Literature DB >> 24499270

Melatonin modulates the autophagic response in acute liver failure induced by the rabbit hemorrhagic disease virus.

Beatriz San-Miguel1, Irene Crespo, Daniela Vallejo, Marcelino Álvarez, Jesús Prieto, Javier González-Gallego, María J Tuñón.   

Abstract

Autophagy is an important survival pathway and participates in the host response to infection. Beneficial effects of melatonin have been previously reported in an animal model of acute liver failure (ALF) induced by the rabbit hemorrhagic disease virus (RHDV). This study was aimed to investigate whether melatonin protection against liver injury induced by the RHDV associates to modulation of autophagy. Rabbits were infected with 2 × 10(4) hemagglutination units of a RHDV isolate and received 20 mg/kg melatonin at 0, 12, and 24 hr postinfection. RHDV induced autophagy, with increased expression of beclin-1, ubiquitin-like autophagy-related (Atg)5, Atg12, Atg16L1 and sequestrosome 1 (p62/SQSTM1), protein 1 light chain 3 (LC3) staining, and conversion of LC3-I to autophagosome-associated LC3-II. These effects reached a maximum at 24 hr postinfection, in parallel to extensive colocalization of LC3 and lysosome-associated membrane protein (LAMP)-1. The autophagic response induced by RHDV infection was significantly inhibited by melatonin administration. Melatonin treatment also resulted in decreased immunoreactivity for RHDV viral VP60 antigen and a significantly reduction in RHDV VP60 mRNA levels, oxidized to reduced glutathione ratio (GSSG/GSH), caspase-3 activity, and immunoglobulin-heavy-chain-binding protein (BiP) and CCAAT/enhancer-binding protein homologous protein (CHOP) expression. Results indicate that, in addition to its antioxidant and antiapoptotic effects, and the suppression of ER stress, melatonin induces a decrease in autophagy associated with RHDV infection and inhibits RHDV RNA replication. Results obtained reveal novel molecular pathways accounting for the protective effect of melatonin in this animal model of ALF.
© 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Entities:  

Keywords:  acute liver failure; autophagy; melatonin; rabbit hemorrhagic disease

Mesh:

Substances:

Year:  2014        PMID: 24499270      PMCID: PMC7166588          DOI: 10.1111/jpi.12124

Source DB:  PubMed          Journal:  J Pineal Res        ISSN: 0742-3098            Impact factor:   13.007


Introduction

Acute liver failure (ALF) (sometimes referred to as fulminant hepatic failure) is a clinical syndrome resulting from rapid loss in hepatocyte function, typically associated with coagulopathy and encephalopathy in patients without pre‐existing liver disease. Liver transplantation is the only therapy of proven benefit, but the rapidity of progression and the variable course of ALF limit its use 1. As a result, reproducible experimental animal models resembling the clinical conditions are still needed to test new therapeutic approaches, and ALF presents many challenging opportunities in basic research. Most common models are based on surgical techniques or the use of hepatotoxic drugs and very few satisfactory viral models are available 2. We have developed a viral model of ALF by means of the inoculation of rabbits with the virus of rabbit hemorrhagic disease (RHDV), which displays biochemical data, histological characteristics, and clinical features that resemble those in human ALF 3. In rabbits infected with RHDV melatonin inhibits oxidative damage, apoptotic mechanisms and endoplasmic reticulum (ER) stress 4, 5, 6, 7, which supports its potential therapeutic use in patients with ALF. A number of reports published in the last few years indicate that properties of the indol as a potent antioxidant, modulator of apoptosis and positive regulator of immune functions contribute to melatonin's antiviral actions 8. Autophagy is a catabolic process involving self‐degradation of cellular components via the lysosomal pathway which acts as survival mechanism and can participate in the host response to infection 9, 10. Autophagy is known to participate in both sensing oxidative stress and removing oxidatively damaged proteins and organelles 11, and plays a multifunctional role in host defense, by promoting pathogen clearance and modulating innate and adaptative immune responses 12. The process begins with the engulfment of bulk amounts of cytoplasm by double membrane vesicles, termed autophagosomes, which ultimately fuse with lysosomes, generating an autolysosome in which the constituent is subsequently degraded 13. At the molecular level the nucleation of the autophagosomal membrane is controlled by a molecular complex containing Bcl‐2‐interacting protein (beclin)‐1, which allows the production of phosphatidylinositol 3‐phosphate to occur 14. Conjugation of ubiquitin‐like autophagy‐related (Atg)12 to Atg5 and formation of a complex with Atg16L1 is required in the elongation of the autophagosome membrane. Autophagosome formation also requires the conversion of cytosolic‐associated protein light chain 3 (LC3)‐I to the membrane‐bound LC3‐II form. LC3 then binds to the adaptator protein p62 sequestrosome 1 (p62/SQSTM1) which, in addition to its role in cell proliferation, inflammation or oxidative stress, facilitates the autophagic degradation of ubiquitinated protein aggregates in lysosomes 13, 15. The interplay between autophagy and programmed cell death is complex, and recent data suggest the existence of a cross talk between autophagic and apoptotic pathways 16. Some studies have demonstrated that autophagy may have an active contribution to cell death in virus infected cells 17. However, there are also reports that autophagy can prolong survival of virus‐infected cells by counteracting the apoptotic response 18, 19. Given the well‐known regulatory effect that melatonin has on apoptotic cell death, and the dual capabilities of autophagy to induce survival or death depending on cellular stress 20, melatonin modulation of autophagy is currently under consideration 21, and the regulatory role of the indol on the process of autophagy deserves further careful studies. In this research, we analyzed whether melatonin administration modulates the autophagic response in RHDVinfected rabbits. Our findings provide evidence that reduction in liver damage by melatonin is associated with a lower RHDV RNA replication and a decrease in the incomplete autophagy induced by RHDV. Further elucidation of the role of autophagy and its relationship to oxidative stress and apoptosis in the pathogenesis of RHDV infection will help to a better knowledge of molecular mechanisms accounting for the protective effect of melatonin in this animal model of ALF.

