:  Zivar Salehi; Mohammad Halimi Jelodar; Mehdi Rassa; Moheb Ahaki; Hamidreza Mollasalehi; Farhad Mashayekhi
Journal:  Dig Dis Sci       Date:  2008-07-10       Impact factor: 3.199

View more
  6 in total

Review 1.  Helicobacter pylori: Emergence of a Superbug.

Authors:  Amin Talebi Bezmin Abadi
Journal:  Front Med (Lausanne)       Date:  2014-10-14

2.  Helicobacter pylori and Gastric Cancer.

Authors:  Amin Talebi Bezmin Abadi
Journal:  Front Med (Lausanne)       Date:  2016-08-22

Review 3.  Role of dupA in virulence of Helicobacter pylori.

Authors:  Amin Talebi Bezmin Abadi; Guillermo Perez-Perez
Journal:  World J Gastroenterol       Date:  2016-12-14       Impact factor: 5.742

4.  Effect of the cagW-based gene vaccine on the immunologic properties of BALB/c mouse: an efficient candidate for Helicobacter pylori DNA vaccine.

Authors:  Mohammad Chehelgerdi; Abbas Doosti
Journal:  J Nanobiotechnology       Date:  2020-04-21       Impact factor: 10.435

5.  High prevalence of multiple antibiotic resistance in clinical E. coli isolates from Bangladesh and prediction of molecular resistance determinants using WGS of an XDR isolate.

Authors:  Preeti Jain; Asim Kumar Bepari; Prosengit Kumer Sen; Tanzir Rafe; Rashed Imtiaz; Maqsud Hossain; Hasan Mahmud Reza
Journal:  Sci Rep       Date:  2021-11-24       Impact factor: 4.379

Review 6.  Dysregulation of lncRNA in Helicobacter pylori-Infected Gastric Cancer Cells.

Authors:  Leila Yousefi; Hamid Owaysee Osquee; Reza Ghotaslou; Mohammad Ahangarzadeh Rezaee; Tahereh Pirzadeh; Javid Sadeghi; Fatemeh Hemmati; Bahman Yousefi; Seyyed Yaghoub Moaddab; Mehdi Yousefi; Masoud Shirmohammadi; Mohammad Hossein Somi; Khudaverdi Ganbarov; Hossein Samadi Kafil
Journal:  Biomed Res Int       Date:  2021-07-09       Impact factor: 3.411

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.