Literature DB >> 24520561

Rapidly fatal hemorrhagic pneumonia and group A Streptococcus serotype M1.

Maria Santagati, Teresa Spanu, Marina Scillato, Rosaria Santangelo, Fabio Cavallaro, Vincenzo Arena, Giacomo Castiglione, Marco Falcone, Mario Venditti, Stefania Stefani.   

Abstract

We report 3 cases of fulminant hemorrhagic pneumonia in previously health patients. Sudden-onset hemoptysis and dyspnea developed; all 3 patients and died <12 h later of massive pulmonary bleeding, despite aggressive supportive care. Postmortem analysis showed that the illnesses were caused by group A Streptococcus emm1/sequence type 28 strains.

Entities:  

Mesh:

Year:  2014        PMID: 24520561      PMCID: PMC3884710          DOI: 10.3201/eid2001.130233

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Streptococcus pyogenes or group A Streptococcus (GAS) is a versatile pathogen that can cause serious diseases, including bacteremia, cellulitis, puerperal sepsis, meningitis, pneumonia, and necrotizing fasciitis (,). This pathogen also causes streptococcal toxic shock syndrome, a severe response to streptococcal pyrogenic exotoxins (Spe proteins), which trigger overproduction of inflammatory cytokines, leading to tissue damage, organ failure, and shock (,). Despite improved awareness and treatment, GAS infections remain among the top 10 infectious causes of fatal disease in humans (). Periodic resurgences of invasive GAS infections in industrialized countries have been linked to emergence of dominant GAS clones resulting from horizontal gene transfer (–). The ability of these clones to cause life-threatening disease in healthy persons probably depends on expression of virulence factors that facilitate penetration of host cell barriers and evasion of immune defenses (,,). More than 250 GAS types have been identified in sequencing studies of the hypervariable region of the emm gene, which encodes the M surface protein (,). The emm types seem to correlate with tissue tropism of the organism, and M protein augments GAS virulence by interfering with antibody and complement deposition, facilitating formation of microcolonies and neutralizing antimicrobial peptides, and stimulating proinflammatory and procoagulatory activities (,). M1 protein and M1 fragments released by neutrophil proteases can also provoke pulmonary hemorrhage, inflammation, and tissue destruction by their interaction with fibrinogen, which causes neutrophils to release heparin-binding protein, a mediator of vascular leakage (). The hypervirulent emm1 GAS clone also harbors prophages encoding SpeA proteins and extracellular streptodornase D (Sda1), which can also enhance virulence and dissemination (,). We report 3 cases of rapidly fatal, hemorrhagic pneumonia in previously healthy patients that were determined to be caused by infection with hypervirulent GAS.

The Study

Patient 1 was a 74-year-old Italian man who came to the emergency department (ED) of Vittorio Emanuele Hospital in Catania, Italy, in July 2012. Patient 2 was 65-year-old German woman who arrived in Rome from Frankfurt in March 2011 and came directly from the airport to the ED of the University of Rome Medical Center. Patient 3 was a 40-year-old Japanese man who came to the ED of the Catholic University Medical Center in Rome in February 2012, 3 days after arriving in the city. All 3 patients had sudden-onset hemoptysis, dyspnea, and fever (temperature 37.5–38.5°C), which had rapidly worsened over 2–3 h. Their medical histories were unremarkable. All 3 patients had acute respiratory failure requiring ventilator support and hemoconcentration; hyponatremia; increased levels of serum creatinine, lactate dehydrogenase, lactic acid, and brain natriuretic peptides; leukocytosis (7,000–8,000 cells/mm3, 3,200–4,000 neutrophils); and increased levels of C-reactive protein (>400 mg/mL) and d-dimer (>2,000 μg/mL). Computed tomography of the chest showed patchy opacification throughout the lungs and multifocal confluent parenchymal opacities (Figure, panel A). Bronchoalveolar lavages were bright red and contained numerous erythrocytes, gram-positive cocci resembling streptococci, and no polymorphonuclear leukocytes. In spite of aggressive supportive care and empirical therapy with ceftriaxone (2 g intravenously) and levofloxacin (500 mg intravenously), the conditions of the patients deteriorated rapidly, and all 3 died of massive pulmonary hemorrhage ≤12 h after symptom onset.
Figure

A) Computed tomographic image of the chest of a 74-year-old patient (patient 1) with fatal hemorrhagic pneumonia, Catania, Italy, showing multifocal confluent parenchymal opacities. B) Postmortem view of the lungs showing hemorrhage and edema. C) Microscopic evidence of necrosis and bacteria in the lungs (original magnification ×40).

