Literature DB >> 24511291

Identification of leaf rust resistance genes in selected egyptian wheat cultivars by molecular markers.

I A Imbaby1, M A Mahmoud1, M E M Hassan1, A R M Abd-El-Aziz2.   

Abstract

Leaf rust, caused by Puccinia triticina Eriks., is a common and widespread disease of wheat (Triticum aestivum L.) in Egypt. Host resistance is the most economical, effective, and ecologically sustainable method of controlling the disease. Molecular markers help to determine leaf rust resistance genes (Lr genes). The objective of this study was to identify Lr genes in fifteen wheat cultivars from Egypt. Ten genes, Lr13, Lr19, Lr24, Lr26, Lr34, Lr35 Lr36, Lr37, Lr39, and Lr46, were detected in fifteen wheat cultivars using various molecular markers. The most frequently occurring genes in fifteen Egyptian wheat cultivars were Lr13, Lr24, Lr34, and Lr36 identified in all the cultivars used, followed by Lr26 and Lr35 (93%), Lr39 (66%), Lr37 (53%), and Lr46 (26.6%) of the cultivars, and finally Lr19 was present in 33.3% of cultivars. It is concluded that there was a good variation in Lr genes carried by wheat cultivars commercially grown in Egypt. Therefore, strategies for deploying resistance genes to prolong effective disease resistance are suggested to control wheat leaf rust disease.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24511291      PMCID: PMC3913395          DOI: 10.1155/2014/574285

Source DB:  PubMed          Journal:  ScientificWorldJournal        ISSN: 1537-744X


1. Introduction

Rusts are the most devastating fungal diseases posing a threat to wheat production worldwide. Leaf rust, caused Puccinia triticina Eriks., is a major disease in most of the wheat-growing areas [1]. In Egypt, leaf rust is the most common and important wheat disease. It caused severe losses in grain yield which reached 23% [2] and losses in epidemic years reached up to 50% [3]. The most environmentally sound, low cost method of controlling leaf rust is to breed and grow resistant wheat varieties. So far over 60 leaf rust resistance genes, that is, Lr genes, have been identified and localized on the wheat chromosomes [4]. Resistance genes are expressed at seedling stage (qualitative resistance genes) than at adult plant (quantitative resistance genes). Certain adult plant resistance genes like Lr34 and Lr46 are very important for breeding because they proved to confer durable resistance over a long period of time in different environments, as well as against diverse pathotypes of the fungus [5]. The effectiveness of resistance genes depends on the composition of the pathogen populations. As this changes dynamically, new pathotypes virulent to the given resistance genes multiply from time to time, so the resistance of a variety is not a constant trait. A variety carrying a single resistance gene mat becomes susceptible within a short time. The postulation of resistance genes is traditionally carried out using rust isolates with known virulence [6] but this procedure is extremely time, space, and labour intensive and cannot be employed if no different fungal isolates are available. In many cases resistance genes can only be identified using molecular markers [7]. Over the last 15 years many efficient markers for leaf rust resistance genes have been described. The molecular markers most closely linked to Lr genes are based on the PCR technique, as the majority of these can be applied relatively easily in wheat breeding programmers. Molecular markers are used for two purposes in resistance breeding: (1) to monitor the incorporation of designated resistance genes or QTLs into elite wheat genotypes (i.e., MAS, marker-assisted selection) and (2) to identify resistance genes in varieties and lines where the genetic background is unknown (i.e., gene detection). A great deal of information on postulated leaf rust resistance genes has been collected from countries (including Australia, Canada, China, India, Pakistan, South Africa, and USA) where wheat is a major crop [8-12]. Little information is available on Lr genes present in Egyptian wheat cultivars [13, 14]. Objective of this study is to identify genes for resistance to leaf rust disease in selected Egyptian wheat cultivars.

2. Materials and Method

2.1. Plant Material

Fifteen wheat cultivars were used. These cultivars were tested for leaf rust disease under green house at seedling and adult plant stages. Fifteen Egyptian wheat cultivars and seven Near-Isogenic Thatcher lines (NILs) were tested for wheat leaf rust for their reaction to leaf rust. The wheat cultivars include Giza cultivars (163, 164, 165, 167, and 168), Sakha cultivars (8, 61, 69, 92, and 94), Sids cultivars (1 and 12) and Gemmeiza cultivars (7, 9, and 10). The selected Thatcher NILs were Lr13, Lr19, Lr24, Lr26, Lr34, Lr37, Lr36, and Lr49.