Materials and methods

Virus and experimental model

Nine‐week‐old male New Zealand white rabbits were kept in the animal facility of the University of León with 12‐hr light cycle at 21–22°C and 50% relative humidity. They were given a standard dry rabbit food and water ad libitum. Effects of melatonin were studied by sacrificing control rabbits and batches of infected animals at 18, 24, 30 and 36 hr post infection (hpi). Infection was induced by i.m. injection of 2 × 104 hemagglutination units of an RHDV isolate 3, 4. Melatonin was given (20 mg/kg body weight i.p.) at 0, 12 and 24 hpi; untreated animals received 4 mL of vehicle at 0, 12 and 24 hpi. Melatonin (Sigma, St Louis, MO, USA) was dissolved into absolute ethanol and further dilutions were made in saline. The final concentration of ethanol was 5%. The study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health, and was specifically approved by the Ethics Committee of the University of León.

Real‐time RT‐PCR

Total RNA was extracted from frozen rabbit liver using a Trizol reagent (Life Technologies, Madrid, Spain) and quantified using a Nano Drop1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Residual genomic DNA was removed by incubating RNA with RQ1 RNase‐free DNase (Promega, Madison, WI, USA). RNA integrity was confirmed by formaldehyde gel electrophoresis. Total RNA (1 μg) was reverse transcribed as described 7 and mRNA was determined by real‐time PCR analysis using SYBR Green I Master (Roche Diagnostics GmbH, Mannheim, Germany) and the appropriate primers (Table 1). Relative changes in gene expression levels were determined using the method 22. The cycle number at which the transcripts were detectable (Ct) was normalized to the cycle number of β‐Actin gene detection, referred to as ΔCt.
Table 1

Primers used in this study

GeneSense primer (5'‐3')Antisense primer (5'‐3')
Beclin‐1CATGCAATGGTGGCTTTCCTCTCGCCCTTTTCAACCTCTT
Atg5CGTCCTGTGGCTGCAGATGAAGGACACACTTCTTTGAGGAGATC
Atg12TGCTGAAGGCTGTGGGAGATTGTTCGCTCTACAGCCCATTT
Atg16L1CCACCAAACCGGCATGAGCTTGCAGCTGGCTGTCATTC
p62/SQSTM1AACAGAGGTGACCACCCTTCAAGCACAGACTGGCTGGAAGTC
RHDVTAGCCCAACAGAAGCACAAGAAACAAGTCGTCAACCTCCC
BiPATTGACAATGGTGTCTTCGAAGTCCCCCGCCCAGGTGAGT
CHOPATACATCACCACACCTGAAAGCAGCACTCGGCTGCCATCTC
β‐ActinTGGCATCCTGACGCTCAATCGTCCCAGTTGGTCACGAT
Primers used in this study

