Literature DB >> 24466348

Characterization of the staphylococcal cassette chromosome composite island of Staphylococcus haemolyticus SH32, a methicillin-resistant clinical isolate from China.

Dongliang Yu1, Borui Pi2, Yan Chen3, Yanfei Wang2, Zhi Ruan2, Michael Otto4, Yunsong Yu2.   

Abstract

Staphylococcal cassette chromosome (SCC) elements contribute considerably to virulence and resistance to antibiotic agents in staphylococci. SCC elements in coagulase-negative staphylococci (CoNS) are highly diverse and there is evidence suggesting that they serve as a reservoir for antibiotic resistance genes in methicillin-resistant Staphylococcus aureus (MRSA). However, only a small number of SCC elements have been characterized in CoNS and their exact roles in the emergence and evolution of MRSA remain to be demonstrated. Here, we determined the structure of an SCC composite island (CISH32) found in the clinical Staphylococcus haemolyticus isolate SH32 by whole-genome DNA sequencing. CISH32 was 48 kb in length and mainly composed of two imperfect SCC elements, namely (i) a ΨSCCmec(SH32) part containing a class C1 mec gene complex but lacking ccr genes and (ii) a SCCSH32 part with a ccrA5B3 gene complex but lacking mec genes. In addition, CISH32 contained a type III restriction-modification system and several resistance loci, for example genes conferring resistance to cadmium and arsenic. ΨSCCmec(SH32) is almost entirely identical to a pseudo SCCmec element found in S. haemolyticus WCH1 and shares pronounced sequence similarity to a ΨSCCmec element of S. haemolyticus JCSC1435. However, staphylococci other than S. haemolyticus, including S. aureus and S. epidermidis, contain homologs of SCCSH32 that are more similar to SCCSH32 than those elements found in S. haemolyticus, suggesting that CISH32 of S. haemolyticus SH32 was assembled in recent evolutionary events. Moreover, the composite structure of CISH32 indicates that the detection of class C1 mec and ccrA5B3 gene complexes in S. haemolyticus does not always indicate the existence of a UT9-type SCCmec element, which has remained questionable.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24466348      PMCID: PMC3900703          DOI: 10.1371/journal.pone.0087346

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The emergence and spread of methicillin-resistant Staphylococcus aureus (MRSA) has become a worldwide problem, which is in part due to the extensive repertoire of virulence factors present in many MRSA strains and the fact that some isolates also contain genes providing resistance to a wide array of other antibiotic agents [1]. Virulence and antibiotic resistance genes are mostly encoded by mobile genetic elements (MGEs), including plasmids, transposons and staphylococcal cassette chromosome (SCC) elements [2]. SCCmec elements represent a particular concern, because they harbor mec genes (mecA/mecC) providing resistance to methicillin and almost all other beta-lactam antibiotics. In recent years, an extensive genetic diversity of SCCmec elements has been revealed in S. aureus and other staphylococci, by PCR assays, DNA microarrays, or genome sequencing [3]–[7]. These studies also showed that coagulase-negative staphylococci (CoNS) harbor more diverse SCCmec elements than S. aureus and are a potential reservoir for the transfer of SCCmec elements to S. aureus [8]. However, the exact role of SCCmec elements of CoNS in the emergence and evolution of MRSA is largely unknown and requires characterization of more SCC/SCCmec elements. In the present work, we identified an SCC composite island (CI) in the clinical S. haemolyticus isolate SH32 and analyzed its structure in comparison to related SCC elements.

Materials and Methods

Ethics statement, strain and DNA preparation

S. haemolyticus SH32 was isolated in 2003 from the blood of an inpatient at First Affiliated Hospital, College of Medicine, Zhejiang University. We obtained an exempt status from the Institutional Review Board of the First Affiliated Hospital, College of Medicine, Zhejiang University to use this strain to perform all experiments in this study. Antibiotic susceptibility of the strain was described previously [9]. Genomic DNA was prepared with a QIAamp DNA mini kit (Qiagen) according to the manufacturer's instructions.