A) Computed tomographic image of the chest of a 74-year-old patient (patient 1) with fatal hemorrhagic pneumonia, Catania, Italy, showing multifocal confluent parenchymal opacities. B) Postmortem view of the lungs showing hemorrhage and edema. C) Microscopic evidence of necrosis and bacteria in the lungs (original magnification ×40). Autopsy specimens showed bilateral hemorrhagic pleural effusions (1,500–2,000 cells/mL), heavy, blood-engorged lungs (1,600–1,700 g), and patent hilar structures, but no thoracic or abdominal lymphadenopathy. Lungs showed hemorrhage and edema (Figure, panel B). Microscopic analysis of the lungs showed necrosis and bacteria (Figure, panel C). Admission blood cultures (3 sets/patient) were positive at the 12-h reading. S. pyogenes was identified by using matrix-assisted laser desorption ionization–time-of-flight mass spectrometry (Bruker Daltonik, Breman, Germany) and isolated in all culture bottles, bronchoalveolar lavage cultures (pure colonies, 106 CFU/mL), and postmortem lung tissue cultures. All isolates were susceptible to erythromycin, tetracycline, amoxicillin, penicillin, and clindamycin by Etest (bioMérieux, Marcy l’Etoile, France). Results were interpreted according to European Committee on Antimicrobial Susceptibility Testing breakpoints (www.eucast.org/clinical_breakpoints). Results of testing for urinary Legionella pneumophila and S. pneumoniae antigens, β-glucan, galactomannan, and HIV and toxicology panels were negative for all 3 patients. Commercially available PCRs for respiratory tract samples showed negative results for major respiratory viruses and bacterial pathogens. Antibody titers against streptolysin O were <200 IU. The emm typing, which was performed by PCR using protocols and the database of the Centers for Disease Control and Prevention (Atlanta, GA, USA; www.cdc.gov/ncidod/biotech/strep/M-ProteinGene_typing.htm), showed that all 3 GAS strains were emm-type 1 and had identical sequences at the 5ʹ end of the emm gene, indicative of the emm 1.0 allele. Strains were tested for multiple virulence genes (Table) by using PCR and primers described elsewhere () or designed with the VectorNTI program (Invitrogen, Carlsbad, CA, USA). They were identical in terms of the spe genotype (speA+, speB+, speC–, speG+, speI–, speJ+, smeZ+, ssa–); the presence of SLO, sagA, sagBC, and sda1 genes; and the absence of PAM, prtF, and sof genes. Multilocus sequence typing was performed as described (http://spyogenes.mlst.net/) and showed an identical sequence type (ST) (ST28/CC28) for the isolates from patients 1 and 3 and a new single-locus variant of ST28 (designated ST648) for the isolate from patient 2. All cases were caused by GAS strains harboring the emm1.0 allele and Sda1, smeZ, speA, speB, speG, and speJ genes.
Table

Primers used for identification of virulence genes by PCR for group C Streptococcus isolates*

GenePrimer name†Primer sequence, 5′→3′Amplicon size, bp
Slo MS442GGTAACCTTGTTACTGCTAATGCTGA400
MS443TAATGGAAATATCGACTGGTGTAGTG‡400
speA speA-fwCTCAACAAGACCCCGATCCAAG500
speA-rewATTTAGAAGGTCCATTAGTATATAGTTGC‡500
speB MS384GGCATGTCCGCCTACTTTACCGA800
MS385CAGGTGCACGAAGCGCAGAAG‡800
speC MS410TACTGATTTCTACTATTTCACCTATCATC447
MS411TCTGATTTTAAAGTCAATTTCCTGG‡447
speG MS412GCTATGGAAGTCAATTAGCTTATGCAG448
MS413CCGATGTATAACGCGATTCCGA‡448
speI speI-upGGTCCGCCATTTTCAGGTAGTTT516
speI-rewACGCATACGAAATCATACCAGTAG‡516
speJ MS414CACTCCTTGTACTAGATGAGGTTGC508
MS415ACGCATACGAAATCATACCAGTAG‡508
sagBC sagBC-fwGCAGCTAGTTGCTCAACATTTAATG600
sagBC sagBC-rewCATAGGCAGTCGCCTGATTCC‡600
prtF MS400CGGAGTATCAGTAGGACATGCGGA882
prtF MS401CTCCCACCAACATTGCTTAATCCA‡882
PAM PAM-fwGCAGACGACGCTAGAAATGAAGTA900
PAM-rewCCTGCTTGTGGTGCTTGACCTTTAC‡900
Sof MS402ATGCCTGGTTGGGTATCTTCGGT406
MS403AGAGAACAAAACGTTCTGCGCCTA‡406
Ssa ssa-fwGTAGTCAGCCTGACCCTACTCCAGAAC621
ssa-rewACTGATCAAATATTGCTGCAGGTGC‡621
sda1 MS431GGGTCTATAAGAAAAGTGGGCAAAG439
MS432TGATCGTAAAGGTGGGATGCAGTA‡439