Western blot analysis

For Western blot analysis, liver tissue (25 mg) was homogenized in 1 mL RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche Diagnostics GmbH), maintaining temperature at 4°C throughout all procedures. Then the homogenate was incubated on ice for 30 min and finally the samples were centrifuged at 13,000 g for 30 min at 4°C. The supernatant fraction was stored at −80°C in aliquots until use. Nuclear extracts were prepared from liver homogenates as described previously 23. Briefly, 100 mg of liver from all animals was homogenized in 5 × 10−4 L of buffer A (0.01 m HepesKOH pH 7.9, 250 g/L glycerol, 0.420 m NaCl, 0.0015 m MgCl2, 2 × 10−4  m EDTA, 5 × 10−4 m DTT, 2 × 10−4 m PMSF) and a phosphatase inhibitor cocktail (Roche Diagnostics GmbH) to disrupt extracellular matrix and cellular membranes. Homogenates were centrifuged at 1000 g for 10 min at 4°C. The pellet was resuspended in 2.5 × 10−4 L of buffer B (0.02 m NaCl HepesKOH pH 7.9, 250 g/L glycerol, 0.042 m NaCl, 15 × 10−4 m PMSF), homogenized, and incubated at 4°C for 30 min. Cellular debris was removed by centrifugation at 14,000 g for 15 min at 4°C. The supernatant fraction containing DNA binding proteins was recollected and stored at −80°C in aliquots until use. Protein concentration was measured by Bradford assay. Equal amounts of protein extracts (10–50 μg) were separated by 7–12% sodium dodecyl sulfate (SDS)‐polyacrylamide gel electrophoresis and transferred electrically to polyvinyllidene difluoride membranes (Millipore, Bedford, MA). The membranes were then blocked with 5% nonfat dry milk in Tris‐buffered saline containing 0.05% Tween 20 (TBST) for 30 min at 37°C and probed overnight at 4°C with polyclonal anti‐p62/SQSTM1, poly(ADP‐ribose)polymerase‐1 (PARP‐1) and IRF7 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), phospho‐IRF7 (Cell Signaling Technology, Danvers, MA, USA) and LC3‐I/II (Abcam, Cambridge, UK) antibodies at 1:200–1:1000 dilution with PBST containing 2.5% nonfat dry milk. Equal loading of protein was demonstrated by probing the membranes with a rabbit anti‐β‐Actin polyclonal antibody (1:2000; Sigma) and a rabbit anti‐Lamin‐B polyclonal antibody (1:200; Santa Cruz Biotechnology). After washing with TBST, the membranes were incubated for 1 hr at room temperature with secondary HRP conjugated antibody (1:5000; Dako, Glostrup, Denmark), and visualized using ECL detection kit (Amersham Pharmacia, Uppsala, Sweden) 7. The density of the specific bands was quantified with an imaging densitometer (Scion Image J Software 1.46a, Bethesda, MD, USA).

Immunohistochemistry

Tissue samples were recovered, fixed in 10% buffered formalin and embedded in paraffin. Sections (4 μm) were dewaxed and hydrated through graded ethanol, cooked in 25 mm citrate buffer, pH 6.0, in a pressure cooker for 10 min, transferred into boiling deionized water and let to cool for 20 min. Tissue sections were then treated with 3% hydrogen peroxide to inactivate endogenous peroxidase activity. The slides were incubated with rabbit anti‐VP60 antibodies (Ingenasa, Madrid, Spain) overnight at 4°C. Subsequently, the sections were incubated for 30 min using the EnVision+ system and developed with a solution of 3‐3‐diaminobenzidine (DAB) (Vector Lab, Burlingame, CA, USA). The slides were stained with hematoxylin for 10 s and mounted. The specificity of the technique was evaluated by negative controls (omitting the incubation with the primary antibody and incubating it with nonimmune sera).

Double immunofluorescence

For immunofluorescent double staining sections were dewaxed in xylene and rehydrated in graded ethanol to distilled water, do not allowing slides to dry at any time during this process. Heat mediated antigen was performed in a cooker filled with 1 mm EDTA (pH = 8). Sections were brought to a boil and then maintain at a sub‐boiling temperature for 15 min. All subsequent incubations with immunochemicals were performed in a humidified chamber. After unmasking and after blocking the nonspecific binding the sections were co‐incubated with the LAMP‐1 antibody (Santa Cruz Biotechnology) and LC3 (Abcam) (at 1:50 and 1:200 dilution, respectively) overnight at 4°C. After incubation with primary antibodies, samples were washed twice in PBS for 10 min at room temperature. Thereafter, the secondary antibodies donkey anti‐rabbit conjugated with FITC and donkey anti‐mouse conjugated with Dylight™549 (Jackson Immuno‐Research, Baltimore, PA, USA) were applied for 2 hr at 21°C. After washing in TBS, the coverslips were mounted on Dako Cytomation Fluorescent Mounting Medium (Dako). In sections from each experimental group, the primary antibody was replaced by antibody diluent to assess for nonspecific binding of the secondary antibody 7. The preparations were analyzed with an inverted fluorescent microscope (Nikon Eclipse Ti, Tokyo, Japan).

Measurement of oxidized and reduced glutathione

Oxidized and reduced glutathione (GSSG and GSH, respectively) analysis was performed by the method of Hissin and Hilf 24, homogenizing 250 mg of tissue in 0.1 m sodium phosphate 5 mm EDTA buffer (pH 8.0) with 25% phosphoric acid at a proportion of 1:20.