Sequencing and gap closure

Both pair-end and mate-pair (3-kb insertion) libraries were constructed and sequenced using a HiSeq 2000 platform (Illumina, USA) in the Chinese National Human Genome Center, Shanghai. The acquired 2×100 bp reads were assembled by velvet software [10]. Identification of contigs representing parts of SCC elements was performed using BLAST tools [11], using mapping marker genes such as orfX, mecA and the ccr gene complex. Gap closure was then performed using standard PCR and PCR product sequencing using a 3730XL instrument (Applied Biosystems, USA).

Annotation and comparative analysis

Gene prediction in S. haemolyticus SH32 was performed using GeneMark-hmm (V2.08) [12]. The nucleotide acid sequence of predicted genes and their deduced amino acid sequences were subsequently compared against the non-redundant protein database provided by NCBI (www.nlm.nih.gov) using BLAST tools [11]. The comparison of different SCC elements was performed using BLASTN and displayed by in-house developed perl scripts. The sequences used in the comparative analysis were retrieved from the NCBI website.

Detection of mecA and ccrA5B3

A specific primer pair (forward: GAACCGCAGGTCTCTTCAGATCTAC; reverse: CACCTTGTCCGTAACCTGAATC) was used to determine the class C1 mec gene complex using standard PCR. Long-distance PCR was performed to detect ccrA5B3 (forward: CGCGCTATTATCACGAATCC; reverse: GCGTGATTAAGTGCGTTAGC). The PCR products were subsequently sequenced using an ABI 3730 sequence analyzer (Applied Biosystems).

Results and Discussion

Assembly and annotation

Genome sequencing of S. haemolyticus SH32 generated 339 contigs. Five of them harbored orfX, mecA and ccr genes or fragments, indicating that they contain fragments of an SCCmec element. The gaps between these contigs were then closed by standard PCR and PCR product sequencing, which yielded one contig with a length of 197,413 bp and an average G+C content of 33.3% (accession number: KF006347). Among a total of 201 genes that were identified in this contig, most had their best-hit homologs in S. haemolyticus JCSC1435. Almost half of the genes in the identified SCC composite island (hereafter referred to as CI) were more similar to their counterparts in S. epidermidis, S. aureus and other staphylococci than those reported from S. haemolyticus (Figure 1A). Partially, this may be due to the limited information available about SCC/SCCmec elements in S. haemolyticus, but it may also suggest events of horizontal transfer of those SCCmec elements between the respective staphylococcal species.
Figure 1

General features of the SCC composite island in Staphylococcus haemolyticus SH32.

(A) Distribution of the best-hit homologs of genes contained in the SH32 SCC composite island in staphylococci. The G+C content of the SCC region (from 70 to 120 kb) was calculated with a window size of 200 bp. 32.8% is the average G+C content of the whole chromosome. (B) Gene structure of the SH32 SCC composite island. Predicted genes in SCC elements are represented by triangles, while their direction indicates the encoding strands. Black triangles denote IS431 genes. Abbreviations: DR, direct repeat sequence; IR, inverted repeat sequence.

General features of the SCC composite island in Staphylococcus haemolyticus SH32.

(A) Distribution of the best-hit homologs of genes contained in the SH32 SCC composite island in staphylococci. The G+C content of the SCC region (from 70 to 120 kb) was calculated with a window size of 200 bp. 32.8% is the average G+C content of the whole chromosome. (B) Gene structure of the SH32 SCC composite island. Predicted genes in SCC elements are represented by triangles, while their direction indicates the encoding strands. Black triangles denote IS431 genes. Abbreviations: DR, direct repeat sequence; IR, inverted repeat sequence.

General features of the SCC composite island in SH32

The CI region, which is characterized by the bracketing 15-bp sequences found in integration site sequences containing directed (DR) and inverted repeats (IR) (Figure 1B), is about 48 kb in length and comprises 54 predicted genes (SHP0065-118) (Table 1). The G+C content of CI is 31.6%, slightly lower than that of the whole chromosome of S. haemolyticus (∼32.8%), which is possibly due to an enrichment of genes originating from horizontal gene transfer in SCC elements. In contrast to the composite islands found in S. epidermidis ATCC 12228 and S. haemolyticus JCSC1435, for which eight and six copies, respectively, of integration site sequences (ISS) were found and which are composed of multiple SCC elements (or remnants) [13], [14], only two copies of ISS were found in CI in addition to that present in orfX. This suggests that less complex integration events occurred in the SCC element in S. haemolyticus SH32. According to the nomenclature of IWG-SCC [15], the structure of CI was described as orfX-ΨSCCmec(SH32)-SCC, i.e. a pseudo SCCmec element that contains a mec gene complex but lacks ccr recombinases [hereafter referred to as ΨSCCmec(SH32)], and an SCC element that harbors ccr but lacks mec genes (hereafter referred to as SCC).
Table 1

