Literature DB >> 24497543

Identification of Redeye, a new sleep-regulating protein whose expression is modulated by sleep amount.

Mi Shi1, Zhifeng Yue, Alexandre Kuryatov, Jon M Lindstrom, Amita Sehgal.   

Abstract

In this study, we report a new protein involved in the homeostatic regulation of sleep in Drosophila. We conducted a forward genetic screen of chemically mutagenized flies to identify short-sleeping mutants and found one, redeye (rye) that shows a severe reduction of sleep length. Cloning of rye reveals that it encodes a nicotinic acetylcholine receptor α subunit required for Drosophila sleep. Levels of RYE oscillate in light-dark cycles and peak at times of daily sleep. Cycling of RYE is independent of a functional circadian clock, but rather depends upon the sleep homeostat, as protein levels are up-regulated in short-sleeping mutants and also in wild type animals following sleep deprivation. We propose that the homeostatic drive to sleep increases levels of RYE, which responds to this drive by promoting sleep. DOI: http://dx.doi.org/10.7554/eLife.01473.001.

Entities:  

Keywords:  Sleepless/Lynx-1; acetylcholine signaling; cycling; sleep

Mesh:

Substances:

Year:  2014        PMID: 24497543      PMCID: PMC3912633          DOI: 10.7554/eLife.01473

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Sleep is a common and prominent behavior in almost all vertebrate animals and also in most invertebrates (Cirelli, 2009; Sehgal and Mignot, 2011). The function of sleep is a mystery, but it is surely of great importance to animals, as prolonged sleep deprivation can lead to death. Anatomical studies in mammals and birds have revealed brain structures and neurotransmitters that regulate sleep and wakefulness (Saper et al., 2010). However, our understanding of the molecular mechanisms that drive the need to sleep is still in its infancy, partially due to the challenge of performing genetic experiments with mammalian models. In the past decade, several premier genetic organisms have been introduced into the sleep field, including fruit flies, worms and zebra fish. Mammalian counterparts of some sleep components identified in these model animals also regulate sleep (Joho et al., 2006), which argues that (i) behavioral genetics in lower organisms provides an efficient tool to identify sleep components, (ii) at least some of the mechanisms underlying sleep are conserved through evolution. A two-process model for sleep regulation has been widely accepted by the sleep field. Process C (the circadian clock) controls the timing, in other words the onset and offset of sleep, whereas process S (the sleep homeostat) regulates sleep duration based on the sleep pressure built up during prior wakefulness (Borbely, 1982). This simple model explains sleep related phenomena, including sleep rebound after sleep deprivation. Molecular mechanisms of circadian control have been well characterized (Zheng and Sehgal, 2012), but, as noted above, relatively little is known about process S. Forward genetic screens in Drosophila have led to the identification of several mutants with altered sleep length, but while the genes implicated by these mutants are required for implementation of sleep drive, they have not yet been directly linked to this drive (Sehgal and Mignot, 2011). Using a forward genetic screen, we identified a new sleep mutant we termed redeye (rye), which is directly controlled by the homeostatic drive to sleep. The rye mutation maps to a nicotinic acetylcholine receptor (nAChR), which interacts with a previously identified sleep-regulating protein, SLEEPLESS (SSS). Levels of RYE are expressed cyclically, in conjunction with the sleep state, and reflect sleep need such that they are up-regulated after sleep deprivation and in short-sleeping mutants. We conclude that homeostatic sleep drive promotes sleep at least in part by increasing expression of RYE.

Results

Identification of redeye, a short-sleeping mutant

As previous screens have identified sleep components on the X chromosome and the second chromosome (Cirelli et al., 2005; Koh et al., 2008; Stavropoulos and Young, 2011), we sought to identify sleep-altering mutations on the third chromosome in Drosophila. To this end, we generated a stock of iso31 (Ryder et al., 2004) flies carrying a newly isogenized third chromosome and treated males of this stock with 10–25 mM ethyl-methanesulfonate (EMS). Individual male progeny were bred to achieve homozygosity of the third chromosome, and females of the F3 generation were tested for daily sleep patterns in the presence of light:dark cycles (Koh et al., 2008). As seen in previous screens (Koh et al., 2008), sleep amounts were normally distributed in the 1857 lines assayed (Figure 1A, Figure 1—source data 1). Two homozygous mutant lines showed a severe reduction of sleep length, and we focused on one of these that we named redeye (rye). rye homozygotes show a >50% reduction in both daytime and night-time sleep (Figure 1C). The activity (average number of beam crossings during periods of activity) of rye mutants is comparable with that of wild type controls, suggesting it is not a hyperactive mutant (Figure 1B). rye heterozygotes have slightly less sleep than wild type, suggesting that the rye mutation is partially dominant (Figure 1B,C). The dramatic reduction of baseline sleep results largely from a shortening of the average sleep episode duration (Figure 1D), which is indicative of a defect in sleep maintenance. The average number of sleep episodes at night is actually increased significantly in rye mutants, perhaps because the sleep homeostat senses sleep loss and compensates by initiating more bouts. We also assayed rye mutants in sleep deprivation assays and found that they did not lose much additional sleep in response to mechanical stimulation (data not shown). We surmise that an inability to sustain sleep bouts leads to the buildup of high sleep need in rye mutants, which makes them resist any further sleep loss.
Figure 1.

Identification of a short sleep mutant, redeye (rye), through a chemical mutagenesis (EMS) screen.

(A) Histogram depicting average sleep levels in females from homozygous EMS-mutagenized lines (n = 1857). The mean sleep value for each mutant was calculated by assaying sleep in 4–8 individual flies in the presence of 12 hr L-12 hr D cycles. Average sleep for all lines is indicated on the X axis in increments of 25 min. The Y axis depicts the number of mutant lines within each group. The dashed lines mark the sleep values that correspond to plus/minus 3× standard deviation of the mean. The arrowhead indicates the redeye mutant. (B) Top: average activity pattern of females from control lines and from rye mutants recorded in 12hr L-D cycles (n = 14–16 in 5 days). Bottom: sleep profiles with standard error bars. Black: lines isogenized on the 3rd chromosome for chemical mutagenesis; Blue: flies heterozygous for rye and the isogenized control chromosome; Orange: rye homozygotes. (C) Mean values of total sleep, daytime sleep and night-time sleep for rye mutants (Figure 1—source data 1). For each genotype 14–16 flies were assayed over a 5 day period. Bars represent standard error. One-way ANOVA was performed followed by Tukey post hoc analysis. * represents p<0.05, **p<0.01 and ***p<0.001. (D) Sleep quality of rye mutants: Daytime and night-time sleep episode length and episode number are plotted in the box-and-whisker diagram (Figure 1—source data 1). The middle line represents the median value; Bottom and top line of each box represent 25% and 75% respectively; Bottom bar and top bar represent 5% and 95% respectively. ns: not significant, ***p<0.001.

DOI: http://dx.doi.org/10.7554/eLife.01473.003

DOI: http://dx.doi.org/10.7554/eLife.01473.004

Identification of a short sleep mutant, redeye (rye), through a chemical mutagenesis (EMS) screen.

(A) Histogram depicting average sleep levels in females from homozygous EMS-mutagenized lines (n = 1857). The mean sleep value for each mutant was calculated by assaying sleep in 4–8 individual flies in the presence of 12 hr L-12 hr D cycles. Average sleep for all lines is indicated on the X axis in increments of 25 min. The Y axis depicts the number of mutant lines within each group. The dashed lines mark the sleep values that correspond to plus/minus 3× standard deviation of the mean. The arrowhead indicates the redeye mutant. (B) Top: average activity pattern of females from control lines and from rye mutants recorded in 12hr L-D cycles (n = 14–16 in 5 days). Bottom: sleep profiles with standard error bars. Black: lines isogenized on the 3rd chromosome for chemical mutagenesis; Blue: flies heterozygous for rye and the isogenized control chromosome; Orange: rye homozygotes. (C) Mean values of total sleep, daytime sleep and night-time sleep for rye mutants (Figure 1—source data 1). For each genotype 14–16 flies were assayed over a 5 day period. Bars represent standard error. One-way ANOVA was performed followed by Tukey post hoc analysis. * represents p<0.05, **p<0.01 and ***p<0.001. (D) Sleep quality of rye mutants: Daytime and night-time sleep episode length and episode number are plotted in the box-and-whisker diagram (Figure 1—source data 1). The middle line represents the median value; Bottom and top line of each box represent 25% and 75% respectively; Bottom bar and top bar represent 5% and 95% respectively. ns: not significant, ***p<0.001. DOI: http://dx.doi.org/10.7554/eLife.01473.003

Measurement of sleep duration for all EMS mutants and sleep analysis of rye mutants.

DOI: http://dx.doi.org/10.7554/eLife.01473.004

Normal circadian rhythms in rye homozygotes

As the circadian clock regulates the timing of sleep and some clock mutants show reduced sleep (Hendricks et al., 2003), we also assayed rye flies for defects in circadian rhythms. These endogenously generated rhythms are best monitored under constant conditions, in the absence of cyclic environmental cues, so we monitored behavior in constant darkness (DD). rye mutants display robust rest:activity rhythms in DD (∼62% rhythmicity) despite showing prolonged duration of activity (Figure 2A; Table 1). Of the ‘arrhythmicrye homozygotes detected, half (6/11) actually displayed a rhythm of ∼12 hr period length, which likely resulted from persistence of bimodal behavior (typically seen in light:dark) in DD. Thus, most rye homozygotes are rhythmic. Consistent with the intact circadian behavior, circadian cycling of the clock protein, PERIOD (PER), is normal in central clock cells of rye mutants. The peaks and troughs of expression, as well as the subcellular localization, at different times of day are similar to those in iso controls (Figure 2B). Thus, PER is largely nuclear at ZT20, entirely nuclear at ZT2, expressed at low levels at ZT8 and undetectable at ZT14. We conclude that only the homeostatic regulation of sleep is affected in rye mutants.
Figure 2.

rye homozygotes display normal circadian rhythms and clock protein cycling.