2.2. Disease Assessment

2.2.1. Seedling Stage

The cultivars to be tested were planted in 7 cm square plastic pots. Four cvs were planted per pot with 10–15 seeds per cv planted in each corner of the pot. Plants were grown in rust-free greenhouse until inoculation. At 7 days after planting when first leaves were fully expanded, the seedlings were gently rubbed between moist fingers and then sprayed with tap water using atomizer in the inoculation chamber, then inoculated by spraying them with a suspension of urediospores in a light mineral oil carrier. Inoculum concentration was normalized to 2-3 mgmL−1 [15]. The oil was allowed to evaporate from the leaves for 30–60 min, and the seedlings were placed overnight in a dew chamber at 17°C. They were then transferred to a greenhouse with mean temperature approximately 20-21°C. At 14 days after inoculation, the cvs were scored for infection type (IT) according to the scale of [16], where 0: nearly immune; 1: very resistant; 2: moderately resistant; 3: moderately resistant to moderately susceptible; and 4: very susceptible.

2.2.2. Adult Stage

The aforementioned cvs were sown in 30 cm square diameter pots. Each cv was planted in each pot, and four pots were planted for each cv as replicates. 75 days after planting (prebooting stage) [17], the plants were inoculated as mentioned before. After incubation, the plants were transferred onto the greenhouse benches. The disease severity (%) was recorded as the area of leaf covered with rust pustules according to the method adopted by [16]. Moreover, the particular cvs were planted in 25 cm square diameter pots and were left till tillering stage [17] then harvested for gene identification by using molecular markers.

2.3. DNA Extraction

DNA was isolated from 50 of the varieties (each) using Qiagen kit for DNA extraction. The extracted DNA was dissolved in 100 ul of elution buffer. The concentration and purity of the obtained DNA were determined by using “Gen Qunta” system, pharmacia Biotech. The purity of the DNA for all samples was between 90 and 97% and the ratio between 1.7 and 1.8 concentrations was adjusted at 6 ng/ul for all samples using TE buffer pH 8.0.

2.4. Detection of Lr Genes by Molecular Markers

Thirty ng from the extracted DNA, 0.25 μM of each primer of its and 0.40 μM from each specific primer (10 primers) were used for amplification reaction. The PCR mixture contained PCR beads tablet (manufactured by Amesshan Pharmacia Bio-tech) which contained all of the necessary reagents except the primer and the DNA to be used. The total volume was completed to 25 μL using sterile distilled water. The sequences of the used primers and size fragment are present in Table 3. Amplifications were performed in T-gradient thermocycler (Biometra, Germany). Sequences of primers are listed in Table 1. Amplification parameters for all primer sets used are presented in Table 2.
Table 3

Wheat cultivars tested at seedling and adult plant stages for resistance to leaf rust disease.

CultivarPedigreeResistance to leaf rust disease
Seedlinga Adultb
Giza 163T.aestivum/Bom/Ciano/3/Siete Cerros1, 250S
Giza 164Kavkas/Buho“s”//Kal/Bluebird=Verry#5180S
Giza 165Ciano/Maris Fundin//Mantaro2, 390S
Giza 167Au/Up 301//GII/Sx/3/Pew “s”/4/Mai “s”/Maya “s”//Pew350S
Giza 168MRL/BUC//Seri.CM93046-8M-0Y-0M-2Y-0B220MR
Sakha 8Indus/Norteno “s”0, 110MSS
Sakha 61Inia-RL 4220//Siete Cerros/Yaqui 50350S
Sakha 69Inia-RL 4220//Siete Cerros/Yaqui 5025S
Sakha 92Napo 63/Inia 66//Wren “s”320S
Sakha 94Opata/Rayon//KauzCMBW9043180-OTOPM-3Y-010M-010M-010Y-10M-015Y-0Y1, 210MRMS
Sids 1HD2172/Pavon “s”//1158. 57/Maya 74 “s”380S
Sids 12BUC//7C/ALD/5MAYA74/ON//1160-147/3/BB/GLL/4/CHAT:S′′/6/MAYA/VUL//CMH74A/4∗SX.SD7096-4SD-1SD-1SD-0SD.
Gemmeiza 7 CMH74A.630/5X82/3AgentCGM.4611-2GM-3GM-1GM0GM420S
Gemmeiza 9Ald“S”/Haus//CMH74A.630/SxCGM4583-5GM-1GM-0GM.0, 110MRMS
Gemmeiza 10Maya74“S”/ON/1160-147/3/Bb/G11/4/chat“S”/5/crow“S”CGM5820-3GM-1GM-2GM-0GM110MSS

