Literature DB >> 24515895

Galectin-7 as a potential predictive marker of chemo- and/or radio-therapy resistance in oral squamous cell carcinoma.

Sho Matsukawa1, Kei-ichi Morita, Ayako Negishi, Hiroyuki Harada, Yusuke Nakajima, Hiroaki Shimamoto, Hirofumi Tomioka, Kae Tanaka, Masaya Ono, Tesshi Yamada, Ken Omura.   

Abstract

Treatment of advanced oral squamous cell carcinoma (OSCC) requires the integration of multimodal approaches. The aim of this study was to identify predictors of tumor sensitivity to preoperative radiotherapy/chemotherapy for OSCC in order to allow oncologists to determine optimum therapeutic strategies without the associated adverse effects. Here, the protein expression profiles of formalin-fixed paraffin-embedded (FFPE) tissue samples from 18 OSCC patients, termed learning cases, who received preoperative chemotherapy and/or radiotherapy followed by surgery were analyzed by quantitative proteomics and validated by immunohistochemistry in 68 test cases as well as in the 18 learning cases. We identified galectin-7 as a potential predictive marker of chemotherapy and/or radiotherapy resistance, and the sensitivity and specificity of the galectin-7 prediction score (G7PS) in predicting this resistance was of 96.0% and 39.5%, respectively, in the 68 test cases. The cumulative 5-year disease-specific survival rate was 75.2% in patients with resistant prediction using G7PS and 100% in patients with sensitive prediction. In vitro overexpression of galectin-7 significantly decreased cell viability in OSCC cell line. Therefore, our findings suggest that galectin-7 is a potential predictive marker of chemotherapy and/or radiotherapy resistance in patients with OSCC.
© 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Entities:  

Keywords:  Formalin-fixed paraffin-embedded; galectin-7; liquid chromatography and mass spectrometry; oral squamous cell carcinoma

Mesh:

Substances:

Year:  2014        PMID: 24515895      PMCID: PMC3987084          DOI: 10.1002/cam4.195

Source DB:  PubMed          Journal:  Cancer Med        ISSN: 2045-7634            Impact factor:   4.452


Introduction

Oral cancer is the sixth most common cancer worldwide, with an annual incidence of ∼275,000 cases. However, unlike many other cancers, the incidence of oral cancer is increasing 1. In Japan, the number of patients diagnosed with oral cancer was 2100 in 1975 and 6900 in 2005, and this number is estimated to increase to 7800 by 2015, when it will represent 1% of all cancer cases and approximately 40% of all head and neck cancer cases 2. Histopathologically, squamous cell carcinoma (SCC) is the most common cancer of the oral cavity, accounting for >90% of all oral cancer cases. Despite recent improvements in multimodal therapies, the survival rate of these patients remains poor because of frequent locoregional and/or distant recurrences. These statistics highlight the urgent need for treatment alternatives 3. Treatment of advanced head and neck SCC requires the integration of multimodal approaches. Interest in neoadjuvant chemotherapy has recently regenerated because of its survival benefits, particularly when a taxanecisplatinfluorouracil regimen is applied instead of the standard cisplatinfluorouracil regimen 4–6. Usually, tumor response to neoadjuvant chemotherapy predicts its response to radiotherapy. The prognostic indicators of favorable outcome would allow oncologists to make a more rational selection of therapeutic strategies without the unnecessary toxicities of neoadjuvant chemotherapy. Over the past decade, gene expression in oral SCC (OSCC) has been studied extensively using microarray techniques. However, gene expression is not always correlated with the level of expression of the corresponding protein 7. Furthermore, although the use of fresh material is required for most analytical approaches, human tissue samples are not always available in sufficient quantity. As an alternative, formalin-fixed paraffin-embedded (FFPE) tissue blocks can be routinely collected and stored as samples for research purposes after pathological diagnosis. A method of extracting proteins from FFPE tissues in the form of tryptic peptides was recently developed, and the methodology is compatible with a variety of mass spectrometry (MS)-based proteomics 8. This study aimed to identify potential predictive markers of chemotherapy and/or radiotherapy resistance in patients with OSCC using quantitative proteomic analysis of FFPE biopsy tissues.

Patients and Methods

Patients

This retrospective study included 86 patients diagnosed with resectable OSCC and treated at the Tokyo Medical and Dental University Hospital Faculty of Dentistry (TMDU, Tokyo, Japan) between January 2001 and December 2011 (Table 1). The diagnosis was confirmed by histological examination of tissue biopsies surgically removed from the center of the cancerous tissue. The FFPE samples were fixed in formalin, embedded in paraffin, and stored at room temperature. Thereafter, all patients received preoperative chemotherapy and/or radiotherapy, followed by surgical primary tumor resection with or without neck dissection. After the chemotherapy and/or radiotherapy, treatment outcome was evaluated using the response evaluation criteria in the solid tumors (RECIST) guidelines. Cases of progressive disease (PD) or stable disease (SD) were assigned to the resistant group (Group R), whereas those who achieved a partial response (PR) or complete response (CR) were assigned to the sensitive group (Group S). This protocol was reviewed and approved by the Ethics Committee Board of the TMDU.
Table 1

Clinical characteristics and expression profile of galectin-7.

