Literature DB >> 24533312

Natural history of Zoonotic Babesia: Role of wildlife reservoirs.

Michael J Yabsley1, Barbara C Shock1.   

Abstract

Babesiosis is an emerging zoonotic disease on all inhabited continents and various wildlife species are the principal reservoir hosts for zoonotic Babesia species. The primary vectors of Babesia are Ixodid ticks, with the majority of zoonotic species being transmitted by species in the genus Ixodes. Species of Babesia vary in their infectivity, virulence and pathogenicity for people. Various factors (e.g., increased interactions between people and the environment, increased immunosuppression, changes in landscape and climate, and shifts in host and vector species abundance and community structures) have led to an increase in tick-borne diseases in people, including babesiosis. Furthermore, because babesiosis is now a reportable disease in several states in the United States, and it is the most common blood transfusion-associated parasite, recognized infections are expected to increase. Because of the zoonotic nature of these parasites, it is essential that we understand the natural history (especially reservoirs and vectors) so that appropriate control and prevention measures can be implemented. Considerable work has been conducted on the ecology of Babesia microti and Babesia divergens, the two most common causes of babesiosis in the United States and Europe, respectively. However, unfortunately, for many of the zoonotic Babesia species, the reservoir(s) and/or tick vector(s) are unknown. We review the current knowledge regarding the ecology of Babesia among their reservoir and tick hosts with an emphasis of the role on wildlife as reservoirs. We hope to encourage the molecular characterization of Babesia from potential reservoirs and vectors as well from people. These data are necessary so that informed decisions can be made regarding potential vectors and the potential role of wildlife in the ecology of a novel Babesia when it is detected in a human patient.

Entities:  

Keywords:  Piroplasms; Tick-borne; Wildlife; Zoonoses

Year:  2012        PMID: 24533312      PMCID: PMC3862492          DOI: 10.1016/j.ijppaw.2012.11.003

Source DB:  PubMed          Journal:  Int J Parasitol Parasites Wildl        ISSN: 2213-2244            Impact factor:   2.674


1. Introduction

Babesia are tick-borne parasites in the Phylum Apicomplexa. Two closely related genera, Theileria and Cytauxzoon, are also tick-borne, and collectively these three genera are referred to as the piroplasms. Many species of piroplasms are significant pathogens and the Apicomplexa also includes numerous other pathogens of veterinary and medical importance including Plasmodium spp. (causative agents of malaria), Cryptosporidium spp., Eimeria spp., Isospora spp., and Toxoplasma gondii. Several reviews have focused on the clinical aspects of babesiosis in people and domestic animals, the pathogenesis of infection, the phylogenetic relationships of the piroplasms, piroplasm genomics, and their diagnosis and treatment, thus we will review the current knowledge regarding the ecology of Babesia among their reservoir and tick hosts with an emphasis of the role of wildlife as reservoirs (Florin-Christensen and Schnittger, 2009, Lau, 2009, Rosenblatt, 2009, Ayoob et al., 2010, Gray et al., 2010, Suarez and Noh, 2011, Lack et al., 2012, Lobo et al., 2012, Matijatko et al., 2012, Mosqueda et al., 2012, Schnittger et al., 2012). Historically, Babesia were classified by two methods, (1) the relative size and shape of trophozoites in the erythrocytes and the number of merozoites and (2) the host of origin. Based on size, there were two groups (small and large Babesia), but this division is not associated with phylogenetic relatedness. Identification based on host origin was based on the assumption that these parasites are host-specific, which we now know is not the case for many species. Molecular characterization of multiple gene targets indicates that the piroplasms should be divided into at least five or six groups: one that includes small Babesia from various wild rodents, felids, canids, and mesomammals (called archaeopiroplasmids or Microti group); one that includes parasites from cervids, dogs, and people (called the western piroplasms, Duncani group or prototheilerids); one that includes primarily canine, bovine, and cervine species (babesids); another that includes primarily bovine, equine, and ovine species (unguilibabesids); and a final group that includes the Theileria and Cytauxzoon spp. (theilerids) (Criado-Fornelio et al., 2003). Some analyses suggest that the babesids and unguilibabesids are one monophyletic group and that the theilerids represent up to three separate groups. Regardless of divisions, numerous studies support that the organisms currently included in the genus Babesia are polyphyletic, and that new genera should be erected to clarify the phylogenetic relationships of the piroplasms (Criado-Fornelio et al., 2003, Lack et al., 2012, Schnittger et al., 2012). Interestingly, zoonotic species are found in all of the groups with Babesia spp. but no Theileria or Cytauxzoon spp. have been identified as zoonotic infections (Fig. 1).
Fig. 1

Phylogenetic tree of Babesia and related piroplasms with zoonotic species bolded. The tree was constructed using neighbor-joining analysis of full-length 18S rRNA gene sequences extracted from GenBank (accession numbers listed for each species). For zoonotic representatives, the endemic country or region is listed in parentheses.

Phylogenetic tree of Babesia and related piroplasms with zoonotic species bolded. The tree was constructed using neighbor-joining analysis of full-length 18S rRNA gene sequences extracted from GenBank (accession numbers listed for each species). For zoonotic representatives, the endemic country or region is listed in parentheses. Even at the species level, there is considerable confusion regarding the true number of species. For example, Babesia microti, the predominant cause of babesiosis in the United States and a rare cause of disease in people from Europe and Asia, has a holarctic distribution in rodents and insectivores, but recent molecular studies indicate that this species is a species complex that includes at least four ‘named’ types (US, Munich, Kobe, and Hobetsu (referred to as Otsu in some publications)) and an unknown number of other strains (Goethert et al., 2006, Tsuji et al., 2006, Nakajima et al., 2009). It has been suggested that B. microti and other B. microti-like species (some erroneously referred to as Theileria annae) reported from some rodents and mesomammals (e.g. raccoons, foxes, skunks), Babesia rodhaini from rodents, and Babesia leo and Babesia felis from African felids should collectively be included in a new genus but more research is needed before a change is finalized (Uilenberg, 2006, Nakajima et al., 2009). Babesiosis in people can range from asymptomatic infections to severe disease and death. Severity of illness depends on many factors, such as Babesia species and immunocompetence of the patient. Infections with B. microti, the most common species in North America, can result in asymptomatic infection to severe disease which sometimes results in death. Asymptomatic patients are typically diagnosed on routine testing that either identifies the organism in blood smears or during serologic testing (as conducted on some blood donors). It is estimated that about a third of patients remain asymptomatic (Krause et al., 2003). Most patients with B. microti infections develop mild to moderate flu-like illnesses characterized by malaise and fatigue that progress to include the following symptoms: rash, fever, chills, sweats, headache, arthralgia, myalgia, anorexia, cough, or nausea. Rarely, mild splenomegaly or hepatomegaly may be noted. Clinical symptoms may persist for weeks to months, but rarely for more than a year. A small percentage of patients (∼5–10%), especially those that are immunosuppressed or splenectomized, may develop severe disease from B. microti infection. These patients may present with jaundice, or diffuse ecchymoses or petechiae (Rosner et al., 1984). The most common zoonotic species in Europe, Babesia divergens, requires rapid diagnosis as clinical disease is often severe. Generally the parasite has an incubation period of one to three weeks during which the patients may begin to describe malaise and discomfort. Onset of serious illness is sudden, with hemoglobinuria as the most common sign (Telford and Spielman, 1993). Clinical signs of B. divergens infection are easily confused with those of malaria including jaundice, non-periodic fever, sweats, shaking, headache, vomiting, diarrhea, etc. (Gorenflot et al., 1998). It is estimated that most cases of B. divergens infection resulted in major organ failure and death within four to seven days after the onset of hemoglobinuria (Gorenflot et al., 1987, Kjemtrup and Conrad, 2000). However, prompt therapy with blood transfusion and ventilation has reduced the B. divergens mortality rate (Zintl et al., 2003). Recent reviews have discussed the clinical course of infection, diagnosis, and treatment option for babesiosis in detail (Gray et al., 2010, Mosqueda et al., 2012).