a0: nearly immune; 1: very resistant; 2: moderately resistant; 3: moderately resistant to moderately susceptible; and 4: very susceptible; brust severity (%); MR: moderately resistant; MS: moderately susceptible; S: susceptible.

Table 1

Sequences of the nucleotide primers used in this study.

Lr genePrimer codeSequence of primers (5′-3′)Size of amplified marker fragment (bp)
1313FGTGCCTGTGCCATCGTC324
13RCGAAAGTAACAGCGCAGTGA[31]

1919FCATCCTTGGGGACCTC300
19RCCAGCTCGCATACATCCA[32]

2424FTCTAGTCTGTACATGGGGGC100
24RTGGCACATGAACTCCATACG[33]

2626FCATCCTTGGGGACCTC260
26RCCAGCTCGCATACATCCA[34]

3434FGTGAAGCAGACCCAGAACAC253
34RGACGGCTGCGACGTAGAG[35]

3535FAGAGAGAGTAGAAGAGCTGC 252
35RAGAGAGAGAGCATCCACC [36]

3636FGCTGCATGAGCTCTGCAAT282
36RTCTGTGAGGCATGACAGAA[37]

3737FAGGGGCTACTGACCAAGGCT199
37RTGCAGCTACAGCAGTATGTACACAAAA[38]

3939FCCTGCTCTGCCCTAGATACG180
39RATGTGAATGTGATGCATGCA[39]

4646FAGG GAAAAGACATCTTTTTTT TC335
46RCGACCGACTTCGGGTTC[35]
Table 2

Amplification parameters for all primer sets used.

Lr geneCycle condition
1394°C 5 min., 30 cycles (94°C 1.5 min., 55°C 2 min., 72°C 1.5 min.), 72°C 5 min.
1994°C 4 min., 40 cycles (92°C 1 min., 60° 1 min., 72°C 2 min.), 72°C 5 min.
2494°C 5 min., 30 cycles (94°C 1.5 min., 55°C 2 min., 72°C 1.5 min.), 72°C 5 min.
2694°C 2 min., 35 cycles (94°C 30 s., 63°C 2 min., 72°C 1.5 min.), 72°C 5 min.
3494°C 5 min., 35 cycles (94°C 30 s., 65°C 2 min., 72°C 2 min.), 72°C 5 min.
3594°C 10 min., 35 cycles (94°C 1 min., 54°C 1 min., 72°C 2 min.), 72°C 5 min.
3694°C 5 min., 35 cycles (94°C 1 min., 57°C 1 min., 72°C 2 min.), 72°C 5 min.
3794°C 10 min., 40 cycles (94°C 1 min., 55°C 1 min., 72°C 1 min.), 72°C 10 min.
3994°C 4 min., 10 cycles (94°C 1 min., 64°C 1 min., 72°C 1 min.), 30 cycles 94°C 1 min., 55°C 1 min., 72°C 1 min.), 72°C 5 min.
4694°C 4 min., 40 cycles (94°C 1 min., 58°C 1 min., 72°C 1 min.), 72°C 10 min.

2.5. Electrophoresis

Amplification products were separated with 2% agarose gel (Applichem, Germany) in 1x TBE buffer and stained with ethidium bromide (0.5 μg/mL). The 10 μL PCR products were combined with 3 μL of loading buffer, which was added to prepare samples for agarose gel electrophoresis. PCR products were electrophoresed at 75 volt using an electrophoresis unit (WIDE mini-sub cell GT Bio-Rad), and determined with UV transilluminator.

2.6. Gel Analysis

The DNA was scanned for band Rf using gel documentation system (AAB Advanced American Biotechnology 1166E. Valencia Dr. Unit 6 c, Fullerton CA 92631). The different MW bands were determined against PCR marker Promega G 4521 50 bp DNA step ladder and Amresco 100 bp k180 by unweighted pair-group method based on arithmetic mean (UPGMA).