Patient no.CaseGroupGenderAgePrimary siteDifferentiationTNStageG7SG7NLPrediction scorePre C/RResponse to therapy
1LearningGroup RF61MandibulaGrade 2T4N14A292−2.78PF + S/RNC
2LearningGroup RM60Maxillary sinusGrade 3T3N2c4C00−1.97P/RNC
3LearningGroup RM50Floor of mouthGrade 2T3N2b4A45.52−1.82S/RNC
4LearningGroup RM57TongueGrade 1T2N1348.42−1.65S/RNC
5LearningGroup RM79TongueGrade 2T3N1348.42−1.65S/RNC
6LearningGroup RM32TongueGrade 1T2N2b4A31.51−1.38S/RNC
7LearningGroup RM57TongueGrade 1T3N2b4A57.72−1.10PF + S/RPD
8LearningGroup RM68MandibulaGrade 2T4N2b4A44.91−0.61PFNC
9LearningGroup RM47TongueGrade 2T2N0246.61−0.51PFNC
10LearningGroup SM72Floor of mouthGrade 2T3N2c4A72.52−0.25S/RPR
11LearningGroup SM50TongueGrade 1T2N0234.600.04SPR
12LearningGroup SM82TongueGrade 1T2N0256.810.09SPR
13LearningGroup SM59TongueGrade 2T3N0361.601.61S/RPR
14LearningGroup SM61TongueGrade 1T2N0266.501.90SPR
15LearningGroup SM68Lower gingivaGrade 1T2N0266.601.90S/RPR
16LearningGroup SM76Lower gingivaGrade 1T2N2b4A78.702.60SPR
17LearningGroup SM29TongueGrade 2T2N0280.402.70S/RPR
18LearningGroup SM53Lower gingivaGrade 1T2N1383.302.87SPR
19TestGroup RM58MandibulaGrade 2T4N2b4A24.12−3.06SNC
20TestGroup RM70Floor of mouthGrade 2T2N2c4A4.531−2.95RNC
21TestGroup RM57Maxillary sinusGrade 2T4N14B11.41−2.55P/RNC
22TestGroup RF66Maxillary sinusGrade 2T3N2b4A12.71−2.47S/RNC
23TestGroup RM45TongueGrade 3T3N2b4A34.42−2.46PFNC
24TestGroup RM60TongueGrade 2T4N2c4A35.32−2.41SNC
25TestGroup RF81Lower gingivaGrade 3T4N04A16.61−2.25RNC
26TestGroup RF72Buccal mucosaGrade 1T4N2b4A00−1.97RNC
27TestGroup RM67Upper gingivaGrade 3T2N130.60−1.93SNC
28TestGroup RM53Soft palateGrade 3T4N14A8.140−1.50RNC
29TestGroup RM59Buccal mucosaGrade 2T4N2b4A31.61−1.38RNC
30TestGroup RM53MandibulaGrade 1T4N2b4A33.41−1.27RNC
31TestGroup RM68MandibulaGrade 2T4N2b4A56.12−1.20SNC
32TestGroup RF54TongueGrade 2T2N2b4A371−1.06SNC
33TestGroup RF52Lower gingivaGrade 2T4N2c4A60.82−0.93SNC
34TestGroup RM61Retromolar trigoneGrade 1T4N14A40.71−0.85SNC
35TestGroup RM41TongueGrade 3T2N2c4A20.20−0.79RNC
36TestGroup RM66MandibulaGrade 1T4N2b4A431−0.72SNC
37TestGroup RM74Lower gingivaGrade 2T4N2b4A682−0.51SNC
38TestGroup RM69TongueGrade 2T3N2b4A25.80−0.47PFNC
39TestGroup RM57MandibulaGrade 1T4N04A31.80−0.12RNC
40TestGroup RM64TongueGrade 2T3N2c4A752−0.10PFNC
41TestGroup RM62MaxilaGrade 2T4N14A330−0.05S/RNC
42TestGroup RM57TongueGrade 2T2N0233.10−0.04S/RNC
43TestGroup RM64TongueGrade 2T3N2b4A72.410.99SNC
44TestGroup SM57Maxillary sinusGrade 2T3N030.72−4.42P/RPR
45TestGroup SM52Lower gingivaGrade 2T2N2b4A1.352−4.38S/RPR
46TestGroup SM55TongueGrade 3T3N2b4A6.631−2.83PFPR
47TestGroup SM74Upper gingivaGrade 3T4N2b4A9.941−2.64S/RPR
48TestGroup SM62TongueGrade 3T3N0310.91−2.58S/RPR
49TestGroup SM71Buccal mucosaGrade 3T3N2b4B39.92−2.14PFPR
50TestGroup SF76Upper gingivaGrade 2T4N04A00−1.97S/RPR
51TestGroup SF52TongueGrade 3T3N032.10−1.85S/RPR
52TestGroup SM50TongueGrade 1T2N026.20−1.61S/RPR
53TestGroup SM49TongueGrade 2T3N1327.91−1.60PFPR
54TestGroup SM48Lower gingivaGrade 1T4N04A31.11−1.41S/RPR
55TestGroup SM62Lower gingivaGrade 2T3N2b4A33.11−1.29S/RPR
56TestGroup SM58Floor of mouthGrade 2T2N2c4A11.90−1.28RPR
57TestGroup SM61Upper gingivaGrade 3T4N04A12.20−1.26P/RPR
58TestGroup SM59Floor of mouthGrade 2T4N2c4A33.71−1.26PFPR
59TestGroup SF67TongueGrade 2T2N2c4A34.81−1.19PFPR
60TestGroup SF64Upper gingivaGrade 2T3N0337.11−1.06S/RPR
61TestGroup SM58Lower gingivaGrade 2T3N13592−1.03S/RPR
62TestGroup SM54Lower gingivaGrade 2T2N2b4A16.70−1.00S/RPR
63TestGroup SM69TongueGrade 2T3N0320.80−0.76S/RPR
64TestGroup SM65TongueGrade 1T3N0326.50−0.43PFPR
65TestGroup SF40TongueGrade 2T2N2b4A27.90−0.35S/RPR
66TestGroup SM54Lower gingivaGrade 2T4N04A28.30−0.32RPR
67TestGroup SM55TongueGrade 1T3N1330.90−0.18S/RPR
68TestGroup SM59Floor of mouthGrade 2T2N0252.31−0.17S/RPR
69TestGroup SM67Floor of mouthGrade 2T4N14A31.10−0.16S/RPR
70TestGroup SF64Lower gingivaGrade 1T4N14A35.600.10S/RPR
71TestGroup SM65TongueGrade 1T3N138020.19PFPR
72TestGroup SM66Floor of mouthGrade 2T3N0360.710.31PFPR
73TestGroup SM65Retromolar trigoneGrade 2T2N0241.400.44RPR
74TestGroup SM75Upper gingivaGrade 3T4N2c4A41.400.44S/RPR
75TestGroup SF62MaxilaGrade 1T4N04A42.600.51PF/RPR
76TestGroup SF52TongueGrade 2T2N0243.100.53S/RPR
77TestGroup SM59TongueGrade 1T3N2c4A4700.76RPR
78TestGroup SM48TongueGrade 2T3N2b4A51.501.03PFPR
79TestGroup SM62Buccal mucosaGrade 2T2N0252.801.10S/RPR
80TestGroup SF46TongueGrade 2T3N0354.301.18S/RPR
81TestGroup SM45Lower gingivaGrade 1T4N14A54.401.19S/RPR
82TestGroup SM45Floor of mouthGrade 1T2N0255.201.24S/RCR
83TestGroup SM56TongueGrade 3T3N0355.901.28S/RPR
84TestGroup SF62Lower GingivaGrade 2T3N0360.201.53RPR
85TestGroup SM58Soft palateGrade 2T3N0369.902.09S/RPR
86TestGroup SM68Lower gingivaGrade 1T4N04A71.602.19S/RPR

Group R, resistant group; Group S, sensitive group; M, male; F, female; Pre C/R, preoperative chemotherapy and/or radiotherapy; S/R, S-1 + radiation; P/R, carboplatin or cisplatin + radiation; PF/R, cisplatin and 5-fluorouracil + radiation; PF, cisplatin and 5-fluorouracil; S, S-1; R, radiation; CR, complete remission; PR, partial response; SD, stable disease; PD, progressive disease.