*slo, streptolysin O; sagA/BC, streptolysin S-associated gene A protein; smeZ-2 mitogenic exotoxin Z; speA, streptococcal pyrogenic toxin A; speB, streptococcal cysteine protease; speC, streptococcal pyrogenic toxin C; speG, streptococcal pyrogenic toxin G; speI, streptococcal pyrogenic toxin I; speJ; streptococcal pyrogenic toxin J; prtF, fibronectin-binding protein; PAM, plasminogen-binding protein; sof serum opacity factor; ssa streptococcal superantigen; sda1, streptodornase D.
†Primers indicated in boldface were created with the VectorNT program (Invitrogen, Carlsbad, CA, USA). Other primers were described by Santagati et al. ().
‡Reverse primers.

*slo, streptolysin O; sagA/BC, streptolysin S-associated gene A protein; smeZ-2 mitogenic exotoxin Z; speA, streptococcal pyrogenic toxin A; speB, streptococcal cysteine protease; speC, streptococcal pyrogenic toxin C; speG, streptococcal pyrogenic toxin G; speI, streptococcal pyrogenic toxin I; speJ; streptococcal pyrogenic toxin J; prtF, fibronectin-binding protein; PAM, plasminogen-binding protein; sof serum opacity factor; ssa streptococcal superantigen; sda1, streptodornase D.
†Primers indicated in boldface were created with the VectorNT program (Invitrogen, Carlsbad, CA, USA). Other primers were described by Santagati et al. ().
‡Reverse primers.

Conclusions

A total of 1.3%–23.8% invasive GAS infections involve pneumonia, but these infections are more common in developing countries (,,,). Successful management depends on early diagnosis and initiation of effective treatment (,). However, despite early aggressive supportive care and empirical antimicrobial drug therapy, which was later confirmed to be appropriate by antibiogram results, all 3 patients we describe died within 8–12 h of symptom onset from massive pulmonary bleeding and acute respiratory failure. Initial presentations were fairly nonspecific, and diagnoses were made postmortem. The roles of GAS in the rapid progression of disease were highlighted by the abundance of GAS found the lungs, extensive and severe pulmonary damage, and virulence factor profiles of the isolates, all of which included sda1, smeZ, speA, speB, speG, speJ, and emm-1 genes (,). Invasive bacterial disease requires virulence factors that facilitate interactions of the microbe with host tissues and subvert defenses of the immune system. In the emm1 GAS clone, progression to systemic infection is also favored by mutations in the 2-component control of virulence regulatory system, which enhances resistance to subepithelial immune defenses and facilitates deep-tissue penetration. These mutations markedly alter transcription profiles of invasive GAS isolates than those of pharyngeal mucosal isolates (–,), strongly upregulating sda1 transcription and markedly downregulating expression of the gene encoding cysteine protease SpeB (–). The sda1 gene facilitates avoidance of neutrophil extracellular traps by the pathogen and serves as a selective force for a control of virulence regulatory system mutation (,). SpeB protease enables accumulation and activation of broad-spectrum host protease plasmin on the microbial cell surface, thereby promoting infection spread to normally sterile sites (,,). Invasive GAS strains also produce increased levels of toxins, including some that destroy immune cells, and superantigens (e.g., SpeA, SpeJ) that dysregulate the immune response of the host (). Host factors also affect clinical presentation and disease progression, which explains why diseases of different severity can be caused by genetically indistinguishable emm1 strains with no evidence of regulatory gene mutation (,,). Elucidation of these host and bacterial factors involved in the pathogenesis of these rare but life-threatening infections may be useful for improving disease prognosis ().
  14 in total

1.  Evolutionary origin and emergence of a highly successful clone of serotype M1 group a Streptococcus involved multiple horizontal gene transfer events.

Authors:  Paul Sumby; Steve F Porcella; Andres G Madrigal; Kent D Barbian; Kimmo Virtaneva; Stacy M Ricklefs; Daniel E Sturdevant; Morag R Graham; Jaana Vuopio-Varkila; Nancy P Hoe; James M Musser
Journal:  J Infect Dis       Date:  2005-07-29       Impact factor: 5.226

Review 2.  The epidemiology of severe Streptococcus pyogenes associated disease in Europe.

Authors:  T L Lamagni; A Efstratiou; J Vuopio-Varkila; A Jasir; C Schalén
Journal:  Euro Surveill       Date:  2005-09

3.  Inverse relation between disease severity and expression of the streptococcal cysteine protease, SpeB, among clonal M1T1 isolates recovered from invasive group A streptococcal infection cases.

Authors:  R G Kansal; A McGeer; D E Low; A Norrby-Teglund; M Kotb
Journal:  Infect Immun       Date:  2000-11       Impact factor: 3.441

4.  M protein, a classical bacterial virulence determinant, forms complexes with fibrinogen that induce vascular leakage.