Caspase‐3 activity

Lysates were prepared by homogenizing liver tissue in 0.25 mM sucrose, 1 mM EDTA, 10 mM Tris and a protease inhibitor cocktail (Roche Diagnostics GmbH). The lysates were then centrifuged at 14,000 g for 10 min at 4°C, and supernatants (50 μg protein) were incubated for 1 hr at 37°C in HEPES buffer containing 100 μM concentrations of the specific fluorogenic substrate 7‐amino‐4‐methylcoumarin N‐acetyl‐L‐aspartyl‐Lglutamyl‐L‐valyl‐l‐aspartic acid amide (DEVD‐AMC). Cleavage of the caspase substrate was monitored using a spectrofluorimeter (Hitachi F‐2000 fluorimeter, Hitachi LTD, Tokyo, Japan) at excitation/emission wavelengths of 380/460 nm. Activity was expressed as fluorescence units per milligram of protein per minute of incubation.

Statistical analysis

Results are expressed as mean values ± standard error of the mean (S.E.M.). Data were compared by analysis of variance (ANOVA); when the analysis indicated the presence of a significant difference, the means were compared with the Newman‐Keul's test. Significance was accepted when P was <0.05. Values were analyzed using the statistical package SPSS 19.0 (IBM Corporation, Armonk, NY, USA).

Results

To determine the presence of the virus in the liver of rabbits infected with the RHDV viral VP60 antigen was examined by immunohistochemical techniques. Data obtained indicate a progressive increase in the extent of labeling in RHDVinfected animals which reached a maximum at 36 hpi (Fig. 1A,B) in parallel to the increase in RHDV mRNA level (Fig. 1C). Melatonin treatment resulted in decreased immunoreactivity and significantly reduced RHDV mRNA expression (Fig. 1A–C), revealing an inhibitory role of the indol on RHDV replication. Viral replication associated to increased expression of the phosphorylated form of IRF7, a master regulator of type I‐interferon‐dependent innate immunity, and this effect was not modified by melatonin administration (Fig. 1D).
Figure 1

Expression of the capsid protein VP60 and IRF7 in rabbit hemorrhagic disease virus (RHDV)‐infected and melatonin‐treated rabbits. (A,B) VP60 immunohistochemical labeling in hepatocytes: (a,f) Control, (b,g) 18 hpi; (c,h) 24 hpi; (d,i) 30 hpi; (e,j) 36 hpi. Paraffin‐embedded sections were immunostained with a VP60 antibody. Original magnification: 200×. Data are presented as percentage change from the control group. Image analysis was performed using the ImageJ software v3.91 (http://rsbweb.nih.gov/ij/). (C) Levels of VP60 mRNA analyzed by real‐time PCR assay and normalized against β‐Actin. Values are expressed as means ±  S.E.M. (n = 6). a < 0.05, compared with Control, b < 0.05, compared with RHDV, same period. (D) Western blot of IRF7. Proteins from liver extracts were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by β‐Actin bands.

Expression of the capsid protein VP60 and IRF7 in rabbit hemorrhagic disease virus (RHDV)‐infected and melatonin‐treated rabbits. (A,B) VP60 immunohistochemical labeling in hepatocytes: (a,f) Control, (b,g) 18 hpi; (c,h) 24 hpi; (d,i) 30 hpi; (e,j) 36 hpi. Paraffin‐embedded sections were immunostained with a VP60 antibody. Original magnification: 200×. Data are presented as percentage change from the control group. Image analysis was performed using the ImageJ software v3.91 (http://rsbweb.nih.gov/ij/). (C) Levels of VP60 mRNA analyzed by real‐time PCR assay and normalized against β‐Actin. Values are expressed as means ±  S.E.M. (n = 6). a < 0.05, compared with Control, b < 0.05, compared with RHDV, same period. (D) Western blot of IRF7. Proteins from liver extracts were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by β‐Actin bands. Autophagy activation by RHDV infection was confirmed by the significant increase of beclin‐1 expression and the upregulation of components of the Atg12Atg5Atg16L1 complex at 18–24 hpi (Table 2). Another frequently used autophagy marker is LC3, which is converted from the cytosolic form LC3‐I to the lapidated form LC3‐II. Western blot data indicate that LC3‐II expression increased markedly at 18–24 hpi, with a maximum rise of LC3‐II/LC3‐I ratio at 24 hpi, which suggests that RHDV could be blocking the autophagic process in liver cells at early postinfection periods (Fig. 2A). Effects on LC3 expression can reflect aggregated effects of induced autophagosome synthesis, decreased fusion with lysosomes and/or suppression of proteolytic turnover in the autophagolysosomes. Immunoflourescence analysis showed spots of green fluorescence which reached a maximum at 24 hpi, suggesting an elevated turnover of autophagosomes (Fig. 2B). At 18 hpi, there was little colocalization between LC3 and the lysosomal marker LAMP‐1, but extensive overlap was observed at 24 hpi, presumably due to increased accumulation of autophagolysosomes. However, the parallel increase in p62/SQSTM1 mRNA levels (Table 2) may reflect a dysfunctional autophagy with impairment of the autophagic flux. The autophagic response in RHDVinfected rabbits was partially inhibited by melatonin treatment, as shown by the reduced LC3 immunofluorescent staining (Fig. 2B), the decrease in LC3‐II protein expression (Fig. 2A), and the diminished mRNA expression of beclin‐1, Atg5, Atg12 and Atg16L1 (Table 2).
Table 2