2. Natural history of zoonotic Babesia

The Babesia are one of the most common haemoparasites in the world, second only to trypanosomes, and have a wide host range, including hundreds of mammal species and a limited number of bird species. Babesia parasites are maintained in a complex system of tick vectors and animal reservoirs. People are not a natural host for any species of Babesia but can serve as accidental hosts for numerous species (Fig. 2, Table 1).
Fig. 2

Babesia parasites in human erythrocytes. (a) B. divergens, (b) B. venatorum, (c) Babesia sp. MO1 from Kentucky, (d) B. microti, (e) B. duncani, (f) Babesia sp. KO1 from Korea. (1) Paired piriforms; (2) Tetrads; (3) Ring forms. The figure was reprinted with permission from Elsevier first published in Gray et al. (2010). The parasites shown in Fig. 2a, b, c, e, and f were assembled from original photographs, first published as follows: (a) Hunfeld et al., 2008; (b) Häselbarth et al., 2007; (c) Beattie et al., 2002; (e) Kjemtrup et al., 2002; (f) Kim et al., 2007.

Table 1

Natural history characteristics of the primary agents of human babesiosis.

SpeciesGeographical distributionVector(s)aReservoir hostsb
Babesia microti complex
 Babesia microtiUSA (northeast, upper Midwest, and mid-Atlantic)Ixodes scapularisRodents
 Babesia sp. KobeAsia (Japan, Russia, Korea)UnknownRodents
 Babesia sp.ChinaIxodes persulcatusRodents
 Babesia sp. MunichEuropeIxodes ricinusRodents
 B. microti-like sp.AustraliaUnknownRodent?
Babesia sp. TN1USA (Tennessee)UnknownUnknown
Babesia sp. KO1KoreaUnknownUnknown
Babesia duncani (= Babesia sp. WA1)USA (California, Washington)UnknownUnknown
Babesia sp. CA-typeUSA (California)UnknownUnknown
Babesia sp. MO1USA (Missouri, Kentucky, Washington, Massachusetts)Ixodes dentatusLagomorphs
Babesia sp. (B. divergens-like)ChinaUnknownUnknown
Babesia sp. (B. divergens-like)Canary Islands, SpainUnknownUnknown
Babesia divergensEuropeIxodes ricinusBovines
Babesia sp. EU1 (= B. venatorum)EuropeIxodes ricinusCervids
Babesia sp.MexicoUnknownUnknown
Babesia spp.South America (Columbia, Brazil)UnknownUnknown
Babesia spp.Africa (South Africa, Egypt)UnknownUnknown

Primary vector(s) to humans. Other tick species may maintain infections among reservoir hosts.

Additional details regarding reservoir host(s) are given in the text.

Babesia parasites in human erythrocytes. (a) B. divergens, (b) B. venatorum, (c) Babesia sp. MO1 from Kentucky, (d) B. microti, (e) B. duncani, (f) Babesia sp. KO1 from Korea. (1) Paired piriforms; (2) Tetrads; (3) Ring forms. The figure was reprinted with permission from Elsevier first published in Gray et al. (2010). The parasites shown in Fig. 2a, b, c, e, and f were assembled from original photographs, first published as follows: (a) Hunfeld et al., 2008; (b) Häselbarth et al., 2007; (c) Beattie et al., 2002; (e) Kjemtrup et al., 2002; (f) Kim et al., 2007. Natural history characteristics of the primary agents of human babesiosis. Primary vector(s) to humans. Other tick species may maintain infections among reservoir hosts. Additional details regarding reservoir host(s) are given in the text. The complete life cycle for a large percentage of Babesia species is unknown, but ticks in the family Ixodidae are the only known vectors. One possible exception is Ornithodorus erraticus, an argasid soft tick, which may transmit Babesia meri, a parasite of sand rats (Psammomys obesus) in Africa (Gunders, 1977, René et al., 2012, Ros-García et al., 2011, Schwint et al., 2008, Razmi and Nouroozi, 2010). Even for those with known life cycles, there are still many unknowns, such as possible roles of alterative vectors or hosts, impacts of host community diversity on prevalence in ticks and hosts, cross-protection among subsequent infections with the same or closely related Babesia, ability of ticks to serve as reservoirs in the absence of vertebrate hosts (for those that utilize transovarial transmission), and duration of infectivity of the Babesia to tick vectors. Another potential aspect of Babesia transmission that is understudied, and may be important in the ecology of zoonotic infections, is the use of “bridge vectors”. Some pathogens can be maintained in nature by one or more vectors that may be very host specific and are unlikely to or only rarely feed on people. If a tick species that will feed on people and/or a competent reservoir host is present or introduced into the sylvatic cycle, the more catholic vector could transmit Babesia to people. Goethert et al. (2003) discovered that B. microti is maintained in nature by a rodent-associated tick (Ixodes angustus) in an area without Ixodes scapularis; however, genetic testing revealed that the B. microti associated with I. angustus was different from zoonotic strains of B. microti. Similarly, B. microti is maintained in the United Kingdom by another rodent-associated tick (Ixodes trianguliceps); however, genetic characterization of these B. microti strains has not been conducted (Bown et al., 2008). More research is needed to understand the role of bridge-vectors in the ecology of zoonotic Babesia species. An alternative route of transmission is through blood transfusion, and in North America babesiosis is the most common transfusion–transmitted infection (Young et al., 2012). Worldwide, little attention has been given to transfusion-associated cases, but they likely occur in areas where babesiosis is endemic (Hildebrandt et al., 2007). Another route of transmission is vertical (from mother to infant); several transplacental cases associated with B. microti have been reported in the Northeastern United States (Joseph et al., 2012).

2.1. Babesia in North America

The first case of human babesiosis in North America, was diagnosed in a splenectomized patient from California (USA) in 1966 (Scholtens et al., 1968). The causative agent wasn’t identified, but was likely Babesia duncani or the B. sp. CA-type. Soon after the initial case in California, a case caused by B. microti was diagnosed in a patient from Massachusetts (USA) in 1969 (Western et al., 1970). Although B. microti is the primary cause of human babesiosis the United States, at least four other species have been associated with human infections including B. duncani, B. sp. CA-type, B. sp. MO1, and newly discovered Babesia sp. from a patient in Tennessee (Table 1) (Fig. 2) (Persing et al., 1995, Herwaldt et al., 1996, Conrad et al., 2006; Moncayo et al., unpublished). Tick-transmitted cases of babesiosis have not been reported in Canada, but transfusion-associated transmission of B. microti has occurred (Kain et al., 2001). In Mexico, Babesia has been isolated from three individuals by inoculation of splenectomized hamsters, but no molecular characterization was conducted (Osorno et al., 1976).

2.1.1. Babesia microti

2.1.1.1. Humans

The first case of B. microti infection in the United States was detected in 1969 in Massachusetts (Western et al., 1970). The epidemiology of human babesiosis in the United States is similar to Lyme disease with the majority of human cases diagnosed in the northeastern and upper Midwestern United States. In January 2011, babesiosis became reportable in 18 states and one city, and during 2011, 1124 confirmed and probable cases were reported from 15 of the 18 states where babesiosis is reportable (Herwaldt et al., 2012). Most (97%) of cases were reported from seven states (Connecticut, Massachusetts, Minnesota, New Jersey, New York, Rhode Island, and Wisconsin) (Herwaldt et al., 2012). Babesiosis has been reported in asplenic and spleen-intact patients, but disease is most severe in immunocompromised patients. Infections resulting from blood transfusions have been reported and are probably responsible for sporadic cases occurring in non-endemic states (e.g., Texas, California, Washington, and Georgia) and countries (e.g., Canada) (Kain et al., 2001). From 1980 to 2010, it is estimated that 70–100 transfusion–transmitted infections occurred in the United States (Leiby, 2011). Within highly endemic areas (Connecticut, New York, and Massachusetts), seroprevalence among blood-donors ranged between 0% and 4.3% and importantly, over 50% of seropositive patients were PCR positive (Popovsky et al., 1988, Krause et al., 1991, Linden et al., 2000, Leiby et al., 2002, Leiby et al., 2005, Johnson et al., 2009, Johnson et al., 2012).