Authors:  Heiko Herwald; Henning Cramer; Matthias Mörgelin; Wayne Russell; Ulla Sollenberg; Anna Norrby-Teglund; Hans Flodgaard; Lennart Lindbom; Lars Björck
Journal:  Cell       Date:  2004-02-06       Impact factor: 41.582

5.  DNase Sda1 provides selection pressure for a switch to invasive group A streptococcal infection.

Authors:  Mark J Walker; Andrew Hollands; Martina L Sanderson-Smith; Jason N Cole; Joshua K Kirk; Anna Henningham; Jason D McArthur; Katrin Dinkla; Ramy K Aziz; Rita G Kansal; Amelia J Simpson; John T Buchanan; Gursharan S Chhatwal; Malak Kotb; Victor Nizet
Journal:  Nat Med       Date:  2007-07-15       Impact factor: 53.440

6.  DNase Sda1 allows invasive M1T1 Group A Streptococcus to prevent TLR9-dependent recognition.

Authors:  Satoshi Uchiyama; Federica Andreoni; Reto A Schuepbach; Victor Nizet; Annelies S Zinkernagel
Journal:  PLoS Pathog       Date:  2012-06-14       Impact factor: 6.823

Review 7.  Invasive group a streptococcal disease: epidemiology, pathogenesis and management.

Authors:  Andrew C Steer; Theresa Lamagni; Nigel Curtis; Jonathan R Carapetis
Journal:  Drugs       Date:  2012-06-18       Impact factor: 9.546

8.  [Histological diagnosis of lung bacterial necrotizing infections: a study of four fulminant cases].

Authors:  Sandra Lassalle; Véronique Hofman; Catherine Butori; Dominique Sicard; Paul Hofman
Journal:  Ann Pathol       Date:  2005-10       Impact factor: 0.407

9.  Group A streptococci clones associated with invasive infections and pharyngitis in Portugal present differences in emm types, superantigen gene content and antimicrobial resistance.

Authors:  Ana Friães; Francisco R Pinto; Catarina Silva-Costa; Mario Ramirez; José Melo-Cristino
Journal:  BMC Microbiol       Date:  2012-11-27       Impact factor: 3.605

10.  Molecular analysis of an outbreak of lethal postpartum sepsis caused by Streptococcus pyogenes.

Authors:  Claire E Turner; Matthew Dryden; Matthew T G Holden; Frances J Davies; Richard A Lawrenson; Leili Farzaneh; Stephen D Bentley; Androulla Efstratiou; Shiranee Sriskandan
Journal:  J Clin Microbiol       Date:  2013-04-24       Impact factor: 5.948

View more
  6 in total

Review 1.  Respiratory Infections in the U.S. Military: Recent Experience and Control.

Authors:  Jose L Sanchez; Michael J Cooper; Christopher A Myers; James F Cummings; Kelly G Vest; Kevin L Russell; Joyce L Sanchez; Michelle J Hiser; Charlotte A Gaydos
Journal:  Clin Microbiol Rev       Date:  2015-07       Impact factor: 26.132

2.  A Pediatric Case of Diffuse Alveolar Hemorrhage Secondary to Poststreptococcal Glomerulonephritis.

Authors:  Alison Markland; Gregory Hansen; Anke Banks; Rajni Chibbar; Darryl Adamko
Journal:  Case Rep Crit Care       Date:  2017-12-20

3.  Hemorrhagic pneumonia and upper lobe pulmonary cavitary lesion caused by Streptococcus pyogenes.

Authors:  Gayatri B Nair; Harish Gopalakrishna; Ricardo Conti
Journal:  J Community Hosp Intern Med Perspect       Date:  2021-03-23

4.  Streptococcus pyogenes Pneumonia in Adults: Clinical Presentation and Molecular Characterization of Isolates 2006-2015.

Authors:  Esther Tamayo; Milagrosa Montes; Diego Vicente; Emilio Pérez-Trallero
Journal:  PLoS One       Date:  2016-03-30       Impact factor: 3.240

5.  Clinical implications and characterization of Group A Streptoccoccus infections in adults with cystic fibrosis.

Authors:  Kate Skolnik; Austin Nguyen; Ranjani Somayaji; Christina S Thornton; Barbara Waddell; Michael G Surette; Harvey R Rabin; Michael D Parkins
Journal:  BMC Pulm Med       Date:  2015-12-12       Impact factor: 3.317

6.  How a mild influenza B infection can kill: A case of pulmonary hemorrhage.

Authors:  Nathalie Abi Hatem; Sabrina Campbell; Deepa Kuchelan; Jennifer Bowers; Edmundo Rubio
Journal:  Lung India       Date:  2017 Sep-Oct
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.