Effect of rabbit hemorrhagic disease virus (RHDV) infection and melatonin on mRNA levels of genes related to autophagy and ER stress

ControlRHDV18RHDV18 + MelRHDV24RHDV24 + MelRHDV30RHDV30 + MelRHDV36RHDV36 + Mel
Beclin‐1100 ± 8222 ± 12 a 177 ± 16 a , b 234 ± 16 a 94 ± 7 b 143 ± 7 a 87 ± 7 b 87 ± 768 ± 7 a , b
Atg5100 ± 4170 ± 20 a 141 ± 6 a 149 ± 24 a 70 ± 8 a , b 129 ± 5 a 78 ± 5 a , b 95 ± 549 ± 5 a , b
Atg12100 ± 12193 ± 10 a 177 ± 9 a 135 ± 7 a 94 ± 8 b 89 ± 643 ± 7 a , b 91 ± 753 ± 7 a , b
Atg16L1100 ± 5177 ± 11 a 103 ± 12 b 114 ± 957 ± 9 a , b 86 ± 649 ± 9 a , b 80 ± 1038 ± 9 a , b
p62/SQSTM1100 ± 4134 ± 7 a 92 ± 13 b 158 ± 12 a 108 ± 6 b 130 ± 10 a 75 ± 6 a , b 81 ± 4 a 53 ± 5 a , b
BiP100 ± 6264 ± 8 a 231 ± 9 a 302 ± 6 a 234 ± 7 a , b 216 ± 12 a 136 ± 15 a , b 129 ± 10 a 79 ± 9 a , b
CHOP100 ± 7389 ± 13 a 312 ± 24 a , b 672 ± 9 a 264 ± 4 a , b 244 ± 9 a 136 ± 18 a , b 114 ± 490 ± 7 a

Levels of mRNA were analyzed by real‐time PCR assays. Data, normalized against β‐Actin, are presented as percentage change from the control group. Values are expressed as means± S.E.M. (n = 6). a P < 0.05, compared with Control, b P < 0.05 compared with RHDV, same period.

Figure 2

Markers of autophagy in rabbit hemorrhagic disease virus (RHDV)‐infected and melatonin‐treated rabbits. (A) Western blot of LC3. Proteins from liver extracts were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by β‐Actin bands. The graph shows the LC3‐II/LC3‐I ratio. Values are expressed as means ±  S.E.M. (n = 6). a < 0.05, compared with Control, b < 0.05, compared with RHDV, same period. (B) Colocalization of LC3 and LAMP‐1 by immunofluorescence analysis. In the left panels LAMP‐1 positive staining (red fluorescence); in middle panels positive staining of LC3 (green fluorescence); right panels show the merge of two fluorescences.

Effect of rabbit hemorrhagic disease virus (RHDV) infection and melatonin on mRNA levels of genes related to autophagy and ER stress Levels of mRNA were analyzed by real‐time PCR assays. Data, normalized against β‐Actin, are presented as percentage change from the control group. Values are expressed as means± S.E.M. (n = 6). a P < 0.05, compared with Control, b P < 0.05 compared with RHDV, same period. Markers of autophagy in rabbit hemorrhagic disease virus (RHDV)‐infected and melatonin‐treated rabbits. (A) Western blot of LC3. Proteins from liver extracts were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by β‐Actin bands. The graph shows the LC3‐II/LC3‐I ratio. Values are expressed as means ±  S.E.M. (n = 6). a < 0.05, compared with Control, b < 0.05, compared with RHDV, same period. (B) Colocalization of LC3 and LAMP‐1 by immunofluorescence analysis. In the left panels LAMP‐1 positive staining (red fluorescence); in middle panels positive staining of LC3 (green fluorescence); right panels show the merge of two fluorescences. Endoplasmic reticulum (ER) stress has been reported to induce the accumulation of autophagosomes, and autophagy may be an important part of normal ER function 25. We have previously reported that melatonin treatment inhibits ER stress at 36 hpi in RHDVinfected rabbits 7. During ER stress different transcription factors regulate the expression of ER chaperones that enhance the folding capacity of the ER, including CCAAT/enhancer‐binding protein homologous protein (CHOP) and immunoglobulin‐heavy‐chain‐binding protein (BiP/GRP78). As expected, mRNA levels for both chaperones increased following RHDV infection, with a maximum at 24 hpi, and this effect was significantly inhibited by melatonin administration (Table 2). As previously reported 26, melatonin prevented the significant increase in the GSSG/GSH ratio observed in RHDVinfected rabbits (Fig. 3A). Data obtained also confirmed the already described effect of melatonin on apoptotic death induced by RHDV 6; both activation of caspase‐3, the common event initiated by multiple different stimuli that induces apoptosis, and proteolysis of PARP‐1, a nuclear enzyme cleavaged into a 85‐kDA fragment by caspase‐3 27, increased significantly at 30 and 36 hpi, and these effects were significantly prevented by melatonin treatment (Fig. 3B,C).
Figure 3