Clinical characteristics and expression profile of galectin-7. Group R, resistant group; Group S, sensitive group; M, male; F, female; Pre C/R, preoperative chemotherapy and/or radiotherapy; S/R, S-1 + radiation; P/R, carboplatin or cisplatin + radiation; PF/R, cisplatin and 5-fluorouracil + radiation; PF, cisplatin and 5-fluorouracil; S, S-1; R, radiation; CR, complete remission; PR, partial response; SD, stable disease; PD, progressive disease. As learning cases, 18 biopsy samples were prepared (Table 1), including nine samples from Group R patients and nine samples from Group S patients. As test cases, 68 samples were prepared (Table 1), including 25 samples from Group R patients and 43 samples from Group S patients.

Preoperative chemotherapy and/or radiotherapy

Patients assigned to the S/R group received a daily fractional dose of radiotherapy (2 Gy; 5 days/week) for a total dose of 34–50 Gy using a 4MV LINAC (Varian, CA). Radiation was delivered to the primary tumor site and the cervical nodes for patients with nodal involvement. Concomitant chemotherapy with S-1 (Taiho Pharmaceutical Co., Tokyo, Japan) was orally administered twice a day after a meal for five consecutive days per week. The individual doses were calculated on the basis of body surface area (total 1000–3000 mg). Patients assigned to the P/R group received a fractional daily dose of radiotherapy for a total dose of 50 Gy. Concomitant chemotherapy with carboplatin (CBDCA) or cisplatin (CDDP) was administered once a day using the selective intra-arterial infusion method via the superficial temporal artery 9. The daily dose of CBDCA ranged from 10 to 30 mg, with a total dose of 495–725 mg. The daily dose of CDDP was 8 mg, with a total dose of 280 mg. Patients in the pretreatment PF/R group received a daily fractional dose of radiotherapy for a total dose of 50 Gy. Concomitant chemotherapy with intravenous CDDP (80 mg/m2), followed by 5-fluorouracil (5-Fu) (800 mg/m2 per day) as a continuous 24-h infusion for five consecutive days, was administered. Patients in the PF group received intravenous CDDP (60, 70, or 80 mg/m2), followed by 5-Fu (600, 700, or 800 mg/m2 per day) as a continuous 24-h infusion for five consecutive days. These patients received one or two cycles of treatment. Patients in the pretreatment S group were administered oral S-1 twice a day after meals during the waiting period before surgery (total, 600–2100 mg). Finally, patients in the pretreatment R group only received a daily fractional dose of radiotherapy (2.5 Gy for 4 days/week), with a total dose of 40 Gy.

Peptide extraction

The proteins were extracted from the FFPE samples in the form of tryptic peptides using the Liquid Tissue MS Protein Partitioning Kit (Expression Pathology, Rockville, MD) according to the manufacturer's protocol. The extracted peptides were desalted through a C18 ZipTip (Millipore, Billerica, MA).

Liquid chromatography–mass spectrometry

Eighteen samples (nine from Group R and nine from Group S) were blinded, randomized, and measured in duplicate with a linear gradient of 0–80% acetonitrile in 0.1% formic acid at a speed of 200 nL/min for 60 min using a nano-flow high-performance liquid chromatography (HPLC; NanoFrontier nLC; Hitachi High-technologies, Tokyo, Japan) that was connected to a triple time-of-flight mass spectrometer (5600 Triple TOF; AB Sciex, Framingham, MA). The system detected peptide peaks every 1 sec, with a mass-to-charge ratio (m/z) ranging from 400 to 1600. The MS peaks were detected, normalized, and quantified using in-house 2DICAL (two-dimensional image-converted analysis of liquid chromatography and mass spectrometry) software as described previously 10. A serial identification (ID) number was assigned to each MS peak from ID1 to ID70510.

Protein identification by MS/MS

The MS/MS spectra were aligned with a tolerance of ±0.5 m/z and a retention time (RT) of ±0.4 min. Then, targeted MS/MS was performed. Peaks lists were generated by the MassNavigator software package (Version 1.2.12; Mitsui Knowledge Industry, Tokyo, Japan) and searched against the NCBInr database (NCBInr_20120423.fast) using the Mascot software package (Version 2.2.1; Matrix Sciences, London, UK). The initial peptide tolerances in MS and MS/MS modes were ±0.05 and ±0.1 Da, respectively. The peptides were digested with trypsin, and up to one missed cleavage was allowed. The score threshold for achieving P < 0.05 was set by the Mascot algorithm on the basis of database size. If a peptide matched multiple proteins, then the protein name with the highest Mascot score was selected.

Immunohistochemistry for galectin-7

FFPE sections from all 86 cases were analyzed by quantitative immunohistochemistry (IHC). The 4-μm thick sections were incubated with a rabbit monoclonal anti-galectin-7 antibody (EPR4287; 1:2000; LifeSpan Biosciences, Inc., WA) for 60 min at room temperature. Then, they were incubated with biotinylated anti-primary antibodies (Histofine SAB PO kit; Nichirei, Tokyo, Japan). The signal was detected using streptavidin–peroxidase (Histofine SAB PO kit) and the diaminobenzidine tetrahydrochloride (DAB) substrate. Finally, the sections were counterstained with Mayer's hematoxylin and dehydrated.

Analysis of galectin-7 immunostaining

The galectin-7-stained area (G7S) was quantified by dividing the staining intensity of that area over the staining intensity of the whole tissue section using ImageJ (freeware available at http://rsb.info.nih.gov/nih-image/). The immunostaining pattern of the galectin-7 nuclear staining area (G7N) was defined by dividing the staining intensity of the galectin-7 immunostained area within the nucleus over G7S. The median G7N of the 18 learning samples was 0.168. Therefore, G7NL was graded as follows: weak (G7NL = 0; <0.15 of G7N), positive (G7NL = 1; 0.15–0.40 of G7N), or strongly positive (G7NL = 2; >0.40 of G7N), corresponding to highest tertile of the 18 learning samples.

Cell culture

The human oral SCC cell lines, HSC-3, HSC2, HOC313, HSC4, and Ho1-N-1, were established in the First and the Second Department of Oral and Maxillofacial Surgery, Faculty of Dentistry, Tokyo Medical and Dental University (Tokyo, Japan). SKN3 cells were purchased from the Japanese Collection of Research Bioresources (Osaka, Japan). HEK293 cells were purchased from DS Pharma Biomedical Co. Ltd. (EC85120602-FO; Osaka, Japan). These were maintained in Dulbecco's modified Eagle's medium (DMEM) containing a high concentration of glucose (4.5 mg/mL) supplemented with 10% fetal bovine serum (FBS) and cultured in a 5% CO2 environment at 37°C.