(A) Double plotted activity records of iso controls and rye homozygotes in DD. Rhythmic, but prolonged cross-beam activity was recorded in rye homozygotes. (B) Immunostaining of PERIOD in ventral lateral neurons (LNvs) of iso controls and rye homozygotes at CT time points on the second day of DD following LD entrainment. PER oscillates in these clock neurons in iso as well as in rye homozygotes. PDF labels the small and large LNvs.

DOI: http://dx.doi.org/10.7554/eLife.01473.005

Table 1.

Rhythmic behavior of rye homozygotes in constant darkness

DOI: http://dx.doi.org/10.7554/eLife.01473.006

GenotypeRhythmicity% (n)*Period ± SEM (h)FFT ± SEM
W1118 (iso)93.8% (30/32)23.21 ± 0.040.051 ± 0.005
rye62.1% (18/29)23.66 ± 0.090.054 ± 0.005

Flies were entrained to a light–dark cycle (12 hr/12 hr) for 3 days before being moved into constant darkness (DD). Behavior was analyzed from day 3 to day 11 in DD, and flies with a fast fourier transform value (FFT) above 0.01 were considered rhythmic.

Period lengths and FFT values of rhythmic flies are listed as average value plus minus the standard error of mean (SEM).

rye homozygotes display normal circadian rhythms and clock protein cycling.

(A) Double plotted activity records of iso controls and rye homozygotes in DD. Rhythmic, but prolonged cross-beam activity was recorded in rye homozygotes. (B) Immunostaining of PERIOD in ventral lateral neurons (LNvs) of iso controls and rye homozygotes at CT time points on the second day of DD following LD entrainment. PER oscillates in these clock neurons in iso as well as in rye homozygotes. PDF labels the small and large LNvs. DOI: http://dx.doi.org/10.7554/eLife.01473.005 Rhythmic behavior of rye homozygotes in constant darkness DOI: http://dx.doi.org/10.7554/eLife.01473.006 Flies were entrained to a light–dark cycle (12 hr/12 hr) for 3 days before being moved into constant darkness (DD). Behavior was analyzed from day 3 to day 11 in DD, and flies with a fast fourier transform value (FFT) above 0.01 were considered rhythmic. Period lengths and FFT values of rhythmic flies are listed as average value plus minus the standard error of mean (SEM).

Identification of rye as an α subunit of the nicotinic acetylcholine receptor

We identified the sleep-altering lesion in rye mutants through a combination of recombination mapping and deep-sequencing. Despite starting with a newly isogenized line, deep-sequencing identified many nucleotide changes in the rye background relative to the parental control and so considerable mapping was required to pinpoint the relevant mutation. Meiotic recombination analysis positioned rye between two genetic markers, thread and curled, in the centromeric region of the 3rd chromosome. Further mapping studies, using self identified single nucleotide polymorphism (SNP) markers, narrowed it down to ∼11 mega-bases (Figure 3A, Figure 3—source data 1). For finer localization, we utilized the genome-wide sequence data, which provided 40× and 10× genomes worth of nucleotide sequence, corresponding to 95% and 88% coverage, for the rye and iso31 genomes respectively. Following alignment with the published Drosophila genome, unique nucleotide polymorphisms present in rye mutants were pooled together as potential EMS-induced mutations (n = 26,224). Within the 11 Mb region identified through recombination mapping, there were 1457 potential mutations, but only nine that produced an amino-acid change in coding regions. Sanger sequencing allowed us to exclude seven of these. Two turned out to be deep-sequencing errors and five polymorphisms were also present in the wild type iso stock but not detected due to the low coverage of deep-sequencing in this stock. One polymorphism, in a gene annotated CG7320, was at a site that was also polymorphic in iso, although the amino acid change was different in the two strains. Because of the change in iso, which does not produce a sleep phenotype, we considered CG7320 a less likely candidate for rye. The last of the nine changes identified by deep-sequencing was a C-T transition (typical for EMS-induced mutations) that leads to a threonine to methionine change in CG12414 and is present only in rye mutants (Figure 3B). CG12414 encodes an α subunit of a nicotinic acetylcholine receptor (nAchR) (Lansdell and Millar, 2000). Five alternatively spliced variants produced by this gene are predicted to generate three possible open reading frames with one (pC/pG) containing an intact ligand bind domain (LBD) (Figure 3C). The predicted protein is homologous to several nAChR subunits, including α3, α2, α6, α4 and α7 in order of similarity. Alignment of CG12414 with α3 and α7 using the ClustalW2 algorithm shows that the rye mutation is at the junction between the LBD and the trans-membrane domain (TM) (Figure 3D,E). Interestingly, this junction region is highly conserved across species and the specific threonine mutated in rye is conserved in all α7 subunits (Figure 3D).
Figure 3.

Genetic mapping and genome-wide deep-sequencing reveal a missense mutation in a nicotinic acetylcholine receptor α subunit gene in rye mutants.

(A) Through genetic mapping, using classical phenotypic markers and newly identified SNP markers, rye was mapped between two SNP markers (SNP_L and SNP_R) near the centromere on the 3rd chromosome. (B) Paired-end genomic deep-sequencing of rye mutants identified a missense mutation in CG12414. We confirmed this through Sanger sequencing. This C-T/G-A transition that generated the ryeT227M allele is typical of EMS-induced mutations. (C) Schematic representation of the rye candidate gene, a nicotinic acetylcholine receptor (CG12414: nAcRα-80B). The gene spans ∼100 kb with alternative splicing predicted to produce five transcripts (RC-RG). The spliced forms are predicted to translate into three proteins isoforms (pC-pG). pC(pG) produces the largest protein with the longest ligand binding domain (LBD). (D) Alignment of the partial sequence of Drosophila RYE with nAChR α3 and α7 subunits in other animals using ClustalW2. The region shown is at the boundary of the ligand binding domain (LBD) and transmembrane domain (TM), and is evolutionarily conserved. T227 in RYE is marked in bold form. ‘*’ identity; ‘:’ high similarity; ‘.’ similarity. (E) Protein sequence analysis predicts four transmembrane domains (TM) in RYE, which is typical of most nAChR proteins. RYE appears to contain a single ligand binding domain (LBD) in the extracellular region, and four TMs with three loop regions (L1-L3). The mutated threonine227 is in the LBD, close to the beginning of the TM.

DOI: http://dx.doi.org/10.7554/eLife.01473.007

DOI: http://dx.doi.org/10.7554/eLife.01473.008

Genetic mapping and genome-wide deep-sequencing reveal a missense mutation in a nicotinic acetylcholine receptor α subunit gene in rye mutants.

(A) Through genetic mapping, using classical phenotypic markers and newly identified SNP markers, rye was mapped between two SNP markers (SNP_L and SNP_R) near the centromere on the 3rd chromosome. (B) Paired-end genomic deep-sequencing of rye mutants identified a missense mutation in CG12414. We confirmed this through Sanger sequencing. This C-T/G-A transition that generated the ryeT227M allele is typical of EMS-induced mutations. (C) Schematic representation of the rye candidate gene, a nicotinic acetylcholine receptor (CG12414: nAcRα-80B). The gene spans ∼100 kb with alternative splicing predicted to produce five transcripts (RC-RG). The spliced forms are predicted to translate into three proteins isoforms (pC-pG). pC(pG) produces the largest protein with the longest ligand binding domain (LBD). (D) Alignment of the partial sequence of Drosophila RYE with nAChR α3 and α7 subunits in other animals using ClustalW2. The region shown is at the boundary of the ligand binding domain (LBD) and transmembrane domain (TM), and is evolutionarily conserved. T227 in RYE is marked in bold form. ‘*’ identity; ‘:’ high similarity; ‘.’ similarity. (E) Protein sequence analysis predicts four transmembrane domains (TM) in RYE, which is typical of most nAChR proteins. RYE appears to contain a single ligand binding domain (LBD) in the extracellular region, and four TMs with three loop regions (L1-L3). The mutated threonine227 is in the LBD, close to the beginning of the TM. DOI: http://dx.doi.org/10.7554/eLife.01473.007

Recombination mapping of the rye mutation using a chromosome marked with visible markers h,th,cu,sr,e, and using SNP markers.

DOI: http://dx.doi.org/10.7554/eLife.01473.008

Functional analysis of rye

The genetic mapping and deep-sequencing data combined implicated CG12414 as a candidate gene responsible for the rye sleep phenotype. To verify this function for CG12414, we attempted to rescue rye mutants with a CG12414 transgene. To drive expression in areas that normally express this gene, we cloned the CG12414 promoter region (1.8 kb) and generated a GAL4 construct. This GAL4 is expressed broadly in the Drosophila brain (Figure 4A). We also cloned the CG12414 cDNA into a UAS construct and crossed the GAL4 and UAS transgenes into an iso stock to ensure a homogenous genetic background. These transgenes were then introduced into rye mutants. While either transgene alone did not alter the rye short sleep phenotype, the rye promoter driving RYE expression (ryeP > uas-rye) partially rescued the mutant phenotype and restored total sleep to levels seen in rye heterozygotes (Figure 4B). This is expected, given that ryeT227M is partially dominant over wild type. In a wild type background, ryeP > uas-rye does not increase sleep length (data not shown), suggesting that the increase in sleep is specific to the mutant. Thus, we identified the gene responsible for the short sleep phenotype in rye mutants, and henceforth refer to this gene CG12414, previously called nAChR-80B, as redeye.
Figure 4.

An alpha subunit of the nicotinic acetylcholine receptor accounts for the rye mutant phenotype.

(A) Expression pattern of ryeP-GAL4. Rye-GAL4 was used to express nGFP, which is visualized with an anti-GFP antibody. The anti-nc82 staining marks the neuropil. (B) Expression of the alpha subunit, as described in Figure 3, increases sleep duration in rye mutants (Figure 4—source data 1). Left: sleep profiles, with standard error, of rye mutants and mutants expressing a UAS construct of the putative rye cDNA under control of its own promoter (ryeP-Gal4) in a 12:12 LD cycle. Right: quantification of sleep length. **p<0.01, ***p<0.001. (C) Reduction of rye expression in rye neurons through the expression of an RNAi construct, together with Dicer2, diminishes sleep length (Figure 4—source data 1). Left: sleep profile in a 12:12 LD cycle. Right: quantification of sleep length. *p<0.05. (D) Western blot analysis shows reduced expression of RYE when actin-GAL4 is used to drive rye RNAi (VDRC#11392) with Uas-Dicer2 in female and male flies.