2.1.1.2. Reservoirs

In the eastern US, where the incidence of human babesiosis is highest, the primary reservoir is the white-footed mouse (Peromyscus leucopus) (Anderson et al., 1991, Telford and Spielman, 1993, Stafford et al., 1999). However, infections with morphologically similar Babesia have been reported in other rodents that are sympatric with P. leucopus (e.g., meadow voles (Microtus pennsylvanicus), short-tailed shrews (Blarina brevicauda), brown rats (Rattus norvegicus), Eastern cottontail rabbits (Sylvilagus floridanus), and Eastern chipmunks (Tamias striatus)) (Healy et al., 1976, Spielman et al., 1981, Anderson et al., 1986, Anderson et al., 1987, Telford et al., 1990). In general, prevalences in reservoir hosts are high (>25%) (Healy et al., 1976, Spielman et al., 1981, Anderson et al., 1986). A recent study by Hersh et al. (2012), described the reservoir competence for a suite of potential hosts by collecting engorged I. scapularis larvae and testing resulting nymphs for B. microti. Two strains of B. microti were detected in the nymphs, one was a strain associated with human infections, but the other was genetically unique and only found in nymphs from opossums (Didelphis virginiana), raccoons (Procyon lotor), and a single wood thrush (Hylocichia mustelina). For the B. microti strain associated with human infections, the white-footed mouse had the highest reservoir competence (average of 29.5% of ticks became infected) followed by short-tailed shrews and eastern chipmunks (averages of 21.9%, and 17.6%, respectively). Interestingly, masked shrews (Sorex cinereus) also infected a high percentage of ticks, but only a limited number of ticks and hosts were tested. In Maine, where I. scapularis is absent or rare, a B. microti that was genetically distinct from human-infecting strains was detected in a redback vole (Clethrionomys gapperi), a masked shrew (S. cinereus), and a short-tailed shrew (Goethert et al., 2003). Interesting data from England and Japan suggest that shrews (Sorex spp.) are important hosts; however, few studies have been conducted on US Sorex spp. (Burkot et al., 2000, Goethert et al., 2003, Zamoto et al., 2004b, Bown et al., 2011) Many of these B. microti reservoirs are also competent reservoirs for two other zoonotic pathogens, Borrelia burgdorferi and Anaplasma phagocytophilum, so coinfections of reservoirs and ticks are common (Magnarelli et al., 2006, Abrams, 2008, Tokarz et al., 2010). Experimental or field-based studies are needed to better understand the reservoir competence of rodent species for B. microti in the Northeastern US. Infections with B. microti, based on either morphology or PCR analysis, have been reported in rodents in the western and southeastern US where B. microti-associated human babesiosis is not known to be endemic. Recently, a high prevalence of B. microti (genetically similar to human-associated strains) was detected in cotton rats (Sigmodon hispidus) in Florida (Clark et al., 2012). In Alaska, B. microti (genetically distinct from human-associated strains) has been detected in Northern red-backed voles (Myodes (Clethrionomys) rutilus), tundra voles (Microtus oeconomus), singing voles (Microtus miurus), shrews (Sorex spp.), and Northwestern deer mice (Peromyscus keeni) (Goethert et al., 2006). In Colorado, B. microti was identified in 13 of 15 prairie voles (Microtus ochrogaster) by PCR of blood or spleens (Burkot et al., 2000). Similarly in Montana, nearly half of all montaine voles (Microtus montanus), meadow voles, and water voles (Arvicola richardsoni) tested by blood or spleen smears were infected with B. microti, whereas none of 40 deer mice (Peromyscus maniculatus) were infected (Watkins et al., 1991). Uncharacterized Babesia spp. have been detected in rodents from Wyoming and California (Wood, 1952, van Peenen and Duncan, 1968, Watkins et al., 1991). B. microti from microtine rodents in Alaska are phylogenetically related to strains detected in other rodent species in Montana and Maine, but these parasites were distinct from human-associated B. microti strains from the United States, Asia, and Europe (Goethert et al., 2006). Therefore, the finding of B. microti (based on morphology) in rodents in a particular geographic area might not suggest a high risk of human infection. As additional evidence that genetic characterization is needed, a small piroplasm from dusky-footed woodrats (Neotoma fuscipes) in California was shown to be a Theileria species (Kjemtrup et al., 2001).

2.1.1.3. Vectors

In the United States, the primary vector responsible for transmission of B. microti to humans is I. scapularis. Other rodent-associated Ixodes species (e.g., I. angustus, I. eastoni, I. muris, and I. spinipalpis) are known or suspected sylvatic vectors of the parasite, or genetically related strains (Watkins et al., 1991, Burkot et al., 2000, Goethert et al., 2003, Tokarz et al., 2010). These other Ixodes spp. are primarily nidicolous and are considered low risk for transmission of B. microti to people, but rare reports of human infestation have been reported (Anastos, 1947, Damrow et al., 1989, Zeidner et al., 2000). Infection rates for adult I. scapularis in the Northeastern and Midwestern United States are typically low (<3%), although rates as high as 30% have been reported (Steiner et al., 2008, Walk et al., 2009, Tokarz et al., 2010). Nymphs and adult I. scapularis can transmit B. microti to humans but transmission takes at least 48 hours of feeding, so prompt removal of ticks can prevent transmission (Piesman and Spielman, 1980, Johnson et al., 2009). Transovarial transmission has not been proven for B. microti, (Oliveira and Kreier, 1979, Walter and Weber, 1981), but results from Hersh et al. (2012) suggest it may occur for some strains as Babesia positive nymphs resulted from larvae that engorged on opossums and passerine birds which are not known to be hosts for B. microti.

2.1.2. Babesia duncani

A Babesia sp. (originally referred to as Babesia sp. WA1), morphologically indistinguishable from B. microti, was recognized in babesiosis patients from Washington and California in the early 1990s (Quick et al., 1993, Thomford et al., 1994). This parasite has been formally named B. duncani (Conrad et al., 2006). Although morphologically similar parasites have been reported from people in California previously, it is unknown if these were B. duncani or B. sp. CA type (Scholtens et al., 1968, Bredt et al., 1981). Importantly, cases have been documented in immunocompetent individuals with spleens as well as immunocompromised individuals and blood transfusion-acquired cases have been reported (Herwaldt et al., 2011, Bloch et al., 2012). Serological studies conducted near cases in California and Washington indicated that 3.5–16% of individuals were seropositive (Quick et al., 1993, Persing et al., 1995). Even higher seroprevalences have been reported among blood donors in several states outside the endemic range, which is likely due to movement of infected individuals or infection with one or more Babesia spp. that cross-react with B. duncani (Prince et al., 2010). Phylogenetic analysis of B. duncani indicated that it is in a separate clade from other Babesia species that includes B. conradae from dogs in California, a Babesia sp. from woodrats in Texas, B. lengau from cheetahs in Africa, and B. poelea and B. uriae from seabirds (Fig. 1) (Kjemtrup et al., 2000, Yabsley et al., 2005, Yabsley et al., 2006a, Yabsley et al., 2009, Conrad et al., 2006, Bosman et al., 2010, Charles et al., 2012). This group was also related to Babesia sp. CA-type from humans in California and other Babesia from mule deer (Odocoileus hemionus) and bighorn sheep (Ovis canadensis) in California (Kjemtrup et al., 2000), Significantly, to date, neither a reservoir nor a tick vector has been identified. Testing of numerous rodent, insectivore, and lagomorph species in Washington was uniformly negative for B. duncani (Quick et al., 1993, Persing et al., 1995).

2.1.3. Babesia sp. CA-type

Four severe to fatal human cases with Babesia sp. CA-type have been reported in splenectomized patients from California (Persing et al., 1995). This species is morphologically indistinguishable from B. duncani, but can be distinguished by genetic sequencing of multiple targets. No vector or reservoir has been identified, but genetically similar organisms have been detected in mule deer, bighorn sheep, and a captive fallow deer (Dama dama) from California. However, sequence analysis of the 18S rRNA gene and internal transcribed spacer (ITS)-2 region has revealed limited nucleotide differences between the Babesia spp. from cervids and Babesia sp. CA-type from humans (Conrad et al., 2006).