Adenovirus vector

A cDNA for human galectin-7 (Clone name: pFN21AE1213) was obtained from the Kazusa DNA Research Institute, Kisarazu, Japan (http://www.kazusa.or.jp). The adenoviral construct containing FLAG-tagged human galectin-7 (GAL7) was obtained using Adeno-X™ Adenoviral System 3 with tetracycline inducible expression system (Tet-On 3G Inducible) from Clontech (Mountain View, CA). FLAG (ATGGACTACAAGGACGACGATGACAAG) and human galectin-7 sequences can be transferred as PCR products to the pAdenoX vector using the In-Fusion cloning method (Clontech) according to the protocol. FLAG-tagged human galectin-7 gene plus 15 bp of homology to pAdenoX vector was amplified using CloneAmp HiFi Premix (Clontech) with the following primers: 5′-GTAACTATAACGGTCATGGACTACAAGGACGACGATGACAAGATGTCCAACGTCCCCCACAAGTCCT-3′ (Ad-FLAG-GAL7 forward), 5′-ATTACCTCTTTCTCCTCAGAAGATCCTCACGGAGTCCAGCT-3′ (GAL7 reverse). The Pac I-Digested adenoviral construct was transfected into HEK293 cells. The virus was amplified and harvested according to the Clonetech protocol. The viral titer was determined by the Tissue Culture Infectious Dose 50 (TCID50) method. The infection was with the multiplicity of infection (MOI) of 0–100 IFU/cell in complete growth medium with or without 1 μg/mL doxycycline (Clontech).

Western blot analysis

Cells were lysed in a cell lysis buffer (20 mmol/L Tris-HCl pH 7.5, 1% Triton X-102, 0.1% SDS, 150 mmol/L NaCl, 1 mmol/L EDTA, 50 μg/mL Aprotinin and 80 μg/mL PMSF). The cell lysate was subjected to SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis), followed by electroblotting onto polyvinylidene fluoride (PVDF) membranes. After blocking with 5% skim milk in phosphate-buffered saline (PBS) for 1 h, membranes were probed with specific a mouse monoclonal anti-FLAG (M2; 1:1000; Sigma, St. Louis, MO), a rabbit monoclonal anti-galectin-7 (EPR4287; 1:1000; LifeSpan Biosciences, Inc.), a rabbit polyclonal anti-caspase-3 (#9662; 1:1000; Cell Signaling Technology, Inc., MA), and a rabbit monoclonal anti-beta-actin (#8457(D6A8); 1:1000; Cell Signaling Technology, Inc.) antibodies. Immunoreactive signals were visualized by SuperSignal west dura extended duration (Thermo Scientific, Waltham, MA), using Light-capture (ATTO, Bioscience and Biotechnology, Tokyo, Japan).

In vitro cell viability assay

Cell viability was assessed by the colorimetric water-soluble tetrazolium salt (WST) assay (Cell counting kit-8; Dojindo Laboratories, Kumamoto, Japan) as described by the manufacturer. Briefly, cells (1 × 104/well) were seeded into 96-well plates and cultured for 12 h. Then, cells were incubated with adenovirus infection for 12 h with or without 1 μg/mL doxycycline, and further cultured with or without doxycycline in fresh medium with the absence or presence of anticancer drug, 5 μg/mL cisplatin or 50 μg/mL 5-fluorouracil, for an additional 24 h. At the end of the culture period, 10 μL of a formazan-generating reagent, WST-8, was added to each well for 60 min at 37°C. The absorbance of each well at 450 nm was then measured using a microplate reader.

Statistical Analysis

The MS data and cell viability were analyzed by receiver operating characteristic (ROC) curve analysis, including area under the curve (AUC), stepwise discriminant analysis, T-tests, Mann–Whitney U-tests, and two-sided log-rank tests with PASW Statistics, version 18 (SPSS Inc., Chicago, IL). P < 0.05 was considered statistically significant.

Results

Identification of a predictive marker of chemotherapy and/or radiotherapy resistance in OSCC by LC-MS

To identify a predictive marker of chemotherapy and/or radiotherapy resistance in OSCC, 18 biopsy samples, including nine samples from Group R and nine samples from Group S, were analyzed by LC-MS (Fig. 1). A total of 70,510 peaks per sample were readily detected and quantified. Among them, 10,869 MS peaks differed in intensity between Group R and Group S (P < 0.05; AUC >0.7). We further selected 105 peaks with Mascot scores >50 and excluded abundant proteins, including keratin, fibrinogen, collagen, and histone. Among them, we selected 20 peaks with Group R/Group S peak intensity ratios ≤0.5. We further limited our selection to the peaks with high predictive power on the basis of discriminant analysis (stepwise method), which identified two candidate peaks (ID1181 and ID2504). We chose the peak with the highest Mascot score: ID1181 (Table 2). MS/MS spectra of the ID1181 peaks matched the amino acid sequence of the galectin-7 protein.
Figure 1

Identification of proteins differentially expressed in OSSC samples from patients sensitive (Group S) or resistant (Group R). The samples were processed by LC-MS and analyzed with 2DICAL. (A) Two-dimensional display of a representative sample. (B) Separation gel for the MS peaks ID599 and ID1181 from each group (N = 18). Group R (red) exhibits lower expression of the two peaks compared with Group S (blue).

Table 2

List of peptides that differed between the resistant group and sensitive group.