DOI: http://dx.doi.org/10.7554/eLife.01473.009

DOI: http://dx.doi.org/10.7554/eLife.01473.010

An alpha subunit of the nicotinic acetylcholine receptor accounts for the rye mutant phenotype.

(A) Expression pattern of ryeP-GAL4. Rye-GAL4 was used to express nGFP, which is visualized with an anti-GFP antibody. The anti-nc82 staining marks the neuropil. (B) Expression of the alpha subunit, as described in Figure 3, increases sleep duration in rye mutants (Figure 4—source data 1). Left: sleep profiles, with standard error, of rye mutants and mutants expressing a UAS construct of the putative rye cDNA under control of its own promoter (ryeP-Gal4) in a 12:12 LD cycle. Right: quantification of sleep length. **p<0.01, ***p<0.001. (C) Reduction of rye expression in rye neurons through the expression of an RNAi construct, together with Dicer2, diminishes sleep length (Figure 4—source data 1). Left: sleep profile in a 12:12 LD cycle. Right: quantification of sleep length. *p<0.05. (D) Western blot analysis shows reduced expression of RYE when actin-GAL4 is used to drive rye RNAi (VDRC#11392) with Uas-Dicer2 in female and male flies. DOI: http://dx.doi.org/10.7554/eLife.01473.009

Sleep behaviour of transgenically rescued rye mutants and rye RNAi lines.

DOI: http://dx.doi.org/10.7554/eLife.01473.010 To further characterize rye function, we knocked down RYE expression through RNA interference. A rye RNAi line (#11392) from the VDRC stock center in Vienna was crossed into the ryeP-GAL4 line along with a UAS-Dicer2 transgene, included to improve efficacy of the RNAi. Levels of RYE were reduced (Figure 4D), as was the total sleep length (Figure 4C). Since ryeT227M reduces sleep as well (Figure 1), these data suggest that the T227M mutant allele causes loss of RYE function. The sleep phenotype produced by rye knock-down is rather mild in comparison with the phenotype of the homozygous rye mutant, possibly due to inefficient knockdown in relevant cells or because rye is a dominant-negative mutation. The nicotinic acetylcholine receptor forms a pentameric structure, consisting of five homo-oligomeric or hetero-oligomeric subunits (Miwa et al., 2011), so a dominant negative mutation in any one subunit may well interfere with activity of the complex.

RYE interacts with SSS

We next addressed if rye interacts with other known sleep mutants, in particular with a mutant we identified previously, sleepless (sss), that has an extreme short-sleeping phenotype (Koh et al., 2008). While transheterozygotes of rye and sss (sss/+; rye/+) showed sleep duration comparable to that of rye/+ alone (data not shown), rye heterozygotes carrying a genomic sss transgene, which increases SSS expression above that of wild type controls, showed a further reduction of sleep (Figure 5A). The effect was observed with three independent insertions of the sss transgene, indicating that it was not due to insertion site effects (Figure 5B). We note that this sss transgene does not have a significant effect on sleep in wild type flies although it completely rescues the sleep phenotype of sss mutants (Koh et al., 2008). Thus, the effect is specific to rye mutants.
Figure 5.

Overexpression of sss exacerbates the rye phenotype by repressing RYE activity.

(A) An extra copy of SSS reduces sleep in rye heterozygotes. Sleep profile of rye heterozygotes with or without a genomic sss transgenic line inserted on the third chromosome (sssTG2) and of sss transgenics alone. (B) Quantification of sleep in the genotypes as indicated (Figure 5—source data 1). TG1 and TG3 are additional independent genomic sss transgenes inserted on the 3rd and X chromosomes respectively. Sleep reduction was observed in rye transheterozygotes with all three sss transgenic lines. *p<0.05. (C) Heterologous expression of SSS reduces current following ACh application in Xenopus oocytes expressing Drosophila RYE and human nAChR β2 (Figure 5—source data 1). *p<0.05. (D) Heterologous expression of SSS reduces current following ACh application in Xenopus oocytes expressing human nAChR α4β2 (Figure 5—source data 1). ***p<0.001.

DOI: http://dx.doi.org/10.7554/eLife.01473.011

DOI: http://dx.doi.org/10.7554/eLife.01473.012

Overexpression of sss exacerbates the rye phenotype by repressing RYE activity.

(A) An extra copy of SSS reduces sleep in rye heterozygotes. Sleep profile of rye heterozygotes with or without a genomic sss transgenic line inserted on the third chromosome (sssTG2) and of sss transgenics alone. (B) Quantification of sleep in the genotypes as indicated (Figure 5—source data 1). TG1 and TG3 are additional independent genomic sss transgenes inserted on the 3rd and X chromosomes respectively. Sleep reduction was observed in rye transheterozygotes with all three sss transgenic lines. *p<0.05. (C) Heterologous expression of SSS reduces current following ACh application in Xenopus oocytes expressing Drosophila RYE and human nAChR β2 (Figure 5—source data 1). *p<0.05. (D) Heterologous expression of SSS reduces current following ACh application in Xenopus oocytes expressing human nAChR α4β2 (Figure 5—source data 1). ***p<0.001. DOI: http://dx.doi.org/10.7554/eLife.01473.011

Sleep analysis of rye mutants overexpressing sss, and whole-cell membrane current recording of Xenopus oocytes.

DOI: http://dx.doi.org/10.7554/eLife.01473.012 SSS is a GPI-anchored protein that regulates the Shaker potassium channel and its predicted structure resembles that of a specific class of toxins (Wu et al., 2010; Dean et al., 2011). It is most similar to the mammalian Lynx-1 protein, which is known to inhibit activity of the nicotinic acetylcholine receptor (Miwa et al., 2011). The fact that SSS exacerbated the phenotype of flies heterozygous for rye, which have reduced activity of nAChR, suggested that SSS also regulates nAChRs. We tested a possible Lynx-1-like function of SSS in regulating nAChR activity by using a heterologous expression system, specifically Xenopus laveis oocytes. For functional expression of wild type RYE, we expressed it with a human β2 subunit, as insect β subunits typically do not work in heterologous systems (Millar and Lansdell, 2010). cRNAs encoding sss, wild type rye and human β2 were injected into oocytes, and 4–7 days later whole cell currents were measured following application of ACh (Kuryatov and Lindstrom, 2011). Heterologous expression of insect nAChRs has, in general, been challenging (Millar, 2009), which accounts for the low current values observed (Figure 5C). However, we still detected a significant reduction of nAChR current upon co-expression with SSS (Figure 5C). We also co-expressed in vitro transcribed sss and human α4 and β2 subunits and found that SSS also inhibits the robust current produced by the human receptor complex (Figure 5D). Thus, in addition to its sleep-promoting role reported previously, SSS may also promote wake by repressing activity of nAChRs. As discussed below, loss of the sleep-promoting role has a dominant effect in sss mutants.

RYE is expressed cyclically in association with the sleep state

We next asked if levels of rye vary over the course of the day. Groups of wild type flies were housed in a 12 hr-light and 12 hr-dark incubator and harvested at different Zeitgeber times (ZT). Zeitgeber time defines time based on the environmental stimulus, so ZT0 corresponds to light-on and ZT12 to light-off. RNA was extracted and subjected to quantitative PCR analyses. While period (per), a well-known circadian clock component, oscillates with a circadian rhythm (Zheng and Sehgal, 2012), rye mRNA levels were found to be constant (Figure 6A).
Figure 6.

The RYE protein is expressed cyclically in association with the sleep state, but independently of the circadian clock.

(A) Quantitative PCR analyses show oscillations of per mRNA (left panel), but constant levels of rye mRNA (right panel). actin was used as a normalization control (Figure 6—source data 1). (B) Left: a representative western blot of head extracts from wild type flies shows cyclic expression of RYE with two daily peaks, in the middle of the day (ZT6-10) and in the middle of the night (ZT18-22), corresponding to the sleep state (Figure 1B). PER, in contrast, shows only one daily peak. MAPK was used to control for loading. Right: densitometry quantification of western blots with error bars representing standard error (n = 8). RYE value at ZT0 is set as 1 (Figure 6—source data 1). *p<0.05, **p<0.01. (C) RYE cycling is similar to wild type in Clk flies, indicating that cycling per se does not require a functional clock. However, the phase is variable, so for quantification purposes five independent experiments were split into two groups of roughly similar phase (Figure 6—source data 1).

DOI: http://dx.doi.org/10.7554/eLife.01473.013

DOI: http://dx.doi.org/10.7554/eLife.01473.014

DOI: http://dx.doi.org/10.7554/eLife.01473.015

DOI: http://dx.doi.org/10.7554/eLife.01473.016

The RYE protein is expressed cyclically in association with the sleep state, but independently of the circadian clock.

(A) Quantitative PCR analyses show oscillations of per mRNA (left panel), but constant levels of rye mRNA (right panel). actin was used as a normalization control (Figure 6—source data 1). (B) Left: a representative western blot of head extracts from wild type flies shows cyclic expression of RYE with two daily peaks, in the middle of the day (ZT6-10) and in the middle of the night (ZT18-22), corresponding to the sleep state (Figure 1B). PER, in contrast, shows only one daily peak. MAPK was used to control for loading. Right: densitometry quantification of western blots with error bars representing standard error (n = 8). RYE value at ZT0 is set as 1 (Figure 6—source data 1). *p<0.05, **p<0.01. (C) RYE cycling is similar to wild type in Clk flies, indicating that cycling per se does not require a functional clock. However, the phase is variable, so for quantification purposes five independent experiments were split into two groups of roughly similar phase (Figure 6—source data 1). DOI: http://dx.doi.org/10.7554/eLife.01473.013

qPCR analysis of per and rye expression during LD cycle and densitometry quantification of RYE expression.

DOI: http://dx.doi.org/10.7554/eLife.01473.014

RYE expression in a LD cycle (repeats).