2.1.4. Babesia sp. MO1

Babesia sp. MO1 is a rare cause of babesiosis in the United States. In 1992, this novel Babesia species was detected in a splenectomized patient in Missouri (Herwaldt et al., 1996). Despite treatment (quinine and clindamycin), the patient died 13 days after diagnosis. Two additional cases of Babesia sp. MO1 in splenectomized patients, both nonfatal, have been reported in Kentucky and Washington (Beattie et al., 2002, Herwaldt et al., 2004). The natural hosts of this Babesia sp. appear to be lagomorphs. In Massachusetts, 16% of eastern cottontail rabbits (S. floridanus) were positive (Goethert and Telford, 2003) and related Babesia sequences were subsequently found in desert cottontails (Sylvilagus audubonii) and black-tailed jackrabbits (Lepus californicus) from Texas (Yabsley et al., 2006b). Ixodes dentatus is a competent vector and transmission to rabbits is temporally correlated with peak I. dentatus larvae activity (Goethert and Telford, 2003). I. dentatus is a common tick on rabbits and birds and it will feed on people, although rarely (Harrison et al., 1997, Hamer et al., 2011). Initial phylogenetic analyses on a fragment of the 18S rRNA gene indicated that the Babesia sp. (MO1) was closely related to B. divergens, leading to concern that this European parasite had been introduced into the United States. Subsequent analyses proved that Babesia sp. MO1 is distinct from B. divergens from Europe based on the additional sequence analysis, lack of infectiousness to cattle, distinct morphology when grown in vitro, and erythrocyte in vitro specificity (Holman et al., 2005, Holman, 2006).

2.2. Babesia in Europe and Asia

The first human babesiosis case was reported in Europe and occured in 1957 (Skrabalo and Deanovic, 1957). The most common cause of human babesiosis in Europe is B. divergens, but other zoonotic species include a B. divergens-like species from the Canary Islands, Babesia sp. EU1 (also called B. venatorum), and a B. microti-like species (Fig. 2) (Table 1). As with Babesia species in the US, some infections go undiagnosed as demonstrated by a serologic study conducted in Germany where 3.6% and 5.4% of 467 asymptomatic individuals had antibodies reactive to B. divergens and B. microti, respectively (Hunfeld et al., 2002). At least four species or genotypes of zoonotic Babesia have been detected in Asia with rare infections reported from Japan, Taiwan, Korea, India, and China (Table 1) (Wei et al., 2001, Arai et al., 2003, Marathe et al., 2005, Kim et al., 2007). Cases from Japan, Taiwan, and China have been caused by B. microti-like species (Wei et al., 2001, Arai et al., 2003, Kim et al., 2007) while the Korean cases were caused by a novel Babesia sp. (KO1) which is related to B. ovis (Kim et al., 2007).

2.2.1. Babesia divergens

The first human babesiosis case was caused by B. divergens and it occurred in Croatia (Skrabalo and Deanovic, 1957). Human cases are typically severe, especially in splenectomized individuals. To date, approximately 40 cases have been reported, primarily from France, Ireland, and Great Britain with fewer cases reported from Sweden, Switzerland, Spain, Portugal, and Croatia (Centeno-Lima et al., 2003, Moreno Giménez et al., 2006, Martinot et al., 2011). However, undiagnosed exposures do occur, as a seroprevalence of 13% was detected among Lyme disease patients in Sweden (Uhnoo et al., 1992). Cattle are the natural host for B. divergens and infections are noted throughout Europe and possibly into North Africa (Tunisia), which corresponds with the distribution of the only known vector, Ixodes ricinus (Zintl et al., 2003). Although cattle are the principal host, infections may have been detected in farmed reindeer (Rangifer tarandus) in the United Kingdom; however, these infections may have been caused by Babesia capreoli (Malandrin et al., 2010). Extensive molecular or biological characterizations of “B. divergens” samples from cervids have revealed that they are distinct and likely are B. capreoli (Adam et al., 1976, Schmid et al., 2008, Bastian et al., 2012). In addition, B. capreoli, unlike B. divergens, lacks infectivity for gerbils and splenectomized cattle (Malandrin et al., 2010). Additional studies are needed to confirm the ability of B. divergens to utilize cervids (non-splenectomized) as reservoirs (Zintl et al., 2011). Experimental B. divergens infections have been established in a variety of splenectomized animals including chimpanzees (Pan troglodytes), rhesus macaque (Macaca mulatta), laboratory rats, roe deer (Capreolus capreolus), fallow deer, red deer (Cervus elaphus), European mouflon (Ovis orientalis musimon), and domestic sheep (Malandrin et al., 2010). Babesia divergens shares the same vector as B. capreoli and two other zoonotic Babesia in Europe (B. sp. EU1 and B. microti). Infections have been reported in I. ricinus from Hungary, Austria, Belgium, Netherlands, Switzerland, Germany, Norway, and Estonia (Blaschitz et al., 2008, Wielinga et al., 2009, Schorn et al., 2011, Egyed et al., 2012 Lempereur et al., 2012, Oines et al., 2012). Importantly, surveys of ticks utilizing highly conserved or short regions of the 18S rRNA gene may lead to misidentification of B. capreoli and other B. divergens-like sp. as B. divergens. Transovarial transmission by I. ricinus has been documented (Bonnet et al., 2007a).

2.2.2. Babesia divergens-like spp.

A B. divergens-like species has been reported in a single patient from the Canary Islands, Spain, in 1994, who had an unidentified tick attached prior to his illness (Olmeda et al., 1997). Sequence analysis of a short region of 18S rRNA indicated the agent was related to B. divergens, but neither B. divergens nor its vector (I. ricinus) is present on the Canary Islands. Interestingly, it was noted that the patient carried a tick-infested rabbit before becoming sick. Although none of the ticks were available for identification, Ixodes ventalloi is a common rabbit-associated tick on the island. Additional work is needed to determine if this species is a variant of B. divergens or is related to B. divergens-like species that are associated with lagomorphs in the United States. Recently, two cases of B. divergens-like sp. were detected among 377 anemic patients in Shandong Province, China (Qi et al., 2011). Similar to the Canary Islands, neither B. divergens nor its vector (I. ricinus) is present in China. Currently, no vector or reservoir host is known for this Chinese babesiosis agent.

2.2.3. Babesia sp. EU1

Babesia sp. EU1 was first recognized as a human pathogen in 1998 and was given the designation EU (European Union)-1 because the three initial cases occurred in asplenic patients from Italy and Austria (Herwaldt et al., 2003). An additional case in an immunosuppressed patient from Germany has been reported. The infections ranged from mild to moderately severe, but none were fatal (Herwaldt et al., 2003, Häselbarth et al., 2007). The name B. venatorum has been proposed, but a formal description has not been published (Häselbarth et al., 2007). Roe deer are the natural host of this parasite and infected deer have been reported from Slovenia, France and Italy (Duh et al., 2005a, Bonnet et al., 2007b, Tampieri et al., 2008, Bastian et al., 2012). Prevalences in deer are generally high (>20%) (Duh et al., 2005a, Bonnet et al., 2007b). No infections have been reported in sympatric red deer, although red deer are infected with B. capreoli (Duh et al., 2005a). Disease due to B. sp. EU1 has been reported for a captive reindeer (R. tarandus) in a zoo in The Netherlands (Kik et al., 2011). The only known vector of B. sp. EU1 is I. ricinus, and similar to B. divergens, infected ticks have been reported throughout Europe including Estonia, Switzerland, Poland, Italy, Belgium, Germany, France, Netherlands, Norway, and Slovenia (Duh et al., 2005b, Casati et al., 2006, Schmid et al., 2008, Cieniuch et al., 2009, Wielinga et al., 2009, Cassini et al., 2010, Burri et al., 2011, Gigandet et al., 2011, Katargina et al., 2011, Reis et al., 2011, Schorn et al., 2011, Capelli et al., 2012, Lempereur et al., 2012, Oines et al., 2012). Transovarial and transstadial transmission of B. sp. EU1 by I. ricinus has been documented (Bonnet et al., 2007b, Bonnet et al., 2009, Mazyad et al., 2010), but in general, prevalences in I. ricinus are low (<2%) (Cieniuch et al., 2009, Cassini et al., 2010, Katargina et al., 2011, Oines et al., 2012). Interestingly, this Babesia has been detected in I. ricinus removed from passerines that migrated to Norway and northwestern Russia, suggesting a risk for establishment in countries currently north of the known distribution (Hasle et al., 2011, Movila et al., 2011). A Babesia, closely related or identical to B. sp. EU1 have been detected in Ixodes persulcatus from the Novosibirsk region of Russia (Rar et al., 2011), but a survey of this tick species in Estonia failed to detect B. sp. EU1 (Katargina et al., 2011).