IDM/ZRTChargeRatio (R/S)UniProt accession numberProtein DescriptionMascot scorePeptide sequenceResistant (mean ± SD)Sensitive (mean ± SD)
4722725.755.330.47P3194714-3-3 protein sigma62.41TTFDEAMADLHTLSEDSYK1070 ± 5382263 ± 846
6326776.455.320.48P04083Annexin A162.79GTDVNVFNTILTTR2782 ± 13875762 ± 3858
25210574.038.930.25P22528Cornifin-B51.67QPCTPPPQLQQQQVK71 ± 83282 ± 293
1294726.757.330.48P15924Desmoplakin129.32FLEFQYLTGGLVDPEVHGR1805 ± 11483765 ± 2017
2504627.850.520.39P15924Desmoplakin60.97AITGFDDPFSGK958 ± 3482460 ± 938
3011843.550.820.45P15924Desmoplakin116.28ITNLTQQLEQASIVK846 ± 3511889 ± 751
3292752.155.730.48P15924Desmoplakin105.46LLEAQIASGGVVDPVNSVFLPK1109 ± 5682304 ± 930
1196677.452.320.47P12724Eosinophil cationic protein63.88YPVVPVHLDTTI1297 ± 4432786 ± 1933
599494.644.430.45P47929Galectin-752.89SSLPEGIRPGTVLR2730 ± 15586018 ± 2658
1181619.843.920.47P47929Galectin-787.57LDTSEVVFNSK1763 ± 9933764 ± 1639
31232593.648.520.42P01857Ig gamma-1 chain C region57.90GPSVFPLAPSSK192 ± 225453 ± 169
1316618.951.420.46P14923Junction plakoglobin87.37VSVELTNSLFK1815 ± 12963931 ± 1850
914576.852.320.42P05164Myeloperoxidase56.64IANVFTNAFR925 ± 7272198 ± 1956
20233576.852.720.48P05164Myeloperoxidase56.77IANVFTNAFR659 ± 4041365 ± 778
2998688.946.520.47Q13835Plakophilin-166.93VMGNQVFPEVTR1035 ± 7812190 ± 1187
10288594.337.720.42Q13835Plakophilin-185.89LLQSGNSDVVR413 ± 235987 ± 597
26579450.736.820.49Q13835Plakophilin-150.69LDAEVPTR261 ± 181538 ± 346
1257582.046.130.48P06702Protein S100-A965.32VIEHIMEDLDTNADK1365 ± 9452817 ± 1354
2735807.966.020.48P06702Protein S100-A9111.26QLSFEEFIMLMAR829 ± 8071743 ± 1423
9832744.342.520.49P68363Tubulin alpha-1B chain87.43LISQIVSSITASLR426 ± 143870 ± 572

RT, retention time; Ratio (R/S), a ratio of average peak intensity in the resistant group to that in the sensitive group.

List of peptides that differed between the resistant group and sensitive group. RT, retention time; Ratio (R/S), a ratio of average peak intensity in the resistant group to that in the sensitive group. Identification of proteins differentially expressed in OSSC samples from patients sensitive (Group S) or resistant (Group R). The samples were processed by LC-MS and analyzed with 2DICAL. (A) Two-dimensional display of a representative sample. (B) Separation gel for the MS peaks ID599 and ID1181 from each group (N = 18). Group R (red) exhibits lower expression of the two peaks compared with Group S (blue).

Expression of galectin-7 in OSCC by IHC

The protein expression of galectin-7 in OSCC tissue was confirmed by IHC analysis of the FFPE samples used for LC-MS analysis (Fig. 2A). Pearson's correlation analysis was conducted between G7S and each of the peaks listed in Table 2. A significant positive correlation was detected between G7S and the intensity of the two galectin-7 peaks, namely ID599 (r = 0.71; P = 0.001; Fig. 3A) and ID1181 (r = 0.73; P = 0.001; Fig. 3B). Scatter plot analysis was conducted for the G7S values of Group R and Group S (Fig. 4A). The median G7S was significantly lower for Group R (0.455) than for Group S (0.666; Mann–Whitney U-test; P = 0.003), suggesting that oral SSC patients with low galectin-7 expression are more likely to exhibit chemotherapy and/or radiotherapy resistance. The sensitivity of this prediction was 88.9% and specificity was 88.9% (cutoff point: 0.526).
Figure 2

Immunohistochemistry of galectin-7. (A) Low magnification (bar: 1 mm) showing the overall staining intensity and distribution. Left panel: galectin-7 staining area (G7S) = 0.48, galectin-7 nuclear staining level (G7NL) = 2. Right panel: G7S = 0.80, G7NL = 0. (B) High magnification (bar: 20 μm) showing galectin-7 was expressed in both the cytosolic and nuclear compartments; we observed strong nuclear staining in Group R and mostly cytosolic staining in Group S.

Figure 3

Regression analysis between the galectin-7 staining area (G7S) and the intensity of the MS peaks. Significant positive correlations were detected for both peaks, namely (A) ID599 (r = 0.71; P = 0.001) and (B) ID1181 (r = 0.73; P = 0.001).

Figure 4

Scatter plot analysis for galectin-7 immunostaining. The two groups were compared for quantitative values of (A) galectin-7 staining area (G7S) and (B) galectin-7 nuclear area (G7N). Median G7S was lower for Group R than for Group S, but median G7N was 10-fold higher for Group R than Group S. Classification values for the galectin-7 nuclear staining area are shown by the horizontal lines as values of 0.15 and 0.40.

Immunohistochemistry of galectin-7. (A) Low magnification (bar: 1 mm) showing the overall staining intensity and distribution. Left panel: galectin-7 staining area (G7S) = 0.48, galectin-7 nuclear staining level (G7NL) = 2. Right panel: G7S = 0.80, G7NL = 0. (B) High magnification (bar: 20 μm) showing galectin-7 was expressed in both the cytosolic and nuclear compartments; we observed strong nuclear staining in Group R and mostly cytosolic staining in Group S. Regression analysis between the galectin-7 staining area (G7S) and the intensity of the MS peaks. Significant positive correlations were detected for both peaks, namely (A) ID599 (r = 0.71; P = 0.001) and (B) ID1181 (r = 0.73; P = 0.001). Scatter plot analysis for galectin-7 immunostaining. The two groups were compared for quantitative values of (A) galectin-7 staining area (G7S) and (B) galectin-7 nuclear area (G7N). Median G7S was lower for Group R than for Group S, but median G7N was 10-fold higher for Group R than Group S. Classification values for the galectin-7 nuclear staining area are shown by the horizontal lines as values of 0.15 and 0.40. A careful observation of the IHC findings revealed that galectin-7 was expressed in both the cytosolic and nuclear compartments; we observed strong nuclear staining in Group R and mostly cytosolic staining in Group S (Fig. 2). Median G7N was 10-fold higher for Group R than for Group S, with 0.549 and 0.042, respectively (Mann–Whitney U-test; P = 0.003; Fig. 4B). These data show that chemotherapy and/or radiotherapy resistance is associated with a nuclear concentration of galectin-7. Therefore, we conducted a discriminant analysis using G7S and G7NL for the 18 learning samples analyzed by LC-MS and IHC and obtained the following predictive formula for chemotherapy and/or radiotherapy resistance: Based on this formula, the sensitivity of prediction was 100% and specificity was 88.9%, indicating that sensitivity was increased in the 18 learning cases (Fig. 5A). When this formula was used to analyze the remaining 68 test cases, the sensitivity of prediction was 96.0% and specificity was 39.5% (Fig. 5B).
Figure 5

Scatter plot analysis for the galectin-7 prediction score (G7PS). (A) In the learning cases. (B) In the test cases.

Scatter plot analysis for the galectin-7 prediction score (G7PS). (A) In the learning cases. (B) In the test cases.