DOI: http://dx.doi.org/10.7554/eLife.01473.015

Supporting data for Figure 6C.

DOI: http://dx.doi.org/10.7554/eLife.01473.016 To examine protein levels of RYE, we generated an antibody against the cytoplasmic L3 domain of RYE (Figure 3E), which is the most variable region across all nAChR subunits (Lindstrom, 2003). On western blots, the antibody recognizes a band (or sometimes a doublet) of ∼60 Kd, which is the size predicted for the full-length isoform. Surprisingly, in contrast to the flat mRNA levels, levels of RYE protein show a robust rhythm with two peaks each day, one at around ZT6-10 and the other at ZT18-22 (Figure 6B, Figure 6—figure supplement 1). Interestingly, these correspond to the two daily times of sleep, the afternoon siesta and night-time sleep (Figure 1B), suggesting that RYE is expressed in phase with sleep. The cycling of RYE persists in constant darkness, as do rhythms of sleep (data not shown). However, RYE does not appear to be regulated like other cycling clock components, such as PER, which usually show only one peak (Figure 6B). Furthermore, we found that RYE continues to cycle in Clk flies that lack a circadian clock, although the phase of RYE expression tends to be more variable in these flies (Figure 6C, Figure 6—figure supplement 2). These data suggest that the RYE oscillation per se does not require process C of the two process model, but may depend upon process S (sleep homeostasis). However, the circadian clock may function to provide more precise timing of RYE expression, perhaps through its control of sleep onset and offset.
Figure 6—figure supplement 1.

RYE expression in a LD cycle (repeats).

DOI: http://dx.doi.org/10.7554/eLife.01473.015

Figure 6—figure supplement 2.

Supporting data for Figure 6C.

DOI: http://dx.doi.org/10.7554/eLife.01473.016

Expression of RYE is under control of the sleep homeostat

Increases in RYE expression could occur as a consequence of sleep, and thereby reflect the sleep state, but in that case levels should remain high throughout the sleep state. Given that RYE levels do not remain high throughout the night or through the afternoon siesta, another possibility is that elevations in RYE correspond to sleep drive and so occur at the time of sleep onset. To test this idea, we assayed RYE expression in short-sleeping mutants. These mutants have low sleep levels, but probably have high sleep drive that cannot be implemented. As shown in Figure 7, for the most part RYE expression exhibits two peaks in these mutants, but the phase is more variable (Figure 7—figure supplements 1–3), indicating that defects in sleep behavior affect the RYE expression pattern. Interestingly, overall RYE values are higher in fumin (Kume et al., 2005; Ueno et al., 2012), sss (Koh et al., 2008) and insomniac (Stavropoulos and Young, 2011) mutants than in wild type controls. As noted above, the sss mutation affects channel activity, fumin is a mutation in the dopamine transporter (short sleep is thought to result from the high levels of dopamine in the synaptic cleft) and insomniac is thought to affect protein turnover. The one feature these mutants have in common is short sleep, yet they all have elevated RYE expression during an LD cycle (Figure 7A–C). Based upon these data, we suggest that RYE reflects sleep need. It is elevated at the time of sleep onset and is further increased in short-sleeping mutants because they have high sleep need.
Figure 7.

RYE levels are elevated in short-sleeping mutants.

(A) Western analyses of RYE expression over the course of a day in iso controls and fumin mutants. While RYE still cycles in fumin, the mean value of all six daily time points from three independent experiments (n = 3) shows that overall levels of RYE are higher than in wild type controls (Figure 7—source data 1). *p<0.05. (B) Western analyses of RYE expression over the course of a day in iso controls and sss mutants. As in A, the quantification reflects the mean across the day from three independent experiments (n = 3). *p<0.05. (C) Western analyses of RYE expression over the course of a day in iso controls and insomniac mutants. Quantification as above (n = 3). *p<0.05.

DOI: http://dx.doi.org/10.7554/eLife.01473.017

DOI: http://dx.doi.org/10.7554/eLife.01473.018

DOI: http://dx.doi.org/10.7554/eLife.01473.019

DOI: http://dx.doi.org/10.7554/eLife.01473.020

DOI: http://dx.doi.org/10.7554/eLife.01473.021

RYE levels are elevated in short-sleeping mutants.

(A) Western analyses of RYE expression over the course of a day in iso controls and fumin mutants. While RYE still cycles in fumin, the mean value of all six daily time points from three independent experiments (n = 3) shows that overall levels of RYE are higher than in wild type controls (Figure 7—source data 1). *p<0.05. (B) Western analyses of RYE expression over the course of a day in iso controls and sss mutants. As in A, the quantification reflects the mean across the day from three independent experiments (n = 3). *p<0.05. (C) Western analyses of RYE expression over the course of a day in iso controls and insomniac mutants. Quantification as above (n = 3). *p<0.05. DOI: http://dx.doi.org/10.7554/eLife.01473.017

Densitometry quantification of RYE expression in short sleep mutants.

DOI: http://dx.doi.org/10.7554/eLife.01473.018

Supporting data for Figure 7A.

DOI: http://dx.doi.org/10.7554/eLife.01473.019

Supporting data for Figure 7B.

DOI: http://dx.doi.org/10.7554/eLife.01473.020

Supporting data for Figure 7C.

DOI: http://dx.doi.org/10.7554/eLife.01473.021 If the expression of RYE changes in response to the accumulation of sleep need, it should also be affected by acute sleep deprivation. We mechanically deprived flies of sleep in the second half night (6 hr) in an LD cycle, and confirmed, through the presence of a substantial sleep rebound the following morning, that the flies were successfully deprived (Figure 8A; Koh et al., 2008). RYE levels were assayed during the 5 hr sleep rebound window. In the non-deprived control, RYE levels were low at ZT0 and high at ZT5, as noted above. Sleep-deprived flies had high levels of RYE immediately following deprivation (ZT0), but levels were low at ZT5 (Figure 8A, Figure 8—figure supplement 1). This fits the profile for sleep drive, which is expected to be high at the end of deprivation, but then dissipated over the course of rebound sleep.
Figure 8.

RYE expression is under control of the sleep homeostat.

(A) Left: sleep profile of sleep deprived flies. Blue line: non-deprived controls, Grey line: sleep deprived flies. Arrowheads point to the 6 hr sleep deprivation (SD) window (ZT18-24) and sleep rebound the following morning (ZT0-5). Right: a representative western blot of fly head samples at ZT0 and ZT5 in sleep-deprived (SD) animals and non-deprived (ND) controls. RYE levels are high immediately following sleep deprivation (SD0) and dissipate after sleep rebound (SD5). In contrast, the circadian clock is not affected by SD, since PER cycling is comparable in the SD group and the non-deprived control (ND). Densitometry quantification of the western data (n = 5) is shown below with error bars showing standard error (Figure 8—source data 1). *p<0.05. (B) Model for the role of RYE in the homeostatic regulation of sleep: We propose that RYE is required to maintain sleep, and posttranslational regulation of RYE reflects homeostatic sleep drive. Sleep need builds up during wakefulness and upregulates levels of RYE, which are essential to maintain sleep behavior. Homeostatic drive dissipates during sleep, and levels of RYE are reduced, leading to wakefulness. SSS represses RYE activity, thus acting as a wake-promoting factor in this particular context.

DOI: http://dx.doi.org/10.7554/eLife.01473.022

DOI: http://dx.doi.org/10.7554/eLife.01473.023

DOI: http://dx.doi.org/10.7554/eLife.01473.024

Figure 8—figure supplement 1.

Supporting data for Figure 8A.

DOI: http://dx.doi.org/10.7554/eLife.01473.024

RYE expression is under control of the sleep homeostat.

(A) Left: sleep profile of sleep deprived flies. Blue line: non-deprived controls, Grey line: sleep deprived flies. Arrowheads point to the 6 hr sleep deprivation (SD) window (ZT18-24) and sleep rebound the following morning (ZT0-5). Right: a representative western blot of fly head samples at ZT0 and ZT5 in sleep-deprived (SD) animals and non-deprived (ND) controls. RYE levels are high immediately following sleep deprivation (SD0) and dissipate after sleep rebound (SD5). In contrast, the circadian clock is not affected by SD, since PER cycling is comparable in the SD group and the non-deprived control (ND). Densitometry quantification of the western data (n = 5) is shown below with error bars showing standard error (Figure 8—source data 1). *p<0.05. (B) Model for the role of RYE in the homeostatic regulation of sleep: We propose that RYE is required to maintain sleep, and posttranslational regulation of RYE reflects homeostatic sleep drive. Sleep need builds up during wakefulness and upregulates levels of RYE, which are essential to maintain sleep behavior. Homeostatic drive dissipates during sleep, and levels of RYE are reduced, leading to wakefulness. SSS represses RYE activity, thus acting as a wake-promoting factor in this particular context. DOI: http://dx.doi.org/10.7554/eLife.01473.022

Densitometry quantification of RYE expression after SD.

DOI: http://dx.doi.org/10.7554/eLife.01473.023

Supporting data for Figure 8A.

DOI: http://dx.doi.org/10.7554/eLife.01473.024

Discussion

The molecular mechanism of sleep homeostasis is a mystery and a subject of intense research in the sleep field (Suzuki et al., 2013). In addition to the investigation of mechanisms underlying sleep drive, considerable effort is being put into identifying biomarkers of sleep need. Based on what we know about the so-called sleep homeostat, which consists of increasing sleep pressure during wakefulness and dissipation of such pressure following sleep, we suggest that a component or direct output of the homeostat should satisfy three criteria: (i) the gene product should regulate the sleep:wake cycle (i.e., genetic alleles of this gene should have some sleep phenotype); (ii) expression levels or activity of the gene product should go up during wakefulness or during sleep deprivation and (iii) expression levels or activity should decrease after sleep. The function of RYE and the molecular kinetics of the RYE protein largely satisfy these criteria. However, while RYE builds up during sleep deprivation, it does not accumulate gradually over the wake period in a daily cycle. Rather, it displays a marked increase close to the time of sleep onset, suggesting that it is not a central component of the homeostat, but responds to an upstream homeostatic signal, perhaps when that signal reaches a certain threshold. The fact that over-expression of RYE does not promote sleep also supports the idea that it is not the sleep-inducing homeostatic signal (further discussed below). Nevertheless, RYE is not simply a sleep output gene or sleep biomarker. It is required for implementation of signals from the homeostat and it functions to maintain sleep. Thus, we propose that rye is a sleep-regulating gene immediately downstream of the homeostat.