Gene content of the SCCmec element in Staphylococcus haemolyticus SH32.

LocusPosition1 RegionsCharacteristic genesDescription
SHP006570295–70774 orfX rRNA large subunit methyltransferase
SHP006670903–71889J3ADP-ribosylglycohydrolase
SHP006771908–73242Permease
SHP006873239–74177truncated ribokinase
SHP006974215–74889IS431 transposase for IS431mec
SHP007075693–75346transcriptional regulator
SHP007175771–76454ThiJ/PfpI family protein
SHP007276476–77141NAD dependent epimerase/dehydratase
SHP007377145–78149Oxidoreductase
SHP007478158–78523hypothetical protein
SHP007579059–79676 cadD cadmium binding protein CadD
SHP007679695–80036 cadX cadmium resistant accessory protein
SHP007780457–80056 arsC arsenate reductase
SHP007881764–80475 arsB arsenical pump membrane protein
SHP007982081–81764 arsR arsenical resistance operon repressor
SHP008082211–82885 mec gene complexIS431 transposase for IS-like element
SHP008183061–85067 mecA penicillin-binding protein 2′
SHP008285541–85113uncharacterized protein ydem
SHP008386381–85638glycerophosphoryl diester phosphodiesterase
SHP008487465–872983-hydroxy-3-methylglutaryl CoA synthase
SHP008587723–88397IS431 transposase for IS-like element
SHP008688660–90720J2R copA P-type ATPase copper (Cu2+) transporter
SHP008790735–92168multicopper oxidase mco
SHP008892188–92478putative lipoprotein
SHP008993079–92684 arsC arsenate reductase
SHP009094390–93098 arsB arsenite-antimonite efflux pump
SHP009194704–94390 arsR arsenic resistance operon repressor
SHP009294844–94701hypothetical protein
SHP009396574–94844 arsA arsenite-activated ATPase
SHP009496902–96555 arsD arsenical resistance operon trans-acting
repressor
SHP009597185–97379hypothetical protein
SHP009697425–97745ArsR family transcriptional regulator
SHP009797833–98717putative permease
SHP009898731–98859hypothetical protein
SHP009999411–99295J2Lhypothetical protein
SHP010099585–99977type III R-M system enzyme, M subunit
SHP0101100048–101532type III R-M system protein
SHP0102101534–104503type III R-M, res subunit
SHP0103104510–105802hypothetical protein
SHP0104105786–107660type III R-M, res subunit
SHP0105107961–107842hypothetical protein
SHP0106108112–107981hypothetical protein
SHP0107108630–108127hypothetical protein
SHP0108108959–108648hypothetical protein
SHP0109109396–109046hypothetical protein
SHP0110110695–109961cyclopentanol dehydrogenase
SHP0111112423–110777 ccr gene complex ccrB cassette chromosome recombinase B
SHP0112113793–112459 ccrA cassette chromosome recombinase A
SHP0113114595–113981J1 cch cassette chromosome helicase
SHP0114114682–114957 ΨccrA cassette chromosome recombinase A
SHP0115115428–115069zinc/iron permease
SHP0116115635–115961HTH-type transcriptional repressor CzrA
SHP0117116291–118216cadmium-translocating P-type ATPase
SHP0118119212–118538IS431 transposase for IS431mec

gene position in the contig (accession number: KF006347).

gene position in the contig (accession number: KF006347).