3. Results

3.1. Tested Cultivars and Resistance to Leaf Rust Disease

Resistance of the fifteen wheat cultivars to leaf rust isolates at seedling and adult plant stages is shown in Table 3. Some cultivars, that is, Giza 168, Sakha 94, and Gemmeiza 9, showed resistance at both stages; meanwhile, Giza 163, Giza 164, Giza 165, Sakha 69, and Gemmeiza 10 were resistant at seedling but susceptible at adult plant stage. The rest of the cultivars, that is, Sakha 61, Sakha 92, Sids 1, and Gemmeiza 7, were susceptible at both stages.

3.2. Leaf Rust Resistance Gene Efficacy

The efficiency of wheat genotypes carrying designated Lr genes, that is, Lr 13, Lr19, Lr24, Lr26, Lr34, Lr35, Lr36, Lr37, Lr39, and Lr46, was estimated at seedling and adult plant stages (Table 4). The result indicated that none of the tested Lr genes were effective. At adult stage (under field conditions) Lr34 (efficacy 100%) was the most effective gene, followed by Lr39 (85%), then Lr19 (75%) and Lr46 (60%). Lr's 13, 24, 26, and 37 were not effective under the Egyptian conditions.
Table 4

Efficacy % of the resistance genes for leaf rust disease at seedling and adult plant stages under the Egyptian conditions.

Lr geneEfficiency %
Seedling Adult
1327.52 0.00
1979.5575.0
2452.0725.0
2646.000.00
3464.22100.0
3732.8250.0
3985.0
4643.6360.0

3.3. Detection of Lr Genes with Molecular Markers

15 wheat cultivars, Giza (163, 164, 165, and 168), Sakha (8, 61, 69, 92, and 94), Sedes (1 and 2) and Gemmeiza (7, 9, and 10), were examined by using molecular markers for ten Lr genes (Lr13, Lr19, Lr24, Lr26, Lr34, Lr35, Lr36, Lr37, Lr39, and L 46) against the fungal pathogen of wheat (Figure 1). The size of amplified marker fragment is shown in Table 5 as Lr13, 19, 24, 26, 34, 35, 36, 37, 39, and 46 for 324 bp, 300 bp, 100 bp, 260 bp, 253 bp, 252 bp, 282 bp, 199 bp, 180 bp, and 335 bp, respectively. Data presented in Table 5 illustrates leaf rust resistance genes identified in the used selected cultivars. using molecular markers. Genes Lr13, Lr24, Lr34, and Lr36 were identified in all the cultivars used. Lr26 was identified in 93% also, Lr35 get same present, Lr39 was identified in 66% of the materials followed by Lr37 (53% of the materials). Lr46 was present in 26.6% of the cultivars and finally Lr19 was present in 33.3% of cultivars.
Figure 1

PCR amplification of 15 cultivars genomic DNA using ten Lr molecular marker. Lane M, 100pb marker; lane W, water as negative control; P, positive control; lane 1 Giza 163 cv, lane 2 Giza 164; lane 3, Giza 165; lane 4, Giza 167; lane 5, Giza 168; lane 6, Sakha 8; lane 7, Sakha 61, lane 8, Sakha 69; lane 9, Sakha 92; lane 10, Sakha 94; lane 11, Sids 1; lane 12, Sids 12; lane 13, Gemmeiza 7; lane 14, Gemmeiza 9, lane 15, Gemmeiza 10. (a) Lr13, (b) Lr19, (c) Lr24, (d) Lr26, (e) Lr34, (f) Lr35, (g) Lr36, (h) Lr37, (i) Lr39, and (j) Lr46.

Table 5

Presence of resistance genes to leaf rust in the wheat cultivars used.

Cultivar Lr genes
13192426343536373946
Giza 163++++++
Giza 164+++++++
Giza 165+++++++
Giza 167++++++++
Giza 168++++++++
Sakha 8+++++++
Sakha 61+++++++
Sakha 69++++++++
Sakha 92+++++++
Sakha 94++++++
Sids 1++++++++
Sids 12+++++++++
Gemmeiza 7+++++++++
Gemmeiza 9+++++++++
Gemmeiza 10+++++++++

(+) presence of gene; (−) absence of gene.