RYE expression reflects sleep need

We suggest that RYE represents a molecular correlate of delta power, a characteristic of an electroencephalogram (EEG) that reflects sleep drive. Recently, a few other molecules were reported to change with sleep drive, but the effects were at the level of the mRNA, the magnitude of the increase was less than we report here for RYE and loss of the molecules did not affect baseline sleep duration (Seugnet et al., 2006; Maret et al., 2007; Naidoo et al., 2007). In addition, only one is expressed cyclically (Nelson et al., 2004), indicating that others reflect sleep drive only under pathological conditions of sleep deprivation. RYE levels oscillate robustly in a daily cycle, although the phase is not as coherent as seen for circadian clock proteins. The timing of the peak varies within a temporal range, such that there is almost always a daytime peak and a night-time peak but not necessarily at the exact same time (Figure 6—figure supplement 1). We suggest that RYE cycles under control of the sleep homeostat, which may not time behavior as precisely as the circadian clock, perhaps because sleep can be influenced by many factors. The variability in RYE cycling is particularly pronounced in short-sleeping mutants and in the Clk circadian clock mutant (Figure 6—figure supplement 2, Figure 7—figure supplements 1–3), suggesting that the clock does influence RYE expression although it is not required for its cycling in an LD cycle. Interestingly, RYE cycles exclusively at the level of the protein, indicating translational or post-translational mechanisms. It is worth noting that a recently identified sleep regulator, Insomniac, is a component of specific protein degradation pathways in the cell (Stavropoulos and Young, 2011). Although our study indicates that RYE cycling does not require Insomniac (Figure 7C), it is possible that it is regulated by other protein turn-over machinery. Thus, translational/posttranslational regulation appears to be part of the mechanism of sleep homeostasis.

RYE is required to maintain the sleep state

We show that RYE not only reflects sleep drive, but is also required for sleep maintenance (Figures 1, 4 and 8). Given that RYE is induced by sleep deprivation and it promotes sleep, one might expect over-expression of the protein to increase sleep. However, transgenic expression of rye in a wild type background does not increase sleep, suggesting that while rye is necessary, it is not sufficient for sleep onset. We cannot exclude the possibility that RYE functions together with other signals as part of the sleep-inducing homeostatic drive. On the other hand, it is also possible that transgenic expression does not produce adequate amounts of RYE protein in relevant cells. This might be the case if RYE is tightly regulated at the level of protein stability. For the moment, though, we prefer the parsimonious explanation noted above, that RYE is not part of the homeostat, but immediately downstream of it. Acetylcholine signaling has been long proposed as an arousal factor, as the nAChR complex is a cation channel that normally promotes neuronal activity and ACh is released during wakefulness in mammals (Platt and Riedel, 2011). In contrast, our study indicates that at least one nAChR subunit (RYE) promotes sleep in the fly. There are more than 10 paralogs of nAChR subunits in the fly genome. One possibility is that RYE is expressed specifically in sleep promoting neurons, while other subunits of AChRs are in wake-promoting cells. An increase in ACh during wakefulness may contribute to the accumulation of sleep drive and to the increase in RYE (Lindstrom, 2003). Alternatively, sleep drive may increase RYE independently of ACh, but in either scenario, RYE then promotes sleep. The precise site of RYE action is currently not known. rye-gal4 driven GFP is expressed widely in the brain (Figure 4A), but we cannot be sure that endogenous RYE is as widespread, as our antibody was not effective in immunohistochemistry experiments, and we find that GAL4 drivers are often quite promiscuous (unpublished observations).

SSS inhibits RYE activity and promotes arousal in a sensitized background

SSS was previously identified as a sleep promoting factor, essential for maintaining baseline sleep and for homeostatic rebound (Koh et al., 2008). An interaction between rye and sss is therefore not surprising. What is surprising is that overexpression of SSS promotes wakefulness in rye heterozygotes (Figure 5A,B). SSS is a GPI-anchored protein that functions as a neuronal modulator. Previous studies indicate that SSS promotes activity of the voltage-gated potassium channel, Shaker (Wu et al., 2010). In this study, we report that SSS acts like a brake on nAChR (RYE) activity (Figure 5C,D), as does Lynx-1, a SSS-like molecule, in mammals (Miwa et al., 2011). Although the data we show for Drosophila receptors used only the RYE α subunit, it is likely that SSS also inhibits activity of other Drosophila nAChR receptors. As both sss (a null mutation) and sss (a hypomorphic allele) are short-sleeping mutants (Koh et al., 2008), we propose that the overall effect of SSS is to promote sleep. The reduced sleep in sss mutants probably results from an increase of neuronal excitability, through inactivation of potassium channels (Shaker) (Dean et al., 2011), or from hyperactivity of nAChR channels in wake-promoting neurons. Thus, typically the sleep-inhibiting effect of SSS, mediated through RYE, is masked by these other more dominant influences. However, in a sensitized background (i.e., rye/+), this effect is evident. RYE promotes sleep, and so loss of RYE results in a decrease in sleep, which is further impacted by SSS overexpression (Figure 8B). We note that there are some caveats to these data. For instance, the rye allele could confer a neomorphic function that accounts for the interaction with sss. Likewise, the effects in oocytes could be non-physiological, not necessarily reflecting what happens in the fly brain. However, given that we observe interactions in these two very different types of assays, and both assays indicate repression of nAchR function by SSS, which is the effect predicted from the role of the mammalian SSS-like protein, Lynx1, we believe SSS does indeed regulate nAchRs such as RYE. Interactions between SSS and nicotinic acetylcholine receptors are also reported by recent work from another laboratory (W Joiner, personal communication). It is interesting that genes identified through independent genetic screens in Drosophila are turning out to interact with one another. SSS and Shaker were isolated independently as sleep-regulating genes (Cirelli et al., 2005; Koh et al., 2008), and subsequently shown to interact, and now we find that RYE interacts with SSS. Given that each of these genes represents a relatively infrequent hit in an unbiased screen, the interactions suggest that genetic approaches are converging upon specific sleep-regulating pathways. Interestingly, a recent GWAS study for sleep-altering loci in humans identified significant effects of SNPs in an nAchR subunit as well as in a regulatory subunit of Shaker, suggesting that these mechanisms are also conserved across species (Allebrandt et al., 2013).

Materials and methods

Generation of an isogenic 3rd chromosome stock

Wild type iso31 (Ryder et al., 2004) was crossed with TM2/TM6C, Sb (Bloomington stock #5906), and a single male progeny was selected and crossed with #5906 to balance the 3rd chromosome and generate a line isogenic for this chromosome.

Behavioral analysis

Flies were housed in Percival incubators (Perry, IA) and beam–break activity was recorded with the Trikinetics DAM system (http://www.trikinetics.com/). Pysolo (Gilestro and Cirelli, 2009) software was used to analyze and plot sleep patterns. Sleep deprivation was achieved through repeated mechanical shaking (2 s randomized shaking in every 20-s interval).

Mapping analysis

A 3rd chromosome marker line h, th, cu, sr, e (Bloomington stock #576) was crossed to rye/TM6C, Sb, and heterozygote female progeny (h, th, cu, sr, e/rye) were further crossed to TM2/TM6C, Sb (#5906). A single recombinant male offspring was back-crossed to #576 to score the genotype of recessive markers and also back-crossed to rye for behavioral analysis to score the rye genotype. Overlap in the genotypes of recombinants narrowed down the location of the rye mutation to the region between markers th and cu. Genomic DNA of homozygous recombinants was subject to SNP analysis. The primer set 5′TGTTTAGTGGTGTTGTGTGAGC3′ and 5′GCCGAGTGTCATCGCCTTTG3′ for SNP_L and the primer set 5′AAAGGTCATCTTGCTTCGGAGTTG3′ and 5′GGAGTGGCTTCCTCGTCATC3′ for SNP_R were used for PCR amplification. Nucleotide polymorphisms were identified between iso and #576. Thus, those recombinants were scored accordingly and rye was further narrowed down to a region between those two SNP markers.

Sequencing and cloning

Fragmented genomic DNA (∼400 bp in size) obtained through the Covaris instrument (Woburn, MA) was subjected to Illumina paired-end DNA library preparation. The libraries were amplified for 10 PCR cycles prior to Illumina Hi-Seq analyses. SNP calling analyses identified nucleotide polymorphisms in both rye mutants and iso flies. The primer set 5′GGCTCGATGTGCTTTCAAGAGTTC3′ and 5′CATGCCAGATGAGTGCGTTTC3′ was used to clone the rye promoter region from genomic DNA derived from the iso stock. The primer set 5′TTTAGGCTTAGTCCGCTACC 3′ and 5′AATGTCGTGGTTTGAAGTGC 3′ was used to clone the full length rye cDNA. The PhiC31 integration system was used for injection. The rye promoter construct was specifically inserted onto the 2nd chromosome and the Uas-rye construct was integrated on the 3rd chromosome.

Generation of RYE antibodies

The primer set 5′ATGCATCATCACCATCACCATAGTATCTGCGTGACGGTTGTTG3′ and 5′GTGGTGGTGCACAACTGCCAACGTGAATATCC 3′ was used to clone the L3 epitope of RYE. A GST-RYEL3 fusion protein was expressed in Escherichia coli, excised from a PAGE gel and injected into rats for antibody generation.