2.2.4. Babesia microti and related species

2.2.4.1. Humans

Currently, only a single case of B. microti-associated babesiosis has been confirmed in Europe: a German patient with leukemia who likely became infected by a transfusion (Hildebrandt et al., 2007). Retrospective screening of blood donors for the patient revealed a single donor with a titer to B. microti. Neither person had travel history to North America or Asia. Several surveys have detected anti-B. microti antibodies in individuals in Croatia and Poland suggesting that infections are underdiagnosed (Topolovec et al., 2003, Chmielewska-Badora et al., 2012). In Asia, human cases with B. microti-like sp. are rare and sporadic infections have been reported from Japan, Taiwan, China, and possibly India (Wei et al., 2001, Arai et al., 2003, Marathe et al., 2005). The first human case (B. microti Kobe type) in Japan was diagnosed in a patient in 1999. This patient likely acquired the infection from an asymptomatic donor (Matsui et al., 2000, Wei et al., 2001). Previously diagnosed cases have been reported in Tawain (asymptomatic) (Shih et al., 1997) and in China (Li and Meng, 1984), but the causative agents were not well characterized. Serologic studies in Asia have indicated that unrecognized infections have occurred. In Taiwan, individuals with antibodies to B. microti have been reported (Hsu and Cross, 1977, Shih et al., 1997) and a retrospective survey of sera collected in 1985 from Japan indicated that 1.3% of 1335 samples had antibodies to B. microti Kobe type (n = 3) and B. microti Hobetsu type (n = 14), with the latter type having only been previously detected in rodents (Tsuji et al., 2001, Arai et al., 2003). Outside of Southeast Asia, antibodies to B. microti have been detected in 6% of 273 individuals from northern Turkey (Poyraz and Güneş, 2010).

2.2.4.2. Reservoirs

In Europe, natural infections of B. microti have been reported from numerous rodent and shrew species including species of yellow-necked mice (Apodemus flavicollis), wood mice (Apodemus sylvaticus), bank voles (Myodes (Clethrionomys) glareolus), field voles (Microtus agrestis), common shrews (Sorex araneus), and Mus spp. in Germany, Poland, Croatia, Slovenia, Austria, Hungary, Bulgaria, Czech Republic, Slovakia, and the United Kingdom (Sebek et al., 1977, Sebek et al., 1980, Turner, 1986, Randolph, 1995, Bajer et al., 2001, Duh et al., 2003, Siński et al., 2006, Beck et al., 2011, Bown et al., 2011). Genetic characterization of various samples of B. microti has indicated that both zoonotic and presumed non-zoonotic strains are co-circulating in the same species of rodents (Beck et al., 2011). In Asia, at least three named types of B. microti parasites (US, Kobe, and Hobetsu) have been detected in naturally infected rodents and shrews (Zamoto et al., 2004a, Zamoto et al., 2004b, Kim et al., 2007, Qi et al., 2011). In Japan, two field mice species (Large Japanese field mice (Apodemus speciosus) and Small Japanese field mice (A. argenteus)) are natural hosts for B. microti Kobe type (Shiota et al., 1984, Tsuji et al., 2001, Wei et al., 2001, Saito-Ito et al., 2004, Saito-Ito et al., 2007). Numerous rodents and shrews are infected with B. microti Hobetsu type including Large Japanese field mice, grey red-backed voles (Clethrionomys rufocanus), northern red-backed voles (C. rutilus), Japanese field voles (Microtus montebelli), long-clawed shrews (Sorex unguiculatus), and Laxmann’s shrews (Sorex caecutiens) (Tsuji et al., 2001). Large Japanese field mice, grey red-backed voles, and northern red-backed voles are also hosts for B. microti US-like (Zamoto et al., 2004a, Zamoto et al., 2004b). In Taiwan and China, B. microti Kobe type or related parasites have been reported in Horsfield’s shrews (Crocidura horsfieldii) and spinous country-rats (Rattus coxinga), Chinese white-bellied rats (Niviventer confucianus) and striped field mice (Apodemus agrarius) (Saito-Ito et al., 2008). B. microti US type has been found in striped field mice and Korean field mice (Apodemus peninsulae) from South Korea, yellow steppe lemmings (Eolagurus (= Lagurus) luteus) from China, and Korean field mice and grey red-backed voles from Eastern Russia (Zamoto et al., 2004b). A related B. microti-like sp. has been detected in Eurasian red squirrels (Sciuris vulgaris) (Tsuji et al., 2006).

2.2.4.3. Vectors

In Europe, the primary vector of B. microti is I. ricinus, which also transmits B. divergens and several other human and veterinary pathogens (e.g., Borrelia and Babesia). This tick is common on large mammals, including people, throughout Europe and isolated parts of western Asia and northern Africa. Infections with B. microti-like species have been reported in I. ricinus throughout the range of the tick including Switzerland, Poland, Italy, the Netherlands, Czech Republic, Estonia, Belgium, Hungary, Germany, Russia, and the United Kingdom (Alekseev et al., 2003, Hartelt et al., 2004, Rudolf et al., 2005, Sréter et al., 2005, Casati et al., 2006, Siński et al., 2006, Nijhof et al., 2007, Bown et al., 2008, Wielinga et al., 2009, Cassini et al., 2010, Burri et al., 2011, Gigandet et al., 2011, Katargina et al., 2011, Lempereur et al., 2011). In England, both I. ricinus and I. trianguliceps can transmit B. microti-like spp. among voles but I. trianguliceps is believed to be the primary vector because exclusion of deer (with subsequent drop in numbers of I. ricinus) did not affect density of I. trianguliceps or prevalence of Babesia in voles (Bown et al., 2008). Naturally infected I. trianguliceps have also been reported in Poland and Russia (Telford et al., 2002, Karbowiak, 2004). Interestingly, B. microti was recently detected in 4.5% of 468 questing Dermacentor reticulatus from Poland, suggesting a need to investigate other potential vectors (Wójcik-Fatla et al., 2012). In Asia, B. microti Hobetsu have been detected in questing Ixodes ovatus from Japan while B. microti US type and a B. microti type related to B. microti Kobe type have been detected in I. persulcatus from Russia and China (Saito-Ito et al., 2004, Yano et al., 2005, Sun et al., 2008, Rar et al., 2011, Zamoto-Niikura et al., 2012). In Taiwan, Ixodes granulatus transmitted a B. microti strain to laboratory rats (van Peenen et al., 1977).

2.2.5. Babesia sp. KO1

The first human case of babesiosis in Korea was diagnosed in a splenectomized patient from Jeon-nam Province (Fig. 2) (Kim et al., 2007). She was successfully treated with clindamycin after treatment with quinine, for her initial diagnosis of malaria, failed. Parasites observed in her blood were classified as a larger Babesia and molecular characterization indicated it was related to Babesia sp. from sheep in China. A subsequent PCR-based survey of 68 residents from the patient’s village detected three asymptomatic cases (Kim et al., 2007). All goats tested from the village were negative and no reservoir is currently known. No vector has been identified for B. sp. KO1 but Haemaphysalis longicornis and Haemaphysalis quinghaiensis are vectors of two related Babesia spp. from China (Bai et al., 2002, Guan et al., 2010).