Galectin-7 prediction score correlates with poor prognosis in patients with OSCC

Five-year cumulative survival rates in Group S and Group R were estimated by Kaplan–Meier analysis using galectin-7 as a predictor of chemotherapy and/or radiotherapy resistance. The cumulative 5-year disease-specific survival rate was 75.2% in patients with resistant prediction using galectin-7 prediction score (G7PS) (<0) and 100% in patients with sensitive prediction (G7PS ≥0; Fig. 6). There was a significant positive correlation between resistant prediction using G7PS and survival parameter (log-rank test; P = 0.027; Fig. 6).
Figure 6

Kaplan–Meier survival analysis based on G7PS. There was a significant correlation between resistant prediction and survival parameter (log-rank test; P = 0.027).

Kaplan–Meier survival analysis based on G7PS. There was a significant correlation between resistant prediction and survival parameter (log-rank test; P = 0.027).

Galectin-7 decreases cell viability

To investigate the roles of galectin-7 in OSCC cells, the expression status of galectin-7 in six human OSCC cell lines was detected by Western blot analysis. A low endogenous expression of galectin-7 was detected in all OSCC cell lines except SKN3 (Fig. 7A). Next, we examined the effect of overexpressed galectin-7 in OSCC cells. HSC3 cells were infected with recombinant adenovirus encoding FLAG-tagged galectin-7 (Ad-FLAG-GAL7). The expression of galectin-7 was detected in a MOI-dependent manner with 1 μg/mL doxycycline by Western blot analysis (Fig. 7B), and we confirmed that FLAG-tagged galectin-7 was strongly expressed in HSC3 cells than endogenous expressions of galectin-7 in SKN3 or HSC2 cells (Fig. 7C). To examine the infection efficiency and intracellular distribution of Ad-FLAG-GAL7, we performed immunofluorescence labeling for overexpressed galectin-7. The infection efficiency of Ad-FLAG-GAL7 in HSC3 cells at MOI 50 was ∼80% (Fig. S1A). The intracellular distribution of Ad-FLAG-GAL7 was similar to the IHC staining pattern of galectin-7 (Fig. 8B). Moreover, by Western blot analysis, we confirmed that analysis of supernatants from HSC3 cells infected with Ad-FLAG-GAL7 or other OSCC cell lines have failed to provide evidence for a secreted form of galectin-7 (data not shown). To examine the effect of galectin-7 on cell viability, HSC3 cells infected with Ad-FLAG-GAL7 (MOI of 50) were cultured for 24 h with or without doxycycline. The overexpression of galectin-7 significantly decreased cell viability in normal culture conditions (Fig. 8A). Furthermore, similar results were observed when we treated the cells with 5 μg/mL cisplatin or 50 μg/mL 5-fluorouracil (Fig. 8A). These results indicate that galectin-7 may be involved in tumor cell proliferation/viability rather than chemosensitivity. We also investigated the role of galectin-7 using antisense galectin-7 oligonucleotides in OSCC cell lines. Unfortunately, the results showed no effects of galectin-7 knockdown on cell viability (Fig. S2). To determine whether the decreased cell viability was because of apoptosis, Ad-FLAG-GAL7-infected HSC3 cells were cultured with or without doxycycline. We observed weak activation and cleavage of caspase-3 induced by the overexpression of galectin-7 was observed (Fig. 8B) indicating that the decreased cell viability by overexpression of galectin-7 may be because of growth arrest rather than apoptosis.
Figure 7

Adenovirus-mediated expression of galectin-7 in oral SCC cell lines. (A) Endogenous expression of galectin-7 in oral SCC cell lines. (B) Adenovirus-mediated expression of galectin-7 in HSC3 cells. HSC3 cells were infected with the indicated MOI of a recombinant adenovirus encoding FLAG-tagged galectin-7 (Ad-FLAG-GAL7) with or without 1 μg/mL doxycycline. (C) FLAG-tagged galectin-7 in HSC3 cells strongly expressed rather than endogenous expressions of galectin-7 in SKN3 or HSC2 cells. HSC3 cells were infected with MOI 50 of Ad-FLAG-GAL7. Then, SKN3, HSC2 and HSC3 cells were cultured with or without doxycycline in fresh medium for 24 h. The lysates were analyzed by Western blot analysis.

Figure 8

Overexpression of galectin-7 decreased cell viability. (A) Effect of galectin-7 in HSC3 cells. HSC3 cells were infected with Ad-FLAG-GAL7 at MOI 50. Then, cells were cultured with or without doxycycline in a fresh medium with the absence or presence of anticancer drug, 5 μg/mL cisplatin or 50 μg/mL 5-fluorouracil. Cell viability was assayed as described in. Data represent the means ± SD of four independent experiments. *P < 0.05, compared with uninfected cells in the absence of anticancer drugs. 5-Fu, 5-fluorouracil; CDDP, cisplatin; TET, doxycycline. (B) Cleavage of caspase-3 induced by the overexpression of galectin-7. HSC3 cells were infected with Ad-FLAG-GAL7 at MOI 50. Then, cells were cultured with or without doxycycline in a serum-free medium for 36 h. The lysates were analyzed by Western blot analysis. Beta-actin was used as a loading control.

Adenovirus-mediated expression of galectin-7 in oral SCC cell lines. (A) Endogenous expression of galectin-7 in oral SCC cell lines. (B) Adenovirus-mediated expression of galectin-7 in HSC3 cells. HSC3 cells were infected with the indicated MOI of a recombinant adenovirus encoding FLAG-tagged galectin-7 (Ad-FLAG-GAL7) with or without 1 μg/mL doxycycline. (C) FLAG-tagged galectin-7 in HSC3 cells strongly expressed rather than endogenous expressions of galectin-7 in SKN3 or HSC2 cells. HSC3 cells were infected with MOI 50 of Ad-FLAG-GAL7. Then, SKN3, HSC2 and HSC3 cells were cultured with or without doxycycline in fresh medium for 24 h. The lysates were analyzed by Western blot analysis. Overexpression of galectin-7 decreased cell viability. (A) Effect of galectin-7 in HSC3 cells. HSC3 cells were infected with Ad-FLAG-GAL7 at MOI 50. Then, cells were cultured with or without doxycycline in a fresh medium with the absence or presence of anticancer drug, 5 μg/mL cisplatin or 50 μg/mL 5-fluorouracil. Cell viability was assayed as described in. Data represent the means ± SD of four independent experiments. *P < 0.05, compared with uninfected cells in the absence of anticancer drugs. 5-Fu, 5-fluorouracil; CDDP, cisplatin; TET, doxycycline. (B) Cleavage of caspase-3 induced by the overexpression of galectin-7. HSC3 cells were infected with Ad-FLAG-GAL7 at MOI 50. Then, cells were cultured with or without doxycycline in a serum-free medium for 36 h. The lysates were analyzed by Western blot analysis. Beta-actin was used as a loading control.