Extractions and measurements of DNA, RNA and protein

Drosophila genomic DNA: flies (3–15) were frozen and homogenized in DNA extraction buffer. After LiCl/KAc precipitation, supernatants were subject to isopropanol precipitation. DNA pellets were dissolved in TE for sequencing analyses and PCR amplification. RNA: adult flies were collected at indicated time points and fly heads (10∼20) were subject to Trizol extraction (Ambion, Life Technologies, Grand Island, NY). cDNA libraries were made through high-capacity cDNA reverse transcription kits (Applied Biosystems, Life Technologies, Grand Island, NY). Quantitative PCR analysis was performed using SYBR green reagents in the Applied Biosystems 7000 sequence detection system. The primer set 5′AGTTGAATGGAAGCCACCAGC3′ and 5′TGTTCATCCATGTGCCTCAG3′ was used for qPCR analysis of rye expression. Protein: flies were collected at indicated time points and fly heads (∼5) were prepared for protein extraction and for Western analyses as previously described (Luo and Sehgal, 2012).

Immunocytochemistry assays

Adult fly brains were dissected in cold PBS buffers at indicated CT time points. Brains were fixed in 4% PFA for 30 m and incubated with 5% Normal Donkey Serum (NDS) for 1 hr at the blocking step. Incubation with primary rabbit anti-PER (1:1000), mouse anti-PDF (1:1000) and rabbit anti-GFP, mouse anti nc82 was performed overnight in the cold room. After extensive washing, brains were incubated with the donkey anti-rabbit or anti-mouse secondary antibody (1:1000) for 2 hr. Images were taken under a Leica confocal microscope.