Markers of oxidative stress and apoptosis in rabbit hemorrhagic disease virus (RHDV)‐infected and melatonin‐treated rabbits. (A) Oxidized to reduced glutathione ratio (GSSG/GSH) in hepatic tissue. (B) Liver activity of caspase‐3. Samples were incubated with the specific fluorogenic substrate Ac‐DEVD‐AMC. (C) Western blot of PARP‐1. Proteins from liver extracts were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by Lamin B bands. The graph shows densitometric quantification. Values are expressed as means ± S.E.M. (n = 6). a < 0.05, compared with Control, b < 0.05, compared with RHDV, same period.

Markers of oxidative stress and apoptosis in rabbit hemorrhagic disease virus (RHDV)‐infected and melatonin‐treated rabbits. (A) Oxidized to reduced glutathione ratio (GSSG/GSH) in hepatic tissue. (B) Liver activity of caspase‐3. Samples were incubated with the specific fluorogenic substrate Ac‐DEVD‐AMC. (C) Western blot of PARP‐1. Proteins from liver extracts were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by Lamin B bands. The graph shows densitometric quantification. Values are expressed as means ± S.E.M. (n = 6). a < 0.05, compared with Control, b < 0.05, compared with RHDV, same period.

Discussion

Results from this study demonstrate that RHDV induced autophagosome and autophagolysosome formation, with increased expression of beclin‐1, LC3‐II/LC‐I ratio and Atg5Atg12Atg16L1, and colocalization of LC3 and LAMP‐1. The parallel increase in p62/SQSTM1 expression may reflect a dysfunctional autophagy similar to the previous reports following infection of liver cells by other RNA viruses 28, 29. Data obtained also indicate that the RHDV‐induced autophagic response was inhibited by melatonin administration. Mechanisms through which viruses induce autophagy remain unclear. One of the typical stress responses initiated by viral infection is ER stress, which down‐regulates protein synthesis through the three branches of the unfolded protein response (UPR). During ER stress, different transcription factors regulate the expression of ER chaperones, such as CHOP and BiP, which enhance the folding capacity of the ER 7. It is known that sensors of the UPR control signal‐transduction pathways leading to the transcription of autophagic genes 30, and viruses capable of inducing ER stress have the potential to induce an autophagic response. Thus, previous studies have demonstrated that autophagy is associated to ER stress in HCV infection, and that persistent induction of ER stress and incomplete activation of autophagy play an important role in HCV pathogenesis 28, 31. In addition, a newer hypothesis that is gaining support is that autophagic activities are sensitive to oxidative stress and to the generation of reactive species 11. Indeed, a recent research has shown that oxidative stress triggers the accumulation of autophagic compartments without increasing the degradation of long‐lived proteins in human neuroblastoma cells infected by herpes simplex virus type 1 infection 32. Moreover, it has been reported that in MEF cells infected with the Chikungunya virus, independent induction of ER and oxidative stress pathways triggers autophagy through the inhibition of the mammalian target of rapamycin (mTOR) 18. Therefore, the previously reported reduction of oxidative stress and ER stress by melatonin 7, 26, confirmed in this research through the decrease in CHOP and BiP expression and the increase in the GSSG/GSH ratio, could contribute to the inhibitory effect of the indol on the autophagic response induced by viral infection. In our research, the autophagic activity induced by the RHDV declined in late periods of infection (30–36 hpi) in parallel to the increase in apoptosis. Different studies have previously shown that virally induced autophagy is capable of preventing the early apoptotic death of cells 33, which suggests that autophagy might contribute to limit the cytopathic effect of viruses and the pathological consequences associated with cell death triggered by viral infection. This regulation of programmed cell death by autophagy could also be present in RHDVinfected hepatocytes. However, mechanisms responsible for the regulation of apoptosis by autophagy and for the overhelming of the apoptotic response by the inhibitory effect of autophagy remain unknown. Melatonin is able to induce or inhibit autophagy based on cellular necessities and oxidative stress levels. There are reports that autophagy and survival are significantly enhanced in ischemic N2a cells treated with melatonin 34, and melatonin‐induced autophagy protects against human prion protein‐mediated neurotoxicity 35. Moreover, melatonin induces autophagy and results in the effective removal of mutant‐TGFBIp from granular corneal dystroph type 2 fibroblasts 36. In contrast, melatonin is known to protect HeLa cells from rotenone‐induced cell injury via inhibition of autophagy 37, to suppress cyclosporine A‐induced autophagy in rat pituitary GH3 cells 38, to inhibit kainic acid‐induce neurotoxicity in mouse hippocampus via inhibition of autophagy 39, and to attenuate methamphetamine‐induced autophagy 40. Consistent with studies which report parallel inhibition of autophagic processes and programmed cell death, in the present experiments both autophagy and apoptosis were significantly inhibited by melatonin. These effects of the indol could be the consequence of its antioxidant action, which may directly antagonize mechanisms contributing both to the intrinsic and extrinsic pathways of apoptosis 6, but also result in the inhibition of ER stress and, in turn, in diminished autophagic and apoptotic responses. An additional interesting fact concerns the inhibition of RHDV induced by melatonin. The role of autophagy in relation to viral replication is dual and it may be beneficial to virus or host. Thus, although autophagy may be a cellular mechanism to clear viral infection, and its inhibition results in an increased replication and virulence of herpex simplex virus 1 (HSV1) or vesicular stomatitis virus (VSV), different viruses appear to use this response to enhance their own replication. It has been reported that the double membrane of the autophagosome supports poliovirus replication 41, the autophagic machinery is used for coronaviruses replication 42, HCV uses autophagy for the early protein translation 43, and Dengue virus activate autophagy to elevate viral replication 44. Moreover, it is known that ER stress may play a positive role in HCV RNA replication through activation of autophagy, because siRNAs directed against sensors of the different branches of the UPR suppress HCV‐induced lipidation of LC3, required for formation of autophagosomes, and reduce HCV RNA levels 28. It has also been reported that inhibitors of X‐box binding protein‐1 (XBP‐1), one of the ER stress mediators, inhibit in parallel HCV viral replication and autophagy in hepatoma cells 45. Therefore, data obtained in this study could indicate that the decrease in RHDV RNA replication in melatonin‐treated rabbits is a consequence, at least in part, of its negative effect on ER stress and on the autophagic response. Both HCV and Dengue virus are known to exploit the UPR‐autophagy pathway to promote replication by suppressing innate antiviral immunity 46, 47, and a number of in vitro and in vivo studies have documented that melatonin plays a role in innate immunity 48. However, in our experiments expression of the phosphorylated form of IRF7, a potent type I interferon inducer capable of modulating viral propagation in infected hepatocytes 49, increased in RHDVinfected rabbits and was not modified by melatonin. This suggests that RHDV is not able to abrogate type I interferon‐dependent immune responses, and inhibition of viral replication by melatonin is probably unrelated to induction of innate immunity. In conclusion, results from this study indicate that in addition to its anti‐oxidant and anti‐apoptotic effects, and the suppression of ER stress, melatonin induces a decrease in the autophagy associated with RHDV infection and inhibits RHDV RNA replication. Understanding the mechanisms behind the interplay of RHDV‐induced autophagy with oxidative stress, ER stress and apoptosis may help to identify molecular pathways accounting for the protective effect of melatonin in this animal model of ALF.
  49 in total