2.3. Babesia in Africa

Human babesiosis cases in Africa are rarely diagnosed; however, widespread occurrence of malaria likely causes an underestimation of the number of babesiosis cases (Table 1). To date, three cases of babesiosis have been reported from Egypt. The first case involved a splenectomized farm worker who became ill while a study on livestock babesiosis was occurring. Serology indicated an active infection and the patient recovered after treatment (Michael et al., 1987). The other cases resulted in mild illnessess that resolved after treatment (El-Bahnasawy and Morsy, 2008, El-Bahnasawy et al., 2011). Two suspected cases in South Africa had intraerythrocytic parasites morphologically consistent with Babesia. One patient recovered following treatment with quinine and tetracycline and the other patient died despite treatment (Bush et al., 1990). Antibodies to Babesia have been detected in individuals in Nigeria but analysis of blood smears and inoculation of splenectomized calves and rats failed to confirm infection (Leeflang et al., 1976). Several Babesia spp. have been reported from wild and domestic animals in Africa, but because no sequence analysis has been conducted on human cases, no reservoirs for zoonotic Babesia spp. are currently known. Similarly, few studies have investigated potential vectors of zoonotic Babesia in Africa. A recent study on the Sinai Peninsula (in the Asian portion of Egypt), reported B. divergens-like sp. and B. sp. EU1 infections in I. ricinus (Mazyad et al., 2010).

2.4. Babesia in Australia

The first case of babesiosis in Australia was diagnosed in 2010 (Table 1) (Senanayake et al., 2012). The fatal case occurred in a 56-year-old man with several previous medical issues. Ovoid forms and tetrads consistent with Babesia were found on blood smear and he had a positive antibody titer for B. microti. The complete 18S rRNA gene sequence was 100% similar to B. microti and partial β-tubulin gene sequence was similar to strains of B. microti from the United States. The patient reported previous tick bites and only had a travel history to New Zealand (40 years previously). Following this report, a patient with no travel history outside of Australia tested positive for antibodies reactive with B. microti and B. duncani, and an additional patient with no travel history outside of Australia tested positive for antibodies to B. duncani (Mayne, 2011). Although Babesia spp. have been reported from domestic and wild animals in Australia, there is currently no reservoir nor vector identified for this zoonotic Babesia sp.

2.5. Babesia in South America

Only three cases of uncharacterized babesiosis have been reported from South America, two from Brazil and one from Columbia (Table 1) (Ríos et al., 2003, Rech et al., 2004). However, serologic studies indicate that exposure occurs commonly in some regions and that infections are either asymptomatic or not diagnosed (Alecrim et al., 1983, Rech et al., 2004, Ríos et al., 2003). Sera from two borreliosis cases in Brazil and one from Columbia reacted with B. bovis antigens (Ríos et al., 2003, Yoshinari et al., 2003) and B. bovis antibodies have also been detected in 10% of 49 individuals and 25% of 59 Lyme borreliosis patients in Brazil (Yoshinari et al., 2003). Antibodies to B. microti have been detected in 31% of 80 individuals in Columbia (Buelvas et al., 2008). However, the causative agents are unknown because the serologic assays used crude antigens which can result in cross-reactions.

3. Detection and characterization methods

The primary method to diagnose babesiosis is the observation of parasites within erythrocytes on Giemsa or Wright’s stained thin blood smears. Parasites can also be visualized by UV illumination after staining with acridine orange. Acute cases of babesiosis are typically easily diagnosed by this method because high numbers of parasites are often observed; however, in chronic cases or when trying to diagnose infection in a nonclinical reservoir, this method lacks sensitivity. In addition, few morphological characters are useful in distinguishing Babesia species. The most common criterion is size, but even among the ‘small’ (typically 1–2.5 μm) or ‘large’ Babesia (typically 3–5 μm), most species are morphologically indistinguishable, thus molecular methods are important for species identification (Kjemtrup et al., 2000, Birkenheuer et al., 2004, Conrad et al., 2006). Importantly, the morphology of a particular Babesia species may vary, especially if in an aberrant host, so morphology alone cannot be used to definitively identity a parasite to species (Demeter et al., 2011). Serologic testing is commonly used to diagnose infections when homologous antigens, or antigens from a very closely related species, are available. Because not all human infections result in clinical disease, these chronic cases are more likely diagnosed by serology, rather than blood smear, because few parasites are found in the peripheral blood. In the United States, serologic tests for B. microti are considered sensitive and specific because the other Babesia that infect humans in the United States (i.e., B. duncani, B. sp. CA-type, and Babesia sp. MO1) have limited reactivity with B. microti antigens (Quick et al., 1993, Herwaldt et al., 1996). But, as novel Babesia are discovered, serologic cross-reactivity may be observed. Also, as noted, some reports of human Babesia infection is only based on serology, which cannot be use to definitively identify the Babesia species. Sera from B. duncani patients reacted with the closely related B. conradae (also called “California isolate” of Babesia gibsoni), but only minimally with B. microti (Quick et al., 1993). Similarly, sera from the Babesia sp. MO1 patient only minimally reacted with B. duncani and B. microti antigens but strongly reacted with B. divergens antigens (Herwaldt et al., 1996). In Europe, serologic testing is rarely used to diagnose B. divergens infections because of the rapid course of illness (Gorenflot et al., 1998). Serum samples from patients infected with Babesia sp. EU1 reacted with B. divergens but not B. microti or B. duncani (Herwaldt et al., 2003). B. microti Hobetsu and Kobe types exhibit limited reactivity with B. microti US type from the United States as only three of 18 sera positive for high Babesia Hobetsu or Kobe type titers reacted with B. microti US type (Arai et al., 2003). Inoculation of laboratory animals can be used to diagnose infection with some Babesia species (e.g., B. microti and B. duncani, which both readily grow in hamsters (Mesocricetus auratus) and Mongolian gerbils (jirds) (Meriones unguiculatus)) (Gleason et al., 1970, Quick et al., 1993). B. duncani can also infect laboratory mice (Hemmer et al., 2000), and an inoculated, splenectomized domestic dog seroconverted, but parasites were not observed in blood samples (Thomford et al., 1994). Babesia sp. MO1 does not replicate in laboratory hamsters or Mongolian gerbils nor in splenectomized calves or bighorn sheep (Herwaldt et al., 1996, Herwaldt et al., 2004). Although B. divergens can infect a wide range of ungulates, including its natural host (cattle) and immunosuppressed experimental hosts (e.g., mouflon, red deer, roe deer, fallow deer, and reindeer) (Malandrin et al., 2010), the only laboratory animal that was susceptible to infection was the Mongolian gerbil (Lewis and Williams, 1979). Babesia sp. EU1 did not infect Mongolian gerbils (Herwaldt et al., 2003). Japanese strains of B. microti-like sp. also infect hamsters (Shih et al., 1997, Tabara et al., 2007). Additionally, considerable progress has been made in the epidemiology of zoonotic Babesia from Japan by detecting Babesia parasites in wild rodent reservoirs by inoculating SCID mice whose erythrocytes have been replaced with human erythrocytes (Saito-Ito et al., 2000, Tsuji et al., 2001). Although Babesia species were historically identified on morphologic characteristics alone (e.g., size, general morphology, formation of tetrads), it is now recognized that additional data such as life history (e.g., vector), serologic cross-reaction, and host-specificity are needed to definitively identify Babesia. Because these data are lacking for many species, molecular techniques have become particularly important in the diagnosis and classification of Babesia species (Table 2). Chronic mild infections or those recently acquired are more likely to be diagnosed by PCR than by blood smear analysis or serology, respectively, because PCR is more sensitive for detecting low numbers of circulating parasites, or in the case of early acute infections, before seroconversion occurs (Schwint et al., 2009). Importantly, PCR can be useful in the diagnosis of babesiosis in areas where malaria is endemic because Babesia may look similar to some stages of Plasmodium (Persing et al., 1992).
Table 2

Selected polymerase chain reaction (PCR) assays developed for Babesia that can be used for detection and molecular characterization.