Discussion

The identification of tumor response predictors applying to a variety of radiotherapy and chemotherapy regimens will allow oncologists to customize strategies aimed at minimizing exposure to high-dose adjuvant therapy. To identify candidate biomarkers from the proteomics data, we used the 2DICAL analysis platform that performs a quantitative comparison of unlabeled shotgun proteomics data generated by LC-MS 11. This approach was successfully used to identify blood biomarkers in pancreatic and colorectal cancer patients 12–17. The use of proteins extracted from FFPE tissues in the form of tryptic peptides is compatible with a variety of MS-based proteomics 8. However, we present the first report, as per our knowledge, on tumor response predictors in patients with OSCC. Galectins constitute a family of evolutionary-conserved carbohydrate-binding proteins. They are widely distributed in all organisms and are implicated in many essential functions such as development, differentiation, cell–cell adhesion, cell–matrix interaction, growth regulation, and apoptosis 18. The various roles of galectins in cancer invasion and metastasis have been well documented 19,20. However, very little is known about how galectin-7 expression affects cancer progression 18. The expression level of galectin-7 varies widely among tumor types, from completely downregulated to highly upregulated 21–24. De novo galectin-7 expression by p53 is associated with apoptosis, which inhibits tumor growth 25. Alternatively, galectin-7 mediates the nuclear export of Smad3 through complex formation, which is essential for the tumor-suppressive effects of hepatocyte growth factor on the transforming growth factor-beta signaling pathway 26. Paradoxically, galectin-7 may also induce the expression of genes known to promote cancer progression, including matrix metalloproteinase-9 (MMP-9) 27,28. In this case, galectin-7 expression could be induced by nuclear factor-kappa B, a transcription factor and a positive regulator of MMP-9 known to be expressed in highly aggressive tumor cells 18. This study provides in vitro evidence suggesting not a promoting effect of galectin-7 on the chemosensitivity but a potential of galectin-7 on decreasing cell proliferation/viability, which may be an interesting topic for future studies on OSCC therapy. We also investigated the role of galectin-7 using antisense galectin-7 oligonucleotides, however, the results showed no effects of galectin-7 knockdown on cell viability. A plausible reason for this is that strongly overexpressed galectin-7 affected cell viability, whereas physiologically expressed galectin-7 did not. Therefore, the knockdown of physiologically expressed galectin-7 did not elicit a noticeable effect. Moreover, because the function of galectin-7 in the nucleus remains unclear, further studies are needed to clarify this issue. This study suggests that low galectin-7 protein expression translates into low cumulative survival rate in patients with OSCC via tumor resistance to preoperative chemotherapy and/or radiotherapy. These data are not consistent with the findings of Saussez et al. 29, who reported that galectin-7 protein expression increases during tumor progression in hypopharyngeal and laryngeal SCC. However, this research team also reported that the percentage of cells immunopositive for galectin-7 decreased significantly with the loss of histological differentiation in hypopharyngeal SCC 30. Furthermore, tumor progression was associated with a translocation of galectin-7 from the nucleus to the cytoplasm 29. These data suggest that the sequestration of galectin-7 into the nucleus would prevent this protein from interfering with tumor progression or regression, leading to treatment resistance. Accordingly, a formula combining the expression level and nucleic/cytoplasmic expression ratio of galectin-7 would constitute a rational predictor of chemotherapy and/or radiotherapy resistance in patient with advanced OSCC. Our findings suggest that the specificity of the prediction of chemotherapy and/or radiotherapy resistance using G7PS was 39.5%; therefore, there could be many false-positive results. However, one case with a response evaluation of PR who was predicted as resistant (G7PS = −0.25) died of uncontrolled neck node metastases despite surgery followed by additional radiotherapy. Therefore, patients with resistance prediction using G7PS (<0) should be considered for other treatments or drugs that were not used in this study (e.g., docetaxel or a molecular target drug). Moreover, a synergistic effect of galectin-7 and S100-A9 on cervical squamous carcinoma patients was recently reported 31. We also identified S100-A9 as one of other potential predictive markers; therefore, identification of other useful combination markers that were not analyzed in this study may be important. In conclusion, we identified galectin-7 as a predictor of tumor resistance and developed a predictive formula for patient survival. Accordingly, measurement of galectin-7 protein expression in fresh tissue biopsy samples at the time of diagnosis can provide invaluable information for the design of customized preoperative treatment regimens with advanced OSCC. Future challenges include the identification of other useful combination markers that were not analyzed in this study in order to improve diagnostic accuracy.
  31 in total

1.  Label-free quantitative proteomics using large peptide data sets generated by nanoflow liquid chromatography and mass spectrometry.

Authors:  Masaya Ono; Miki Shitashige; Kazufumi Honda; Tomohiro Isobe; Hideya Kuwabara; Hirotaka Matsuzuki; Setsuo Hirohashi; Tesshi Yamada
Journal:  Mol Cell Proteomics       Date:  2006-03-21       Impact factor: 5.911

Review 2.  Global epidemiology of oral and oropharyngeal cancer.

Authors:  Saman Warnakulasuriya
Journal:  Oral Oncol       Date:  2008-09-18       Impact factor: 5.337

3.  Overexpression of galectin-7, a myoepithelial cell marker, enhances spontaneous metastasis of breast cancer cells.

Authors:  Mélanie Demers; April A N Rose; Andrée-Anne Grosset; Katherine Biron-Pain; Louis Gaboury; Peter M Siegel; Yves St-Pierre
Journal:  Am J Pathol       Date:  2010-04-09       Impact factor: 4.307

4.  Identification of adipophilin as a potential plasma biomarker for colorectal cancer using label-free quantitative mass spectrometry and protein microarray.

Authors:  Junichi Matsubara; Kazufumi Honda; Masaya Ono; Shigeki Sekine; Yoshinori Tanaka; Michimoto Kobayashi; Giman Jung; Tomohiro Sakuma; Shoji Nakamori; Naohiro Sata; Hideo Nagai; Tatsuya Ioka; Takuji Okusaka; Tomoo Kosuge; Akihiko Tsuchida; Masashi Shimahara; Yohichi Yasunami; Tsutomu Chiba; Tesshi Yamada
Journal:  Cancer Epidemiol Biomarkers Prev       Date:  2011-08-09       Impact factor: 4.254

5.  Reduced plasma level of CXC chemokine ligand 7 in patients with pancreatic cancer.

Authors:  Junichi Matsubara; Kazufumi Honda; Masaya Ono; Yoshinori Tanaka; Michimoto Kobayashi; Giman Jung; Koji Yanagisawa; Tomohiro Sakuma; Shoji Nakamori; Naohiro Sata; Hideo Nagai; Tatsuya Ioka; Takuji Okusaka; Tomoo Kosuge; Akihiko Tsuchida; Masashi Shimahara; Yohichi Yasunami; Tsutomu Chiba; Setsuo Hirohashi; Tesshi Yamada
Journal:  Cancer Epidemiol Biomarkers Prev       Date:  2010-12-08       Impact factor: 4.254

6.  Development of oral cancer screening test by detection of squamous cell carcinoma among exfoliated oral mucosal cells.