Review 1.  Role of melatonin in the regulation of autophagy and mitophagy: a review.

Authors:  Ana Coto-Montes; Jose Antonio Boga; Sergio Rosales-Corral; Lorena Fuentes-Broto; Dun-Xian Tan; Russel J Reiter
Journal:  Mol Cell Endocrinol       Date:  2012-05-01       Impact factor: 4.102

Review 2.  The role and therapeutic potential of autophagy modulation in controlling virus-induced cell death.

Authors:  Gordana Tovilovic; Biljana Ristic; Marina Milenkovic; Maja Stanojevic; Vladimir Trajkovic
Journal:  Med Res Rev       Date:  2013-09-30       Impact factor: 12.944

3.  Hepatitis C virus inhibits AKT-tuberous sclerosis complex (TSC), the mechanistic target of rapamycin (MTOR) pathway, through endoplasmic reticulum stress to induce autophagy.

Authors:  He Huang; Rongyan Kang; Ji Wang; Guangxiang Luo; Wei Yang; Zhendong Zhao
Journal:  Autophagy       Date:  2012-11-20       Impact factor: 16.016

4.  Activation of the unfolded protein response and autophagy after hepatitis C virus infection suppresses innate antiviral immunity in vitro.

Authors:  Po-Yuan Ke; Steve S-L Chen
Journal:  J Clin Invest       Date:  2010-12-06       Impact factor: 14.808

5.  Pathogenic molecular mechanisms in an animal model of fulminant hepatic failure: rabbit hemorrhagic viral disease.

Authors:  Sonia Sánchez-Campos; Marcelino Alvarez; Jesus M Culebras; Javier Gonzalez-Gallego; Maria J Tuñón
Journal:  J Lab Clin Med       Date:  2004-10

6.  Modification of cellular autophagy protein LC3 by poliovirus.

Authors:  Matthew P Taylor; Karla Kirkegaard
Journal:  J Virol       Date:  2007-09-05       Impact factor: 5.103

Review 7.  An overview of animal models for investigating the pathogenesis and therapeutic strategies in acute hepatic failure.