Target genePrimer namePrimer sequence (5′–3′)References
18S rRNA of Babesia spp.bab1CTTAGTATAAGCTTTTATACAGCPersing et al. (1992)
bab4ATAGGTCAGAAACTTGAATGATACAPersing et al. (1992)
bab2GTTATAGTTTATTTGATGTTCGTTTPersing et al. (1992)
bab3AAGCCATGCGATTCGCTAATPersing et al. (1992)
PiroAAATACCCAATCCTGACACAGGGArmstrong et al. (1998)
PiroBTTAAATACGAATGCCCCCAACArmstrong et al. (1998)
CryptoFAACCTGGTTGATCCTGCCAGTDuh et al. (2005a)
CryptoRGCTTGATCCTTCTGCAGGTTCACCTACDuh et al. (2005a)
3.1CTCCTTCCTTTAAGTGATAAGYabsley et al. (2005)
5.1CCTGGTTGATCCTGCCAGTAGTYabsley et al. (2005)
RLBH-FGAGGTAGTGACAAGAAATAACAATASchouls et al.(1999)
RLBH-RTCTTCGATCCCCTAACTTTCSchouls et al. (1999)
BabforGACTAGGGATTGGAGGTCBlaschitz et al. (2008)
BabrevGAATAATTCACCGGATCACTCBlaschitz et al. (2008)
BdiFCAGCTTGACGGTAGGGTATTGGOines et al. (2012)
BdiRTCGAACCCTAATTCCCCGTTAOines et al. (2012)
TaqMan probe BdiTFAM-CGAGGCAGCAACGG-MGBOines et al. (2012)



ITS1 of Babesia spp.15CCGATCGAGTGATCCGGTGAATTABostrom et al. (2008)
13BGCTGCGTCCTTCATCGTTGTGBostrom et al. (2008)
15DAAGGAAGGAGAAGTCGTAACAAGGBostrom et al. (2008)
13CTTGTGTGAGCCAAGACATCCABostrom et al. (2008)
ITS1forCGAGTGATCCGGTGAATTATTCBlaschitz et al. (2008)
ITS1revCCTTCATCGTTGTGTGAGCCBlaschitz et al. (2008)



ITS2 of Babesia spp.For7AGCCAATGCGATAAGCATTShock et al. (2012)
Rev7TCACTCGCCGTTACTAGGAGAShock et al. (2012)
ITS2forGGCTCACACAACGATGAAGGBlaschitz et al. (2008)
ITS2revCTCGCCGTTACTAAGGGAATCBlaschitz et al. (2008)



ITS1, 5.8S, and ITS2 of Babesia spp.1055FGGTGGTGCATGGCCGHolman et al. (2003)
ITSRGGTCCGTGTTTCAAGACGGHolman et al. (2003)
1200FCAGGTCTGTGATGCTHolman et al. (2003)
ITSFGAGAAGTCGTAACAAGGTTTCCGHolman et al. (2003)
LSUR300TWGCGCTTCAATCCCHolman et al. (2003)



β-Tubulin of Babesia spp.F34TGTGGTAACCAGATYGGWGCCAACaccio et al. (2000)
R323TCNGTRTARTGNCCYTTRGCCCACaccio et al. (2000)
F79GARCAYGGNATNGAYCCNGTAACaccio et al. (2000)
R206ACDGARTCCATGGTDCCNGGYTCaccio et al. (2000)
Tubu63FCAAATWGGYGCMAARTTYTGGGAZamoto et al. (2004a)
Tubu-3’TCGTCCATACCTTCWCCSGTRTACCAGTGZamoto et al. (2004a)



β-Tubulin of Babesia microtiB-tub-F1GTTAGATCTGGYCCATACGGClark et al. (2012)
B-tub-R1TGTATTGTTGTGARCCACGGCClark et al. (2012)



CCT7 of B. microtiCCT-390FGATTTCATAATGGARGGMATGGCDCCTCAGANakajima et al. (2009)
CCT-1327RTCYCTYARTATDCGTGATATTTCCATCTNakajima et al. (2009)



CCT7 of Babesia spp.CCT-262FCARGATGAYGARGTKGGDGATGGWACBACNakajima et al. (2009)
TBcct- 3’R1GGCASGCKGCYTCAGTSGCTGMGTANakajima et al. (2009)
TBcct35FTGAAGGARGGMACNGAYACWTCYCARGGNakajima et al. (2009)
TBcct1519RGTYTTYTTHACBAGGCTGGGCTCCCADA TRCANakajima et al. (2009)



HSP70 of Babesia spp.HSP70forGCTATTGGTATTGACTTGGGBlaschitz et al. (2008)
HSP70revCCTTCATCTTGATAAGGACCBlaschitz et al. (2008)



HSP70 of Babesia spp.VariousVariousYamasaki et al. (2007)
Selected polymerase chain reaction (PCR) assays developed for Babesia that can be used for detection and molecular characterization. PCR assays targeting several genetic targets have been developed for the detection and characterization of Babesia (Table 2). Some assays are highly specific for certain species, which is useful for diagnosis; however, genus-wide PCR assays and subsequent DNA sequencing are also useful for the detection of Babesia, as novel species may be detected or unexpected species may be present. For example, a patient from California, where only B. duncani and Babesia sp. CA-type have been associated with human infections, was diagnosed with B. microti which was acquired from blood products from a donor from the northeastern United States (Ngo and Civen, 2009).

4. Conclusions and future perspectives

Because babesiosis of humans is exclusively a zoonosis, it is imperative that we understand the natural history (vertebrate and tick hosts) for the various Babesia species that infect people. Some zoonotic Babesia (e.g., B. divergens) are associated primarily with domestic animals, but most zoonotic Babesia are maintained in wildlife reservoirs. The incidence and diversity of tick-borne infections have increased in recent years because of better diagnostic tools, increased awareness, increased contact with natural areas and vectors (habitat encroachment), increased number of immunosuppressed and/or splenectomized individuals, and changes in the environment, for example sub urbanization, which have led to increased densities of ticks and potential reservoir hosts. For example, the incidence and geographic range of Lyme disease, caused by B. burgdorferi, is increasing in North America and Europe (Bacon et al., 2008, Rizzoli et al., 2011). In the United States, B. microti and B. burgdorferi utilize the same vector and reservoir, and in Europe, B. divergens and B. burgdorferi utilize the same vector. Thus, measures to control and prevent Lyme disease may affect the incidence of Babesia infections. Another factor that may impact incidence of babesiosis is global climate change which may cause a shift in the distribution and density of Ixodid ticks (Gilbert, 2010, Jaenson et al., 2012, Estrada-Peña et al., 2012). As with other vector-borne pathogens with vertebrate reservoirs, determining the effects of climate change on the pathogen or vector is complicated because climate changes may also cause changes in the distribution or density of the vertebrate reservoir hosts (Schloss et al., 2012). For many cases of babesiosis, the causative agents are unknown and for many agents of babesiosis, the reservoir(s) and/or vectors are unknown (Table 1). While these data are critical to our understanding of these zoonoses, understanding the epidemiology of these parasites is not as simple as knowing the reservoir hosts and vectors. Ixodid tick vectors may primarily depend on non-reservoir hosts for blood meals (e.g., cervids) that are not reservoirs for some Babesia such as B. microti or B. divergens but are important hosts for the vectors such as I. scapularis and I. ricinus, respectively (Paddock and Yabsley, 2007, Gilbert et al., 2012). Recent data also suggest that mesopredator populations may be important factors in the ecology of B. microti in the US. For example, red foxes (Vulpes vulpes) are predators of B. microti reservoirs, but fox numbers are decreasing in many areas due to the expansion of coyotes (Canis latrans) (Levi et al., 2012). Additional work on the importance of predator-prey dynamics would be particularly interesting. In malaria-endemic regions (e.g., South America and Africa), diagnosis of babesiosis is complicated. In fact, cases in the United States, India, Spain, and Korea were initially diagnosed as malaria and babesiosis was only suspected after treatment failure occurred or after blood smears were carefully screened (Western et al., 1970, Olmeda et al., 1997, Marathe et al., 2005, Kim et al., 2007). However, exposure to Babesia in some of these areas appears to be common, based on the limited serologic studies that have been conducted. In both South America and Africa, PCR-based studies with sequence analysis are needed to identify the causative agents of human babesiosis so the surveillance of potential reservoirs and vectors can be conducted. Additionally, the use of PCR assays and/or restriction enzyme assays that distinguish Babesia from Plasmodium may help to determine the true prevalence of human babesiosis in malaria-endemic areas. In conclusion, numerous Babesia species have been identified as zoonotic, but for many of them, formal descriptions including molecular phylogeny, serological reactivity, and morphologic description are lacking. Importantly, as useful as molecular characterization has become for distinguishing Babesia, it is imperative that morphologic and serologic data as well as natural history data (e.g., reservoir host(s) and vector(s)) be investigated because these data are critical to understanding the epidemiology of the pathogens. Surveillance of mammals, birds, and questing ticks are needed, especially in areas where undescribed parasites are emerging, so that genetic sequences can be obtained for future comparison with human cases. Also, continued surveillance of ticks is needed to understand where changes in density and distribution or introductions of new species into naïve areas are occurring. With these data in place, novel human babesiosis agents can be quickly identified and more focused surveillance, public education, and management plans can be implemented.
  210 in total

Review 1.  An overview of the Babesia, Plasmodium and Theileria genomes: a comparative perspective.