4. Discussion

Survey for wheat leaf rust in Egypt during many growing seasons, 2000–2012, indicated the presence of the disease incited by P. triticina in different governorates. Most of diseased samples were collected from farmer fields and trap nurseries [13, 14, 18, 19]. One of the most important steps in breeding programs for rust resistance in wheat is the identification of the prevailing physiological races in the region. Such program will be successful if all physiological isolates of the disease are included [9]. In recent years developments in molecular marker techniques and marker identification have facilitated the spread of molecular-assisted selection (MAS). This is particularly true in the field of breeding wheat for leaf rust resistance, where PCR-based markers are already available for almost half of the 60 or more designated resistance genes and alleles. Furthermore, all the effective resistance genes designated so far can be traced in segregating progeny populations by means of MAS. The genes Lr13, Lr24, Lr34, and Lr36 were the most common resistance genes that could be identified in the cultivars. Lr13 is probably the most widely distributed Lr gene in the world [20]. 58% of the European wheat genotypes tested carried Lr13 alone or in combination [21]. The gene was once considered to confer durable adult plant resistance but is now ineffective in several countries including Mexico [8]. Lr13 is still considered effective in combinations with other race-specific genes in Australia as the Lr13-virulent pathotype was avirulent on many other resistance genes [22]. However, in Egypt pathotypes contain virulence to Lr13 in combination with virulence on several important resistance genes and many vars. that carries Lr13 alone or in combination with other genes were susceptible in the field trails. As expected Lr34 was found in all tested cultivars, although this gene alone is capable of reducing the level of infection to almost half, as reported by [23]; resistance that is both excellent and durable can only be achieved if Lr34 is combined with 2 or 3 other genes [24]. Lr24 and Lr26 genes were identified in the tested cultivars but were not effective in Egypt. The resistance gene Lr26 is present on the rye segment in a T1BL-1RS wheat-rye translocation. The cultivars “Brigadier,” “Florida,” “Haven” and “Toronto,” show infection types corresponding to Lr26 and carry the T1BL-1RS translocation [25]. Moreover, it has become clear that virulence to Lr26 exists in Northern Europe [26]. Gene Lr37 showed intermediate resistance in Egypt. Gene Lr37 confers mainly adult plant resistance and is difficult to detect in seedling tests. The cultivars that seemed to carry Lr37 singly provided low seedling resistance and full adult plant resistance in Western Europe in 1996–1999 [22]. Most of the resistance genes included in the present study were detected in the Egyptian cultivars. The presence of Lr13 and Lr19 was confirmed by specific amplification of single fragments 324 and 300 bp. The resistance reaction to the rust pathotypes revealed the presence of Lr19 gene. Similarly, rust resistance genes Lr24 and Lr26 resulted in the amplification of the expected fragments 100 and 260 bp. The other resistance genes Lr34, 35, 36, 37, 39 and 46 show specific amplification fragments of 253, 252, 282, 199, 180, and 335 bp, respectively. Leaf rust resistance gene Lr19 has linkage with stem rust resistance gene Sr25 and a gene that causes yellowness of wheat flour [20]. The Lr24 gene is known to be linked to the Sr24 gene for resistance to stem rust, which is apparently effective against all races of stem rust [6] of study paving the way for marker-aided selection of rust resistance genes. The utility of such studies is further authenticated by other studies, where the presence of rust resistance genes was confirmed with molecular markers [27, 28]. Marker-assisted selection offers the opportunity to select desirable lines on the basis of genotype rather than phenotype, especially in the case of combining different genes in a single genotype. With the help of molecular marker, the pyramiding of leaf rust resistance genes, which are active at the seedling and/or adult stage, should facilitate more efficient breeding for durable resistance against this disease. The mechanism for durable resistance to leaf rust is poorly understood, but durability appears to be enhanced when genes are combined [29]. Experience gained so far suggests that markers flanking Lr genes can be used simply and effectively in marker-assisted backcross programmers. Nevertheless, as the linkage between markers and resistance genes is not complete, regular phenotypic monitoring will be required if satisfactory parental genotypes are to be selected. According to our earlier results [30] the ratio of false positive plants for the genes Lr9, Lr24, Lr25, and Lr29 were 1.3, 4.0, 9.5, and 7.6%, respectively. However, molecular markers can prove the presence of the requested resistance gene in the genetic background and in the case of plants carrying adult plant resistance genes like Lr35 and Lr37 this is the only way to choose appropriate parents for crossing programmer. The use of MAS, whereby breeders select molecular markers linked to Lr genes, enables the pyramiding of more than one effective resistance gene. With the help of molecular markers, resistance genes are easy to detect in wheat varieties of unknown parentage. This information can then be used to design crossing programmers.
  6 in total