Authors:  Takuma Kugimoto; Kei-ichi Morita; Ken Omura
Journal:  Oral Oncol       Date:  2012-04-22       Impact factor: 5.337

7.  Identification of a predictive biomarker for hematologic toxicities of gemcitabine.

Authors:  Junichi Matsubara; Masaya Ono; Ayako Negishi; Hideki Ueno; Takuji Okusaka; Junji Furuse; Koh Furuta; Emiko Sugiyama; Yoshiro Saito; Nahoko Kaniwa; Junichi Sawada; Kazufumi Honda; Tomohiro Sakuma; Tsutomu Chiba; Nagahiro Saijo; Setsuo Hirohashi; Tesshi Yamada
Journal:  J Clin Oncol       Date:  2009-03-16       Impact factor: 44.544

8.  Prolyl 4-hydroxylation of alpha-fibrinogen: a novel protein modification revealed by plasma proteomics.

Authors:  Masaya Ono; Junichi Matsubara; Kazufumi Honda; Tomohiro Sakuma; Tomoyo Hashiguchi; Hiroshi Nose; Shoji Nakamori; Takuji Okusaka; Tomoo Kosuge; Naohiro Sata; Hideo Nagai; Tatsuya Ioka; Sachiko Tanaka; Akihiko Tsuchida; Tatsuya Aoki; Masashi Shimahara; Yohichi Yasunami; Takao Itoi; Fuminori Moriyasu; Ayako Negishi; Hideya Kuwabara; Ayako Shoji; Setsuo Hirohashi; Tesshi Yamada
Journal:  J Biol Chem       Date:  2009-08-20       Impact factor: 5.157

9.  Galectin-7 in lymphoma: elevated expression in human lymphoid malignancies and decreased lymphoma dissemination by antisense strategies in experimental model.

Authors:  Mélanie Demers; Katherine Biron-Pain; Josée Hébert; Alain Lamarre; Thierry Magnaldo; Yves St-Pierre
Journal:  Cancer Res       Date:  2007-03-15       Impact factor: 12.701

Review 10.  A distinctive role for galectin-7 in cancer ?

Authors:  Yves St-Pierre; Carole G Campion; Andree-Anne Grosset
Journal:  Front Biosci (Landmark Ed)       Date:  2012-01-01
View more
  10 in total

1.  Association of immunoexpression of the galectins-3 and -7 with histopathological and clinical parameters in oral squamous cell carcinoma in young patients.

Authors:  Janaina Almeida Mesquita; Lélia Maria Guedes Queiroz; Éricka Janine Dantas Silveira; Manuel Antônio Gordon-Nunez; Gustavo Pina Godoy; Cassiano Franscisco Weege Nonaka; Pollianna Muniz Alves
Journal:  Eur Arch Otorhinolaryngol       Date:  2015-01-14       Impact factor: 2.503

2.  Molecular alterations in oral cancer using high-throughput proteomic analysis of formalin-fixed paraffin-embedded tissue.

Authors:  Varshasnata Mohanty; Yashwanth Subbannayya; Shankargouda Patil; Vinuth N Puttamallesh; Mohd Altaf Najar; Keshava K Datta; Sneha M Pinto; Sameera Begum; Neeta Mohanty; Samapika Routray; Riaz Abdulla; Jay Gopal Ray; David Sidransky; Harsha Gowda; T S Keshava Prasad; Aditi Chatterjee
Journal:  J Cell Commun Signal       Date:  2021-03-08       Impact factor: 5.782

3.  Galectin-7 promotes the invasiveness of human oral squamous cell carcinoma cells via activation of ERK and JNK signaling.

Authors:  Jia-Ping Guo; Xiao-Guang Li
Journal:  Oncol Lett       Date:  2017-01-25       Impact factor: 2.967

Review 4.  Galectin-7 in Epithelial Homeostasis and Carcinomas.

Authors:  Tamara Advedissian; Frédérique Deshayes; Mireille Viguier
Journal:  Int J Mol Sci       Date:  2017-12-19       Impact factor: 5.923

Review 5.  The Role of Galectins in Cervical Cancer Biology and Progression.

Authors:  Lufang Wang; Yanyan Zhao; Yanshi Wang; Xin Wu
Journal:  Biomed Res Int       Date:  2018-05-08       Impact factor: 3.411

Review 6.  Mediators of Inflammation - A Potential Source of Biomarkers in Oral Squamous Cell Carcinoma.

Authors:  Mircea Tampa; Madalina Irina Mitran; Cristina Iulia Mitran; Maria Isabela Sarbu; Clara Matei; Ilinca Nicolae; Ana Caruntu; Sandra Milena Tocut; Mircea Ioan Popa; Constantin Caruntu; Simona Roxana Georgescu
Journal:  J Immunol Res       Date:  2018-11-12       Impact factor: 4.818

Review 7.  Functions and Inhibition of Galectin-7, an Emerging Target in Cellular Pathophysiology.

Authors:  Nishant V Sewgobind; Sanne Albers; Roland J Pieters
Journal:  Biomolecules       Date:  2021-11-18

Review 8.  Application of Proteomics in the Discovery of Radiosensitive Cancer Biomarkers.

Authors:  Hui Luo; Hong Ge
Journal:  Front Oncol       Date:  2022-02-23       Impact factor: 6.244

9.  High expression of galectin-7 associates with poor overall survival in patients with non-metastatic clear-cell renal cell carcinoma.

Authors:  Jieti Wang; Yidong Liu; Yuanfeng Yang; Zhiying Xu; Guodong Zhang; Zheng Liu; Hangcheng Fu; Zewei Wang; Haiou Liu; Jiejie Xu
Journal:  Oncotarget       Date:  2016-07-05

10.  Deubiquitination and stabilization of programmed cell death ligand 1 by ubiquitin-specific peptidase 9, X-linked in oral squamous cell carcinoma.

Authors:  Wu Jingjing; Guo Wenzheng; Wen Donghua; Hou Guangyu; Zhou Aiping; Wu Wenjuan
Journal:  Cancer Med       Date:  2018-07-10       Impact factor: 4.452

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.