Authors:  Audrey O T Lau
Journal:  Mol Biochem Parasitol       Date:  2008-12-06       Impact factor: 1.759

2.  Babesia microti-like parasites detected in Eurasian red squirrels (Sciurus vulgaris orientis) in Hokkaido, Japan.

Authors:  Masayoshi Tsuji; Aya Zamoto; Takako Kawabuchi; Tomomi Kataoka; Rui Nakajima; Mitsuhiko Asakawa; Chiaki Ishihara
Journal:  J Vet Med Sci       Date:  2006-07       Impact factor: 1.267

Review 3.  Feline babesiosis.

Authors:  Ashley L Ayoob; Jennifer Prittie; Susan G Hackner
Journal:  J Vet Emerg Crit Care (San Antonio)       Date:  2010-02

4.  Diverse Borrelia burgdorferi strains in a bird-tick cryptic cycle.

Authors:  Sarah A Hamer; Graham J Hickling; Jennifer L Sidge; Michelle E Rosen; Edward D Walker; Jean I Tsao
Journal:  Appl Environ Microbiol       Date:  2011-01-21       Impact factor: 4.792

Review 5.  Human babesiosis: an emerging tick-borne disease.

Authors:  A M Kjemtrup; P A Conrad
Journal:  Int J Parasitol       Date:  2000-11       Impact factor: 3.981

6.  Detection of Babesia Sp. EU1 and members of spotted fever group rickettsiae in ticks collected from migratory birds at Curonian Spit, North-Western Russia.

Authors:  Alexandru Movila; Anna L Reye; Helen V Dubinina; Oleg O Tolstenkov; Ion Toderas; Judith M Hübschen; Claude P Muller; Andrey N Alekseev
Journal:  Vector Borne Zoonotic Dis       Date:  2010-06-16       Impact factor: 2.133

7.  Prevalence of Borrelia burgdorferi and Babesia microti in mice on islands inhabited by white-tailed deer.

Authors:  J F Anderson; R C Johnson; L A Magnarelli; F W Hyde; J E Myers
Journal:  Appl Environ Microbiol       Date:  1987-04       Impact factor: 4.792

8.  The molecular evidence of Babesia microti infection in small mammals collected in Slovenia.

Authors:  D Duh; M Petrovec; T Trilar; T Avsic-Zupanc
Journal:  Parasitology       Date:  2003-02       Impact factor: 3.234

9.  Diversity of Babesia infecting deer ticks (Ixodes dammini).

Authors:  P M Armstrong; P Katavolos; D A Caporale; R P Smith; A Spielman; S R Telford
Journal:  Am J Trop Med Hyg       Date:  1998-06       Impact factor: 2.345

Review 10.  Piroplasmids and ticks: a long-lasting intimate relationship.

Authors:  Monica Florin-Christensen; Leonhard Schnittger
Journal:  Front Biosci (Landmark Ed)       Date:  2009-01-01
View more
  79 in total

1.  Human Babesiosis: Pathogens, Prevalence, Diagnosis and Treatment.

Authors:  Rosalynn Louise Ord; Cheryl A Lobo
Journal:  Curr Clin Microbiol Rep       Date:  2015-09-28

2.  A survey of hemoparasites and ectoparasites in Nasua nasua Linnaeus, 1766 with a redescription of Hepatozoon procyonis Richards, 1961 based on morphological and molecular data.

Authors:  Maria Regina Lucas da Silva; Felipe Fornazari; Thiago Fernandes Martins; Alícia Giolo Hippólito; Luna Scarpari Rolim; Jacqueline Muniz Bisca; Carlos Roberto Teixeira; Lucia Helena O'Dwyer
Journal:  Parasitol Res       Date:  2018-05-07       Impact factor: 2.289

3.  Redescription of Babesia ardeae Toumanoff, 1940, a parasite of Ardeidae, including molecular characterization.

Authors:  J -M Chavatte; C Okumura; I Landau
Journal:  Parasitol Res       Date:  2017-02-03       Impact factor: 2.289

4.  Half a century after its discovery, new insights on Anthemosoma garnhami (Sporozoa, Piroplasmida): morphology, molecular characterisation and phylogenetic position.

Authors:  Jean-Marc Chavatte; Grégory Karadjian; Irène Landau
Journal:  Parasitol Res       Date:  2018-10-15       Impact factor: 2.289

5.  Prevalence and phylogenetic analysis of Babesia spp. in Ixodes ricinus and Ixodes persulcatus ticks in Latvia.

Authors:  Valentina Capligina; Inese Berzina; Antra Bormane; Ineta Salmane; Karlis Vilks; Alisa Kazarina; Dace Bandere; Viesturs Baumanis; Renate Ranka
Journal:  Exp Appl Acarol       Date:  2016-03       Impact factor: 2.132

6.  Immune Response of Mice Against Babesia canis Antigens is Enhanced When Antigen is Coupled to Gold Nanoparticles.

Authors:  S A Staroverov; A S Fomin; S V Kozlov; A A Volkov; E S Kozlov; K P Gabalov; L A Dykman
Journal:  Acta Parasitol       Date:  2020-11-09       Impact factor: 1.440

7.  Molecular investigation of vector-borne parasites in wild micromammals, Barcelona (Spain).

Authors:  Javier Millán
Journal:  Parasitol Res       Date:  2018-06-25       Impact factor: 2.289

8.  Identification of the Babesia-responsive leucine-rich repeat domain-containing protein from the hard tick Haemaphysalis longicornis.

Authors:  Hiroki Maeda; Koshi Kurisu; Takeshi Miyata; Kodai Kusakisako; Remil Linggatong Galay; Talactac Melbourne Rio; Masami Mochizuki; Kozo Fujisaki; Tetsuya Tanaka
Journal:  Parasitol Res       Date:  2015-02-19       Impact factor: 2.289

9.  The first molecular detection of a Theileria-like species (Apicomplexa: Piroplasmida) in Meriones persicus from western Iran.

Authors:  Farnaz Kheirandish; Mohammad Hassan Kayedi; Ehsan Mostafavi; Seyedeh Zeinab Hosseini; Arian Karimi Rouzbahani; Asadollah Hosseini-Chegeni
Journal:  J Parasit Dis       Date:  2019-11-28

10.  Effects of treatment with the anti-parasitic drug diminazene aceturate on antioxidant enzymes in rat liver and kidney.

Authors:  Matheus D Baldissera; Ricardo A Gonçalves; Michele R Sagrillo; Thirssa H Grando; Camila S Ritter; Fabielly S Grotto; Gerson F Brum; Sônia C A da Luz; Sergio O Silveira; Viviane P Fausto; Aline A Boligon; Rodrigo A Vaucher; Lenita M Stefani; Aleksandro S da Silva; Carine F Souza; Silvia G Monteiro
Journal:  Naunyn Schmiedebergs Arch Pharmacol       Date:  2016-01-26       Impact factor: 3.000

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.