1.  Leaf rust resistance genes of wheat: identification in cultivars and resistance sources.

Authors:  Lukasz Stepień; Lidia Golka; Jerzy Chełkowski
Journal:  J Appl Genet       Date:  2003       Impact factor: 3.240

2.  Mapping genes Lr53 and Yr35 on the short arm of chromosome 6B of common wheat with microsatellite markers and studies of their association with Lr36.

Authors:  N A Dadkhodaie; H Karaoglou; C R Wellings; R F Park
Journal:  Theor Appl Genet       Date:  2010-10-06       Impact factor: 5.699

3.  Molecular marker mapping of leaf rust resistance gene lr46 and its association with stripe rust resistance gene yr29 in wheat.

Authors:  M William; R P Singh; J Huerta-Espino; S Ortiz Islas; D Hoisington
Journal:  Phytopathology       Date:  2003-02       Impact factor: 4.025

4.  Identification of molecular markers linked to the Agropyron elongatum-derived leaf rust resistance gene Lr24 in wheat.

Authors:  G M Schachermayr; M M Messmer; C Feuillet; H Winzeler; M Winzeler; B Keller
Journal:  Theor Appl Genet       Date:  1995-06       Impact factor: 5.699

5.  Tagging and validation of a major quantitative trait locus for leaf rust resistance and leaf tip necrosis in winter wheat cultivar forno.

Authors:  T Schnurbusch; E Bossolini; M Messmer; B Keller
Journal:  Phytopathology       Date:  2004-10       Impact factor: 4.025

6.  Leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum) cultivars grown in Northern Europe 1992-2002.

Authors:  Shu-Chin Hysing; Ravi P Singh; Julio Huerta-Espino; Arnulf Merker; Erland Liljeroth; Oscar Diaz
Journal:  Hereditas       Date:  2006-12       Impact factor: 3.271

  6 in total
  6 in total

1.  Genome-Wide Screening of Broad-Spectrum Resistance to Leaf Rust (Puccinia triticina Eriks) in Spring Wheat (Triticum aestivum L.).

Authors:  Amira M I Mourad; Ibrahim S Draz; Ghady E Omar; Andreas Börner; Samar M Esmail
Journal:  Front Plant Sci       Date:  2022-06-22       Impact factor: 6.627

2.  Changes of Nitric Oxide and Its Relationship with H2O2 and Ca2+ in Defense Interactions between Wheat and Puccinia Triticina.

Authors:  Mei Qiao; Jiawei Sun; Na Liu; Tianjie Sun; Gang Liu; Shengfang Han; Chunyan Hou; Dongmei Wang
Journal:  PLoS One       Date:  2015-07-17       Impact factor: 3.240

Review 3.  Recent trends and perspectives of molecular markers against fungal diseases in wheat.

Authors:  Umesh Goutam; Sarvjeet Kukreja; Rakesh Yadav; Neha Salaria; Kajal Thakur; Aakash K Goyal
Journal:  Front Microbiol       Date:  2015-08-25       Impact factor: 5.640

4.  Microscopic and Molecular Characterization of the Prehaustorial Resistance against Wheat Leaf Rust (Puccinia triticina) in Einkorn (Triticum monococcum).

Authors:  Albrecht Serfling; Sven E Templer; Peter Winter; Frank Ordon
Journal:  Front Plant Sci       Date:  2016-11-09       Impact factor: 5.753

5.  Development of multiplex PCR to detect slow rust resistance genes Lr34 and Lr46 in wheat.

Authors:  Roksana Skowrońska; Michał Kwiatek; Agnieszka Tomkowiak; Jerzy Nawracała
Journal:  J Appl Genet       Date:  2019-09-10       Impact factor: 3.240

6.  Effectiveness of Leaf Rust Resistance Genes in the Adult and Juvenile Stages in Southern Russia in 2011-2020.

Authors:  Galina Volkova; Olga Kudinova; Olga Vaganova; Valeria Agapova
Journal:  Plants (Basel)       Date:  2022-03-16
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.