ΨSCCmec(SH32) is conserved in S. haemolyticus

ΨSCCmec(SH32) is about 28 kb in length (as determined by the size of the DNA region between DR1 and DR2), and contains three regions, a mec gene complex, a J3 region and a J2R region. The mec gene complex belongs to the C1 class with the common structure IS431-mecA-ΔmecR1-IS431, with two copies of IS431 arranged in the same direction. J2R, the region between the mec gene complex and DR2, is about 10 kb in length and encodes two heavy metal resistance genes/gene clusters, copA and arsCBRAD, conferring resistance to copper and arsenic, respectively. Interestingly, the J3 region (extending from IRR to the mec gene complex) harbors another cluster of arsenic resistance genes (arsCBR). The corresponding copies of the arsC, arsB and arsR genes in J2R and J3 share 84%, 86% and 63% amino acid identity, respectively. However, homologs of arsCBR and arsCBRAD with higher similarity were found in S. epidermidis and S. haemolyticus isolates, indicating that these two ars clusters in S. haemolyticus SH32 were not generated by duplication and divergence, but are derived from different ancestors. Finally, the J3 region contains additional cadmium resistance genes, cadD and cadX. ΨSCCmec(SH32) is largely identical to ΨSCC (Figure 2). However, ΨSCC harbors an accessory region downstream of DR2 (ca. 17 kb, designated R3), which contains two IS elements, IS431 and ISSha1, as well as several genes encoding putative bacterial virulence factors, such as the proline permease PutP and the ion transporter FeoB [16], [17]. In contrast, ΨSCCmec(SH32) contains an accessory 6-kb insertion between the lip gene (SHP0088, encoding a lipoprotein) and DR1-2 (designated J2R-6k), which mainly encodes the ars gene cluster and is conserved in S. haemolyticus JCSC1435 (SH0089-98). Given the different positions of the R3 regions in ΨSCC (lip-ISS-insertion) and the J2R-6k in ΨSCCmec(SH32) (lip-insertion-ISS), it is apparent that they were acquired by independent events. Zong et al. proposed that the R3 region resulted from homologous recombination, as no DR could be identified in the junction region [18]. However, considering that the J2R-6k region is well conserved in the isolates SH32 and JCSC 1435, this is most probably a common feature of a hypothetical ancestral S. haemolyticus clone that was lost in the isolate WCH1.
Figure 2

Comparison of SCCmec elements in three Staphylococcus haemolyticus isolates.

A: WCH1; B: SH32; C: JCSC 1435. mec(C1/C2): class C1/C2 mec complex. Rectangles with the same colors denote homologous regions. Dashed lines indicate their ends. Vertical solid lines indicate the site of integration site sequences. Green triangles denote insertion sequences.

Comparison of SCCmec elements in three Staphylococcus haemolyticus isolates.

A: WCH1; B: SH32; C: JCSC 1435. mec(C1/C2): class C1/C2 mec complex. Rectangles with the same colors denote homologous regions. Dashed lines indicate their ends. Vertical solid lines indicate the site of integration site sequences. Green triangles denote insertion sequences.