Authors:  María-Jesús Tuñón; Marcelino Alvarez; Jesús-M Culebras; Javier González-Gallego
Journal:  World J Gastroenterol       Date:  2009-07-07       Impact factor: 5.742

Review 8.  Autophagy, immunity, and microbial adaptations.

Authors:  Vojo Deretic; Beth Levine
Journal:  Cell Host Microbe       Date:  2009-06-18       Impact factor: 21.023

Review 9.  Involvement of autophagy in coronavirus replication.

Authors:  Helena J Maier; Paul Britton
Journal:  Viruses       Date:  2012-11-30       Impact factor: 5.048

10.  Unfolded protein response pathways regulate Hepatitis C virus replication via modulation of autophagy.

Authors:  Yoshiyasu Shinohara; Kento Imajo; Masato Yoneda; Wataru Tomeno; Yuji Ogawa; Hiroyuki Kirikoshi; Kengo Funakoshi; Masanori Ikeda; Nobuyuki Kato; Atsushi Nakajima; Satoru Saito
Journal:  Biochem Biophys Res Commun       Date:  2013-02-06       Impact factor: 3.575

View more
  19 in total

1.  Hyperthermia enhances the sensitivity of pancreatic cancer SW1990 cells to gemcitabine through ROS/JNK signaling.

Authors:  Hangbin Jin; Yanyan Zhao; Jianfeng Yang; Xiaofeng Zhang; Shenglin Ma
Journal:  Oncol Lett       Date:  2018-09-18       Impact factor: 2.967

2.  Ceramide metabolism regulates autophagy and apoptotic cell death induced by melatonin in liver cancer cells.

Authors:  Raquel Ordoñez; Anna Fernández; Néstor Prieto-Domínguez; Laura Martínez; Carmen García-Ruiz; José C Fernández-Checa; José L Mauriz; Javier González-Gallego
Journal:  J Pineal Res       Date:  2015-06-08       Impact factor: 13.007

3.  Melatonin-induced increase in sensitivity of human hepatocellular carcinoma cells to sorafenib is associated with reactive oxygen species production and mitophagy.

Authors:  Néstor Prieto-Domínguez; Raquel Ordóñez; Anna Fernández; Carolina Méndez-Blanco; Anna Baulies; Carmen Garcia-Ruiz; José C Fernández-Checa; José L Mauriz; Javier González-Gallego
Journal:  J Pineal Res       Date:  2016-08-19       Impact factor: 13.007

Review 4.  Snapshot: implications for melatonin in endoplasmic reticulum homeostasis.

Authors:  Wei Hu; Zhiqiang Ma; Shouyin Di; Shuai Jiang; Yue Li; Chongxi Fan; Yang Yang; Dongjin Wang
Journal:  Br J Pharmacol       Date:  2016-11-16       Impact factor: 8.739

5.  Effects of aerobic training on markers of autophagy in the elderly.

Authors:  Yubisay Mejías-Peña; Paula Rodriguez-Miguelez; Rodrigo Fernandez-Gonzalo; Susana Martínez-Flórez; Mar Almar; José A de Paz; María J Cuevas; Javier González-Gallego
Journal:  Age (Dordr)       Date:  2016-03-03

Review 6.  Autophagy in farm animals: current knowledge and future challenges.

Authors:  Sophie Tesseraud; Pascale Avril; Muriel Bonnet; Anne Bonnieu; Isabelle Cassar-Malek; Béatrice Chabi; Frédéric Dessauge; Jean-Charles Gabillard; Marie-Hélène Perruchot; Iban Seiliez
Journal:  Autophagy       Date:  2020-07-30       Impact factor: 16.016

7.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

Review 8.  Melatonin in Early Treatment for COVID-19: A Narrative Review of Current Evidence and Possible Efficacy.

Authors:  Kristina M Cross; Dylan M Landis; Laveena Sehgal; J Drew Payne
Journal:  Endocr Pract       Date:  2021-06-10       Impact factor: 3.443

Review 9.  Modulation of Autophagy by Sorafenib: Effects on Treatment Response.

Authors:  Nestor Prieto-Domínguez; Raquel Ordóñez; Anna Fernández; Andres García-Palomo; Jordi Muntané; Javier González-Gallego; José L Mauriz
Journal:  Front Pharmacol       Date:  2016-06-08       Impact factor: 5.810

10.  Melatonin Suppresses Autophagy Induced by Clinostat in Preosteoblast MC3T3-E1 Cells.

Authors:  Yeong-Min Yoo; Tae-Young Han; Han Sung Kim
Journal:  Int J Mol Sci       Date:  2016-04-08       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.