Electrophysiological current recording in Xenopus oocytes

Oocytes were removed surgically from Xenopus laevis and placed in an OR-2 solution containing 82.5 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM HEPES, and pH 7.5. They were defolliculated in this buffer containing 2 mg/ml collagenase type IA (Sigma, St. Louis, MO) for 1.5 hr. After defolliculation, oocytes were incubated at 18°C in 50% L15 (Invitrogen, Carlsbad, CA) 10 mM HEPES, pH 7.5, 10 units/ml penicillin, and 10 g/ml streptomycin at 18°C. 3–6 days after injection, whole-cell membrane currents evoked by acetylcholine were recorded in oocytes at room temperature with a standard two-electrode voltage-clamp amplifier (Oocyte Clamp OC-725; Warner Instrument, Hamden, CT). Recordings were performed at a holding potential of −50 mV. All perfusion solutions contained 0.5M atropine to block responses of endogenous muscarinic AChRs that might be present in oocytes. Acetylcholine was applied by means of a set of 2-mm glass tubes directed to the animal pole of the oocytes. Application was achieved by manual unclamping/clamping of a flexible tube connected to the glass tubes and to reservoirs with the test solutions. The recording chamber was perfused at a flow rate of 15–20 ml/min. cRNAs for human AChR subunits 4 and 2 and Drosophila sss were synthesized in vitro using SP6 RNA polymerase (mMESSAGEmMACHINETM, Ambion). Oocytes were injected with 5 ng of cRNA of each of the subunits. eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers. Thank you for sending your work entitled “Identification of Redeye, a new sleep-regulating protein whose expression is modulated by sleep amount” for consideration at eLife. Your article has been favorably evaluated by a Senior editor and 3 reviewers, one of whom is a member of our Board of Reviewing Editors, and one of whom, Subhabrata Sanyal (Reviewer 3), has agreed to reveal his identity. The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission. The consensus of the reviewers was that the identification of rye is an important and novel contribution. To our knowledge there are no other protein markers that have been reported that are independent of the clock and external conditions and respond only to sleep drive. RYE levels therefore potentially represent an important new biomarker for sleep deprivation. The reviewers also felt that the data on the interaction of rye and sss were the weakest part of the paper and that without deeper investigation the precise interpretation of those experiments was difficult. While it would be satisfying to have mechanism, this study is still quite important without a full understanding of the interaction of rye and sss. We would therefore recommend publication of a suitably revised paper. The full reviews below contain a number of minor things that will help the authors to make the paper stronger, but the main concerns/suggestions are enumerated as follows: 1) Eliminate Figure 5 or cut back on the mechanistic claims and give a much fuller discussion of the caveats surrounding the data (see Reviewer 1 comments). 2) More balanced discussion of the issue of phase and whether rye is downstream of S or actually part of the homeostat (see Reviewer 2 comments). The overexpression data suggest the former. 3) Discussion of the issues surrounding the variability of the western blots (see comment from Reviewers 1 and 3). 4) More information on rye expression (or GAL4 pattern) and localization of requirement would strengthen the paper, especially if Figure 5 is eliminated. If such data exist it would be good to include them, but we would not require new experiments to be done. Reviewer 1 comments: This is a very interesting study. The authors used the power of genetics to identify a novel sleep regulator: RYE. The fact that RYE levels are apparently controlled by sleep drive and not the clock make this a very novel and important discovery. I believe this may be the first molecule of this class and for that reason I am very enthusiastic about this paper. Unfortunately, I think that the data that go beyond the characterization of rye are not very strong and are in many cases not interpretable in the simple way that the authors try to suggest. I almost wonder if the sss connection should not just be taken out of the paper until the authors have more data and can present a believable story. The isolation of the rye gene could stand alone as a brief communication. As it is the SSS stuff just muddies the waters. Perhaps if they added more detail about how the mutants are resistant to SD to the basic story? I am not convinced that there is a specific interaction between SSS and RYE that regulates sleep in WT animals. First, the authors claim that the sssTg lines have no effects on sleep, but they show data that the sleep levels in these lines are equivalent to rye/+, which has reduced sleep. The fact that now combining them results in even less sleep suggests a simple additive and independent effect of each manipulation on sleep. Second, there are no data on RNAi of RYE + OE of SSS. It is possible that the SSS effect is specific to the mutant allele because it has neomorphic function and that SSS may not regulate WT RYE. The oocyte data are not deep enough to ameliorate these concerns. The fact that SSS can decrease current from both human and fly alpha containing complexes makes me suspicious that the SSS effect is indirect via some effect on trafficking/sorting in general or perhaps increased K channel expression. No data on RMP etc. are presented. Many more controls and experiments would be needed to make this cleanly interpretable (e.g., does SSS block current from other unrelated ionotropic receptors? Is there physical interaction of RYE and SSS? Co-expression of the point mutant RYE – is it really DN? Etc.). It is also interesting that SSS seems to promote SHAKER expression yet suppress RYE. How do the authors fit this into a global model? They casually say its sleep promoting role is dominant but how would this really work? One thing we are never shown is where RYE is expressed in the brain. What is the pattern of rye-GAL4? Does this shed any light on the issue of SSS function? Since SHAKER is basically all over the brain perhaps RYE is more tightly localized and this might allow dissection of differential local effects of SSS on activity? Reviewer 2 comments: This paper presents studies that are truly a break-through for the sleep field – the identification of a mutant (rye) in which the affected protein is clearly part of the sleep homeostat (process S), which responds to increasing periods of wakefulness by producing a proportional increase in sleep drive. While the existence of such a homeostat is well supported by sleep behavior, the molecular basis has remained mysterious, and therefore this manuscript presents an important entry point for such a molecular analysis. The experiments are thorough, well controlled and convincing. The mutation affects a subunit for the nicotinic acetyl choline receptor, and the fact that a protein identified as mutated in a previously isolated short-sleeping mutant (sss) is shown to negatively regulate RYE is important because it suggests that the genetic analysis of sleep in Drosophila may be identifying some mutants in a single genetic pathway – something that has not been clear thus far. One perhaps could have hoped that this manuscript would also reveal the signals that lead to upregulation of RYE (i.e., more about the pathway for the sleep homeostat), but this will undoubtedly require more years of work by multiple labs. The data supporting a role for RYE in the sleep homeostat are very compelling, but unless I'm missing something it seems to me that RYE expression is more likely to be triggered by an upstream S process than to be a direct part of the actual S process. For one thing, the phase for RYE expression is not right. A factor which directly responds to S should build up during wakefulness and dissipate during sleep, but RYE accumulates when the flies are asleep and only dissipates towards the end of sleep. While this feature of RYE expression alone might suggest that RYE accumulates during sleep to measure sleep recovery and promote waking, the short-sleep phenotype of the mutant and the elevated levels of RYE in various short-sleep mutants and under conditions of sleep deprivation are not consistent with this alternative (so it does seem that RYE is part of the process S). Another interesting feature is that RYE overexpression in a wild type genetic background does not alter sleep, which is inconsistent with a factor that directly drives the S process (this should elevate or phase advance sleep). The authors note this paradox and postulate that RYE overexpression may not be sufficient to induce sleep, or may not produce higher levels of RYE in the relevant cells (perhaps overexpressed proteins is not stable in these cells). Along these lines, perhaps RYE can only accumulate when the S process reaches a threshold that triggers sleep, and then RYE remains high until sleep debt is dissipated. Consideration of these points needs to be added to the Discussion; if nothing else, there needs to be more discussion of the phase of RYE expression and its relationship to its postulated role in the sleep homeostat. Reviewer 3 comments: This manuscript by Shi et al. describes sleep phenotypes of a very interesting mutation in Drosophila named redeye (rye). The authors do a very commendable job of isolating, identifying, characterizing and defining this mutation and in so doing further establish Drosophila as a powerful platform to study the biochemical and genetic basis of sleep. The authors convincingly show that loss of Rye leads to a short-sleeping phenotype that can be rescued partially by adding back Rye in a domain circumscribed by a newly generated Rye-GAL4 driver line and weakly phenocopied using RNAi. What is most interesting though is that the Rye protein (assayed using newly generated Rye antibodies) cycles during the day and is most prominently present just before sleep onset, is elevated by sleep deprivation and in several short-sleeping mutants such as sleepless, insomniac and fumin, but is not controlled by the clock machinery. These are hallmarks of a true “somnogen”; however, Rye fails in one test, i.e., artificially increased expression of Rye does not promote sleep. Even so, it seems clear that as the authors suggest, Rye is part of the sleep homeostat and is necessary but not sufficient for sleep drive. This is a very interesting study and is suitable for publication in eLife. One area that could have been investigated a bit more deeply is that of the tissue-specificity of Rye. The authors use the Rye-Gal4 and yet suggest that the expression pattern of this GAL4 line may not reflect that of endogenous Rye expression. Given the large number of extant GAL4 lines and some understanding of the sleep circuitry in Drosophila, it might have been instructive to test a few of these (e.g., pan neuronal, dopaminergic neurons, fan shaped body etc) to define the tissue-restricted requirement of Rye, if any. This could be most simply achieved using RNAi (though the phenotypes are arguably weaker than Rye mutants), selective rescue of Rye phenotypes using the UAS-Rye transgene, or perhaps even attempting to test if strong Rye over-expression in neuronal subsets might induce sleep (due to either stronger over-expression than Rye-GAL4 or a circuit-specific effect of Rye elevation). A minor point is the difference in the timing of the first peak of Rye between wild type and clock mutants (Figure 6 B and C). Do the authors think this is relevant or is the peak of Rye temporally more loosely defined than, say, clock proteins? Overall, this is an excellent manuscript and one of the few that describes a protein that is clearly correlated with sleep drive. Mechanistic associations with sleepless and channel activity further highlight the importance of this protein in sleep regulation. The consensus of the reviewers was that the identification of rye is an important and novel contribution. To our knowledge there are no other protein markers that have been reported that are independent of the clock and external conditions and respond only to sleep drive. RYE levels therefore potentially represent an important new biomarker for sleep deprivation. The reviewers also felt that the data on the interaction of rye and sss were the weakest part of the paper and that without deeper investigation the precise interpretation of those experiments was difficult. While it would be satisfying to have mechanism, this study is still quite important without a full understanding of the interaction of rye and sss. We would therefore recommend publication of a suitably revised paper. The reviews contain a number of minor things that will help the authors to make the paper stronger, but the main concerns/suggestions are enumerated below. We appreciate the reviewers’ remarks regarding the novelty and importance of the work. The comment pertaining to the interaction between rye and sss is addressed below, and in detail in the response to Reviewer 1. 1) Eliminate or cut back on the mechanistic claims and give a much fuller discussion of the caveats surrounding the data (see Reviewer 1 comments). Because the interaction between rye and sss (Figure 5) represents a connection to a known sleep-regulating gene, and two very different assays (genetic and electrophysiology) are consistent in indicating evolutionarily conserved repression of nAchRs by SSS-like molecules, we chose to leave these data in the manuscript. We note too that Reviewer2 really liked this part of the manuscript. We did, however, conduct additional tests, and the new data (added to the manuscript) strengthen the case for genetic interaction. In addition, our colleague Bill Joiner recently obtained results indicating regulation of nAcHr by SSS (personal communication). Nevertheless, we acknowledge the reviewer’s concern, and have toned down the claims based upon these data (they are no longer mentioned in the Abstract) and we have also acknowledged the caveats in the Discussion. 2) More balanced discussion of the issue of phase and whether rye is downstream of S or actually part of the homeostat (see Reviewer 2 comments). The overexpression data suggest the former. We agree that RYE is likely downstream of the homeostat. However, RYE is not a simple readout or output of the homeostat (S) as it is directly controlled by S, and functions to maintain the sleep process. We now discuss these issues in the text. 3) Discussion of the issues surrounding the variability of the western blots (see Reviewers 1 and 3 comments). We have added this (see also the Response to Reviewers 1 and 3). One possibility is that Process S cycles, but not with very precise timing because sleep and wake states can be influenced by many factors. The variable phase of RYE expression during an LD cycle may reflect the inaccurate timing of process S. 4) More information on rye expression (or GAL4 pattern) and localization of requirement would strengthen the paper, especially if is eliminated. If such data exist it would be good to include them, but we would not require new experiments to be done. We have included the ryeGAL4>GFP expression pattern in the brain. As mentioned in the initial submission, the expression pattern is broad, and does not implicate any specific structure in sleep regulation. We are mapping relevant cells, but thus far do not have any functional data. Reviewer 1 comments: This is a very interesting study. The authors used the power of genetics to identify a novel sleep regulator: RYE. The fact that RYE levels are apparently controlled by sleep drive and not the clock make this a very novel and important discovery. I believe this may be the first molecule of this class and for that reason I am very enthusiastic about this paper. We thank the reviewer for these comments. Unfortunately, I think that the data that go beyond the characterization of rye are not very strong and are in many cases not interpretable in the simple way that the authors try to suggest. I almost wonder if the sss connection should not just be taken out of the paper until the authors have more data and can present a believable story. The isolation of the rye gene could stand alone as a brief communication. As it is the SSS stuff just muddies the waters. Perhaps if they added more detail about how the mutants are resistant to SD to the basic story? As noted above, we would prefer to leave in the sss-rye interaction data, which are now strengthened by additional genetic experiments, and are supported by data from Bill Joiner’s laboratory. We have also added a bit more discussion of the sleep deprivation experiments, although these are still not included as we did not feel we could draw any strong conclusions about them (we’re happy to include them if the reviewers deem otherwise). I am not convinced that there is a specific interaction between SSS and RYE that regulates sleep in WT animals. First, the authors claim that the sssTg lines have no effects on sleep, but they show data that the sleep levels in these lines are equivalent to rye/+, which has reduced sleep. The fact that now combining them results in even less sleep suggests a simple additive and independent effect of each manipulation on sleep. Second, there are no data on RNAi of RYE + OE of SSS. It is possible that the SSS effect is specific to the mutant allele because it has neomorphic function and that SSS may not regulate WT RYE. We believe that the apparent decrease in sleep in some sssTg lines (sssTG2/+ and sssTG3/+) resulted from small sample sizes (n=8 and n=4, respectively). Please note that sssTG1 did not reduce sleep in wild type, and yet this also reduced sleep in a rye/+ background. Nevertheless, we repeated the experiments with sssTG2 and sssTG3, so as to increase the N, and pooled the old and new data. As shown in the revision, sssTG2/+ (n=24) and sssTG3/+ (n=12) have a sleep length comparable to sssTG1/+ and to the iso stock. We conclude that the reduction of sleep in rye/ sssTG transhets is due to genetic interaction rather than additive effects. It is true that the interaction could reflect a neomorphic function of the new mutant allele, and we have included this caveat in the discussion. As rye RNAi had a weak phenotype, we did not use it for additional experiments, but rather focused on the allele from the screen. Finally, we note that interactions between SSS and nAchRs have been independently discovered by Bill Joiner (personal communication), so there is now increasing evidence to support such interactions. The oocyte data are not deep enough to ameliorate these concerns. The fact that SSS can decrease current from both human and fly alpha containing complexes makes me suspicious that the SSS effect is indirect via some effect on trafficking/sorting in general or perhaps increased K channel expression. No data on RMP etc. are presented. Many more controls and experiments would be needed to make this cleanly interpretable (e.g., does SSS block current from other unrelated ionotropic receptors? Is there physical interaction of RYE and SSS? Co-expression of the point mutant RYE – is it really DN? Etc.). These are all valid points. We attempted to express RYE in S2 cells to test interactions with SSS, but, as noted by others previously for nAChR subunits, we could not get consistent expression. Thus, we could not perform co-immunoprecipitation assays. We have included this and other caveats in the Discussion. We have also deleted mention of the interaction data from the Abstract, and toned down our conclusions. However, we believe it is worth documenting the interaction in the manuscript, given that the genetic experiments are now stronger and the genetic and electrophysiology experiments are consistent in indicating repression of RYE by SSS. We believe the data will be of interest to many researchers, in that they indicate a conserved mechanism for regulation of nAchRs such as RYE by SSS-like molecules (given the known Lynx1-nAchR data in mammals). As noted above, Bill Joiner has also obtained evidence for regulation of nAchRs by SSS (personal communication). It is also interesting that SSS seems to promote SHAKER expression yet suppress RYE. How do the authors fit this into a global model? They casually say its sleep promoting role is dominant but how would this really work? One thing we are never shown is where RYE is expressed in the brain. What is the pattern of rye-GAL4? Does this shed any light on the issue of SSS function? Since SHAKER is basically all over the brain perhaps RYE is more tightly localized and this might allow dissection of differential local effects of SSS on activity? We have added more discussion of these issues. As sss mutants have a stronger sleep phenotype than Shaker, it is not surprising that sss also has other functions. For instance, SSS may normally promote sleep, not only by promoting Shaker activity, but also by inhibiting activity of various nAchRs, most of which are likely wake-promoting (RYE is clearly an exception). We have included the expression pattern of rye-GAL4 driven GFP. It is quite broad, so it does not reveal why the effect of SSS on RYE is masked in sss mutants. Possibly, co-expression of RYE and SSS occurs in a limited number of sleep-regulating cells. Reviewer 2 comments: This paper presents studies that are truly a break-through for the sleep field - the identification of a mutant (rye) in which the affected protein is clearly part of the sleep homeostat (process S), which responds to increasing periods of wakefulness by producing a proportional increase in sleep drive. While the existence of such a homeostat is well supported by sleep behavior, the molecular basis has remained mysterious, and therefore this manuscript presents an important entry point for such a molecular analysis. The experiments are thorough, well controlled and convincing. The mutation affects a subunit for the nicotinic acetyl choline receptor, and the fact that a protein identified as mutated in a previously isolated short-sleeping mutant (sss) is shown to negatively regulate RYE is important because it suggests that the genetic analysis of sleep in Drosophila may be identifying some mutants in a single genetic pathway - something that has not been clear thus far. One perhaps could have hoped that this manuscript would also reveal the signals that lead to upregulation of RYE (i.e., more about the pathway for the sleep homeostat), but this will undoubtedly require more years of work by multiple labs. We thank the reviewer for these very complimentary remarks. The data supporting a role for RYE in the sleep homeostat are very compelling, but unless I'm missing something it seems to me that RYE expression is more likely to be triggered by an upstream S process than to be a direct part of the actual S process. For one thing, the phase for RYE expression is not right. A factor which directly responds to S should build up during wakefulness and dissipate during sleep, but RYE accumulates when the flies are asleep and only dissipates towards the end of sleep. While this feature of RYE expression alone might suggest that RYE accumulates during sleep to measure sleep recovery and promote waking, the short-sleep phenotype of the mutant and the elevated levels of RYE in various short-sleep mutants and under conditions of sleep deprivation are not consistent with this alternative (so it does seem that RYE is part of the process S). Another interesting feature is that RYE overexpression in a wild type genetic background does not alter sleep, which is inconsistent with a factor that directly drives the S process (this should elevate or phase advance sleep). The authors note this paradox and postulate that RYE overexpression may not be sufficient to induce sleep, or may not produce higher levels of RYE in the relevant cells (perhaps overexpressed proteins is not stable in these cells). Along these lines, perhaps RYE can only accumulate when the S process reaches a threshold that triggers sleep, and then RYE remains high until sleep debt is dissipated. Consideration of these points needs to be added to the Discussion; if nothing else, there needs to be more discussion of the phase of RYE expression and its relationship to its postulated role in the sleep homeostat. These are all great points. We agree that RYE could be immediately downstream of process S. RYE levels may be higher in short sleepers because those mutants have defects in further downstream regulators (e.g., dopamine pathways). We have added discussion of these possibilities to the manuscript. Reviewer 3 comments: This manuscript by Shi et al. describes sleep phenotypes of a very interesting mutation in Drosophila named redeye (rye). The authors do a very commendable job of isolating, identifying, characterizing and defining this mutation and in so doing further establish Drosophila as a powerful platform to study the biochemical and genetic basis of sleep. The authors convincingly show that loss of Rye leads to a short-sleeping phenotype that can be rescued partially by adding back Rye in a domain circumscribed by a newly generated Rye-GAL4 driver line and weakly phenocopied using RNAi. What is most interesting though is that the Rye protein (assayed using newly generated Rye antibodies) cycles during the day and is most prominently present just before sleep onset, is elevated by sleep deprivation and in several short-sleeping mutants such as sleepless, insomniac and fumin, but is not controlled by the clock machinery. These are hallmarks of a true “somnogen”; however, Rye fails in one test, i.e., artificially increased expression of Rye does not promote sleep. Even so, it seems clear that as the authors suggest, Rye is part of the sleep homeostat and is necessary but not sufficient for sleep drive. This is a very interesting study and is suitable for publication in eLife. One area that could have been investigated a bit more deeply is that of the tissue-specificity of Rye. The authors use the Rye-Gal4 and yet suggest that the expression pattern of this GAL4 line may not reflect that of endogenous Rye expression. Given the large number of extant GAL4 lines and some understanding of the sleep circuitry in Drosophila, it might have been instructive to test a few of these (e.g., pan neuronal, dopaminergic neurons, fan shaped body etc) to define the tissue-restricted requirement of Rye, if any. This could be most simply achieved using RNAi (though the phenotypes are arguably weaker than Rye mutants), selective rescue of Rye phenotypes using the UAS-Rye transgene, or perhaps even attempting to test if strong Rye over-expression in neuronal subsets might induce sleep (due to either stronger over-expression than Rye-GAL4 or a circuit-specific effect of Rye elevation). As the reviewer notes, the RNAi phenotype is weak, so we did not use this as an assay to identify the relevant circuit. We are attempting to map the circuit through other means, but do not have any conclusions thus far. A minor point is the difference in the timing of the first peak of Rye between wild type and clock mutants (). Do the authors think this is relevant or is the peak of Rye temporally more loosely defined than, say, clock proteins? Overall, this is an excellent manuscript and one of the few that describes a protein that is clearly correlated with sleep drive. Mechanistic associations with sleepless and channel activity further highlight the importance of this protein in sleep regulation. The peak of RYE is indeed more loosely defined than that of clock proteins. The phase is even looser in short-sleeping mutants and in Clk. It is possible that these data reflect the nature of Process S, which is perhaps more flexible/sloppy than Process C (circadian control).
  30 in total