Comparative analysis of SCC

SCC, bracketed by DR2 and DR3, is about 20 kb in length and divided into three regions, namely a ccr gene complex and the J2L and J1 regions. The recombinase genes in SCC are of the types ccrA5 and ccrB3 and are 1,335 bp and 1,647 bp in length, respectively. They are identical to those of S. haemolyticus H9, which were originally reported as ccrB SHP and ccrA SHP [9]. A ccrA5B3 complex has also been identified in another CoNS, S. cohnii WC28 (accession number GU370073), and the coagulase-positive S. pseudintermedius KM241 (accession number AM904731, originally reported as ccrA5B5) [19], [20]. The ccrA5 gene of SCC shares 89.7% and 91.5% nucleotide identity, and the ccrB3 gene 87.7% and 86.4%, with the corresponding genes of the SCCmec elements of S. cohnii WC28 and S. pseudintermedius KM241, respectively. Using a similarity search in the non-redundant NCBI nucleotide database, we also found highly similar (>99% identity) ccr gene complexes in four S. aureus isolates (accession numbers: HF569102, HF569097, HF569093 and GU066221). J1, the region extending from the ccr gene complex to IRL1, is about 5.5 kb in length and contains six genes (SHP0113-118), including a truncated ccrA gene and genes encoding a cassette chromosome helicase and two ion permeases. Comparative analysis revealed that the J1 region is almost identical to those found in SCCpbp4 of S. epidermidis ATCC 12228 (accession number BK001539) and SCC elements in S. aureus isolates M1 (accession number HM030720, type IV) and BK20781 (accession number FJ670542, type VIII). The J2L region in SCC, i.e. the region between the ccr gene complex and DR2, is about 10 kb in length. In contrast to type I restriction-modification (R-M) systems, such as hsdR, hsdS and hsdM, identified in most known SCCmec elements, a type III R-M system was found in SCC J2L. Interestingly, this R-M system is almost identical to an R-M system found in S. epidermidis (accession number NZ_AKGM01000027). In addition, we identified several hypothetical proteins in J2L, for example SHP0106-109, homologs of which are found in S. haemolyticus JCSC 1435 and isolates from other staphylococcal species like S. epidermidis and S. aureus. SHP0107 and SHP0108 are conserved in both species with an identity value of >92%, but SHP0106 and SHP0109 show higher similarity (98% and 97% identity values, respectively) to their counterparts in S. aureus or S. epidermidis than S. haemolyticus JCSC1435 (86% and 55%, respectively). The ccrA5B3 gene complex has been identified in several staphylococcal species, both coagulase-negative and coagulase-positive staphylococci, with varied identity, revealing that it was exchanged between staphylococcal species during evolution. Remarkably, although ccr genes encoded by SCC are not found in S. epidermidis, several S. epidermidis isolates contain regions that are highly homologous to the two junction regions in SCC, J1 and J2L, which include the type III R-M system. R-M systems are responsible for limiting the uptake of foreign DNA in bacteria; and both types I and III R-M systems have been identified as major barriers to lateral gene transfer in S. aureus [21]–[23]. Therefore, the apparent frequent gene transfer between S. haemolyticus and S. epidermidis in SCC regions may be ascribed to the fact that they have similar R-M systems.

Detection of ccrA5B3 in methicillin-resistant S. haemolyticus

We collected a total of 88 methicillin-resistant S. haemolyticus (MRSH) isolates in previous work [9], including 42 isolates that are positive for the arcA gene of the arginine catabolic mobile element (ACME) [24]_ENREF_10. By using PCR amplification and dot blotting, class C1 mec gene complexes and the ccrA5B3 gene were detected in eight of these 42 isolates, including the isolate SH32 [9]. In this work, we investigated the other 46 ACME-arcA negative isolates and found that another two isolates harbored ccrA5B3 gene complexes. Interestingly, both of them also contained class C1 mec gene complexes, suggesting that these isolates diverged after the assembly of class C1 mec and ccrA5B3 gene complexes.

Concluding remarks

More detailed knowledge of CoNS SCCmec elements is of special importance, as they are believed to serve as reservoirs for SCCmec elements transferred to S. aureus [25]. In this study we characterized the entire structure of a SCC composite island in S. haemolyticus, which we found is composed of two SCC remnants. Results from a previous study suggested the presence of a UT9-type SCCmec element in S. haemolyticus that encodes both a class C1 mec and a ccrA5B3 gene complex [6]. Notably, we here found that these two gene complexes are present in two separate SCC remnants, and are not assembled in one SCCmec element. Although the class C1 mec complex and ccrA5B3 genes have been identified in several other S. haemolyticus isolates, our results indicate that confirming the existence of a UT9 SCCmec element solely by PCR assays is problematic, necessitating the analysis of further genome sequences.
  25 in total

Review 1.  Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus.

Authors:  Binh An Diep; Steven R Gill; Richard F Chang; Tiffany HaiVan Phan; Jason H Chen; Matthew G Davidson; Felice Lin; Jessica Lin; Heather A Carleton; Emmanuel F Mongodin; George F Sensabaugh; Françoise Perdreau-Remington
Journal:  Lancet       Date:  2006-03-04       Impact factor: 79.321

2.  Velvet: algorithms for de novo short read assembly using de Bruijn graphs.

Authors:  Daniel R Zerbino; Ewan Birney
Journal:  Genome Res       Date:  2008-03-18       Impact factor: 9.043

3.  Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements.