1.  Kv3 potassium channels control the duration of different arousal states by distinct stochastic and clock-like mechanisms.

Authors:  Rolf H Joho; Gerald A Marks; Felipe Espinosa
Journal:  Eur J Neurosci       Date:  2006-03       Impact factor: 3.386

2.  Dopamine is a regulator of arousal in the fruit fly.

Authors:  Kazuhiko Kume; Shoen Kume; Sang Ki Park; Jay Hirsh; F Rob Jackson
Journal:  J Neurosci       Date:  2005-08-10       Impact factor: 6.167

3.  A two process model of sleep regulation.

Authors:  A A Borbély
Journal:  Hum Neurobiol       Date:  1982

4.  Cloning and heterologous expression of Dalpha4, a Drosophila neuronal nicotinic acetylcholine receptor subunit: identification of an alternative exon influencing the efficiency of subunit assembly.

Authors:  S J Lansdell; N S Millar
Journal:  Neuropharmacology       Date:  2000-10       Impact factor: 5.250

5.  Reduced sleep in Drosophila Shaker mutants.

Authors:  Chiara Cirelli; Daniel Bushey; Sean Hill; Reto Huber; Robert Kreber; Barry Ganetzky; Giulio Tononi
Journal:  Nature       Date:  2005-04-28       Impact factor: 49.962

6.  Identification of a biomarker for sleep drive in flies and humans.

Authors:  Laurent Seugnet; Jaime Boero; Laura Gottschalk; Stephen P Duntley; Paul J Shaw
Journal:  Proc Natl Acad Sci U S A       Date:  2006-12-13       Impact factor: 11.205

Review 7.  Nicotinic acetylcholine receptors of muscles and nerves: comparison of their structures, functional roles, and vulnerability to pathology.

Authors:  Jon M Lindstrom
Journal:  Ann N Y Acad Sci       Date:  2003-09       Impact factor: 5.691

8.  Gender dimorphism in the role of cycle (BMAL1) in rest, rest regulation, and longevity in Drosophila melanogaster.

Authors:  Joan C Hendricks; Sumei Lu; Kazuhiko Kume; Jerry C P Yin; Zhaohai Yang; Amita Sehgal
Journal:  J Biol Rhythms       Date:  2003-02       Impact factor: 3.182

9.  Homer1a and 1bc levels in the rat somatosensory cortex vary with the time of day and sleep loss.

Authors:  Scott E Nelson; Deborah L Duricka; Kenneth Campbell; Lynn Churchill; James M Krueger
Journal:  Neurosci Lett       Date:  2004-08-26       Impact factor: 3.046

10.  The DrosDel collection: a set of P-element insertions for generating custom chromosomal aberrations in Drosophila melanogaster.

Authors:  Edward Ryder; Fiona Blows; Michael Ashburner; Rosa Bautista-Llacer; Darin Coulson; Jenny Drummond; Jane Webster; David Gubb; Nicola Gunton; Glynnis Johnson; Cahir J O'Kane; David Huen; Punita Sharma; Zoltan Asztalos; Heiko Baisch; Janet Schulze; Maria Kube; Kathrin Kittlaus; Gunter Reuter; Peter Maroy; Janos Szidonya; Asa Rasmuson-Lestander; Karin Ekström; Barry Dickson; Christoph Hugentobler; Hugo Stocker; Ernst Hafen; Jean Antoine Lepesant; Gert Pflugfelder; Martin Heisenberg; Bernard Mechler; Florenci Serras; Montserrat Corominas; Stephan Schneuwly; Thomas Preat; John Roote; Steven Russell
Journal:  Genetics       Date:  2004-06       Impact factor: 4.562

View more
  39 in total

1.  Pleiotropic Effects of Loss of the Dα1 Subunit in Drosophila melanogaster: Implications for Insecticide Resistance.

Authors:  Jason Somers; Hang Ngoc Bao Luong; Judith Mitchell; Philip Batterham; Trent Perry
Journal:  Genetics       Date:  2016-11-09       Impact factor: 4.562

2.  Quantitative imaging of sleep behavior in Caenorhabditis elegans and larval Drosophila melanogaster.

Authors:  Matthew A Churgin; Milan Szuperak; Kristen C Davis; David M Raizen; Christopher Fang-Yen; Matthew S Kayser
Journal:  Nat Protoc       Date:  2019-04-05       Impact factor: 13.491

3.  Control of sleep by a network of cell cycle genes.

Authors:  Dinis J S Afonso; Daniel R Machado; Kyunghee Koh
Journal:  Fly (Austin)       Date:  2015       Impact factor: 2.160

4.  Genetic Dissociation of Daily Sleep and Sleep Following Thermogenetic Sleep Deprivation in Drosophila.

Authors:  Christine Dubowy; Katarina Moravcevic; Zhifeng Yue; Joy Y Wan; Hans P A Van Dongen; Amita Sehgal
Journal:  Sleep       Date:  2016-05-01       Impact factor: 5.849

5.  Behavioral and genetic features of sleep ontogeny in Drosophila.

Authors:  Leela C Dilley; Abigail Vigderman; Charlette E Williams; Matthew S Kayser
Journal:  Sleep       Date:  2018-07-01       Impact factor: 5.849

6.  Glutamate Is a Wake-Active Neurotransmitter in Drosophila melanogaster.

Authors:  John E Zimmerman; May T Chan; Olivia T Lenz; Brendan T Keenan; Greg Maislin; Allan I Pack
Journal:  Sleep       Date:  2017-02-01       Impact factor: 5.849

Review 7.  Circadian Rhythms and Sleep in Drosophila melanogaster.

Authors:  Christine Dubowy; Amita Sehgal
Journal:  Genetics       Date:  2017-04       Impact factor: 4.562

8.  Neuropeptide Y Regulates Sleep by Modulating Noradrenergic Signaling.

Authors:  Chanpreet Singh; Jason Rihel; David A Prober
Journal:  Curr Biol       Date:  2017-12-07       Impact factor: 10.834

9.  High-Amplitude Circadian Rhythms in Drosophila Driven by Calcineurin-Mediated Post-translational Control of sarah.

Authors:  Sin Ho Kweon; Jongbin Lee; Chunghun Lim; Joonho Choe
Journal:  Genetics       Date:  2018-05-03       Impact factor: 4.562

Review 10.  Sleep, brain vascular health and ageing.

Authors:  Arehally M Mahalakshmi; Bipul Ray; Sunanda Tuladhar; Abid Bhat; Muhammed Bishir; Srinivasa Rao Bolla; Jian Yang; Musthafa Mohamed Essa; Saravana Babu Chidambaram; Gilles J Guillemin; Meena Kishore Sakharkar
Journal:  Geroscience       Date:  2020-08-03       Impact factor: 7.713

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.