Authors: 
Journal:  Antimicrob Agents Chemother       Date:  2009-08-31       Impact factor: 5.191

4.  GeneMark.hmm: new solutions for gene finding.

Authors:  A V Lukashin; M Borodovsky
Journal:  Nucleic Acids Res       Date:  1998-02-15       Impact factor: 16.971

Review 5.  Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.

Authors:  S F Altschul; T L Madden; A A Schäffer; J Zhang; Z Zhang; W Miller; D J Lipman
Journal:  Nucleic Acids Res       Date:  1997-09-01       Impact factor: 16.971

Review 6.  Staphylococcal cassette chromosome mec: recent advances and new insights.

Authors:  Anna C Shore; David C Coleman
Journal:  Int J Med Microbiol       Date:  2013-03-14       Impact factor: 3.473

7.  Sau1: a novel lineage-specific type I restriction-modification system that blocks horizontal gene transfer into Staphylococcus aureus and between S. aureus isolates of different lineages.

Authors:  Denise E Waldron; Jodi A Lindsay
Journal:  J Bacteriol       Date:  2006-08       Impact factor: 3.490

8.  Whole-genome sequencing of staphylococcus haemolyticus uncovers the extreme plasticity of its genome and the evolution of human-colonizing staphylococcal species.

Authors:  Fumihiko Takeuchi; Shinya Watanabe; Tadashi Baba; Harumi Yuzawa; Teruyo Ito; Yuh Morimoto; Makoto Kuroda; Longzhu Cui; Mikio Takahashi; Akiho Ankai; Shin-ichi Baba; Shigehiro Fukui; Jean C Lee; Keiichi Hiramatsu
Journal:  J Bacteriol       Date:  2005-11       Impact factor: 3.490

9.  Characterization of new staphylococcal cassette chromosome mec (SCCmec) and topoisomerase genes in fluoroquinolone- and methicillin-resistant Staphylococcus pseudintermedius.

Authors:  Sybill Descloux; Alexandra Rossano; Vincent Perreten
Journal:  J Clin Microbiol       Date:  2008-02-27       Impact factor: 5.948

10.  Impact of the high-affinity proline permease gene (putP) on the virulence of Staphylococcus aureus in experimental endocarditis.

Authors:  A S Bayer; S N Coulter; C K Stover; W R Schwan
Journal:  Infect Immun       Date:  1999-02       Impact factor: 3.441

View more
  4 in total

1.  Characterization of antibiotic-resistant, coagulase-negative staphylococci from fresh produce and description of Staphylococcus shinii sp. nov. isolated from chives.

Authors:  Gyu-Sung Cho; Bo Li; Erik Brinks; Charles M A P Franz
Journal:  J Microbiol       Date:  2022-06-22       Impact factor: 2.902

2.  Characterization of a Novel Composite Staphylococcal Cassette Chromosome mec in Methicillin-Resistant Staphylococcus pseudintermedius from Thailand.

Authors:  Pattrarat Chanchaithong; Nuvee Prapasarakul; Vincent Perreten; Sybille Schwendener
Journal:  Antimicrob Agents Chemother       Date:  2015-12-07       Impact factor: 5.191

3.  Novel Organization of the Staphylococcal Cassette Chromosome mec Composite Island in Clinical Staphylococcus haemolyticus and Staphylococcus hominis Subspecies hominis Isolates from Dogs.

Authors:  Nathita Phumthanakorn; Thidathip Wongsurawat; Piroon Jenjaroenpun; Alongkorn Kurilung; Nuvee Prapasarakul
Journal:  Microbiol Spectr       Date:  2022-07-05

4.  Skin Commensal Staphylococci May Act as Reservoir for Fusidic Acid Resistance Genes.

Authors:  Wei-Chun Hung; Hsiao-Jan Chen; Yu-Tzu Lin; Jui-Chang Tsai; Chiao-Wei Chen; Hsiao-Hung Lu; Sung-Pin Tseng; Yao-Yu Jheng; Kin Hong Leong; Lee-Jene Teng
Journal:  PLoS One       Date:  2015-11-18       Impact factor: 3.240

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.