Literature DB >> 24396595

AP-1 Gene Expression Levels May Be Correlated with Changes in Gene Expression of Some Stemness Factors in Colon Carcinomas.

Panagiotis Apostolou1, Maria Toloudi1, Eleni Ioannou1, Marina Chatziioannou1, Eleni Kourtidou1, Ioanna Vlachou1, Ioannis Papasotiriou1.   

Abstract

The AP-1 transcription factor is a heterodimer protein that regulates gene expression in response to a variety of extrinsic stimuli through signal transduction. It is involved in processes including differentiation, proliferation, and apoptosis. Among the genes it regulates are transcription factors that contribute to the stemness phenotype. Cancer stem cells have the ability to self-renew and initiate differentiation into heterogenic cancer cells, which may cause metastasis and relapses. In the present study, we evaluated the effect of AP-1 complexes, as well as the C-FOS and C-JUN genes, in relation to NANOG, OCT3/4, and SOX2 transcription factors. All assays were undertaken with colon cancer stem cells. Knockdown experiments with siRNA were performed for each individual gene as well as their combination. Changes in gene expression were calculated with quantitative polymerase chain reaction experiments, while the effect on cell cycle distribution and apoptosis was studied by flow cytometry. The results differed depending on the percentage of repression, as well as the gene that was suppressed. In all cases, the number of apoptotic cells was increased. These findings indicate that AP-1 may have a crucial role in the maintenance of cancer stem cells.

Entities:  

Year:  2013        PMID: 24396595      PMCID: PMC3874301          DOI: 10.1155/2013/497383

Source DB:  PubMed          Journal:  J Signal Transduct        ISSN: 2090-1747


1. Introduction

The AP-1 transcription factor consists of various proteins including C-FOS and C-JUN. Its function is to regulate gene expression in response to many stimuli, and it is involved in multiple cellular processes, such as differentiation, proliferation, and apoptosis [1, 2]. The monomers of the AP-1 complex are encoded by different genes. These transcription factors are located downstream many transduction pathways, thus making their role critical [3, 4]. Cancer stem cells (CSCs) are cells that are defined by their ability to self-renew and undergo asymmetric cell division, proliferation, and differentiation. With respect to their origin, these cells may be caused by disturbance of the self-renewal and differentiation programs occurring in multipotential stem cells, tissue-specific stem cells, progenitor cells, mature cells, and cancer cells [5]. The hallmarks of the CSC phenotype are defined by many genes; however, NANOG, POU5F1 (OCT3/4), and SOX2 have crucial roles [6, 7]. Recent experimental data indicated that C-JUN is important for the maintenance of the self-renewal and tumorigenicity of glioma stem-like cells [8]. According to another study in colon cancer, C-JUN and TCF4 promoted a subpopulation of colorectal cancer tumor cells to adopt a stem-like phenotype via the NANOG promoter [9]. Moreover, C-FOS maintains hematopoietic stem cells in quiescence [10]. The present study aimed to identify the relationship between the AP-1 complex and stemness transcription factors. We attempted to address whether the AP-1 transcription factor is necessary to activate or suppress NANOG, OCT3/4, and SOX2 transcription factors as well as if it has an effect on apoptosis and the cell cycle.

2. Materials and Methods

2.1. Cell Culture

Human colon cancer stem cells (36112-39P; Celprogen) were cultured in appropriate growth medium (M36112-39PS; Celprogen), supplemented with 10% FBS in 25 cm2 flasks (E36102-29P-T25; Celprogen) at 37°C in a 5% CO2 environment.

2.2. Knockdown

During the exponential phase of proliferation, cells were seeded in 24-well plates (E36112-39; Celprogen) and transfected with small interfering RNA (siRNA) specific for C-JUN and C-FOS genes using Lipofectamine 2000 (11668-027; Invitrogen), according to the manufacturer's instructions. The siRNA were designed in accordance with the rules of Reynolds et al. [11], and the sequences were as follows: C-FOS: 5′ UAUCUGAGAAUCCAUCUUAUU 3′ and C-JUN: 5′ ACAUCAUGGGCUAUUUUUA 3′. All sequences were run on BLAST to exclude sequences that would suppress undesired genes and to ensure specificity. After 48 h incubation, the cells were harvested by trypsinization (25200-072; Invitrogen). Samples incubated with Lipofectamine alone (without siRNA) were also tested to study the effect of compound alone on gene expression.

2.3. Evaluation of Cells

Cells were tested in both cellular and molecular assays. The cellular assays were based on the ability of CSCs to form microspheres in semisuspension, using an inverted light microscope. The cultures have previously been evaluated by molecular analyses, including gene expression analysis for specific transcription factors [12]. The authentication of the control cell line was tested each time using molecular biology assays, such as short tandem repeat profiling, the results of which were compared with the manufacturer's profile. Cultivation was continued for more than 30 passages to exclude the possibility of incorporating embryonic stem cells (ESCs) in the experiments, since cancer stem cells are immortal unlike ESCs.

2.4. Molecular Analysis

RNA was extracted from cell cultures using an RNeasy Mini Kit (74105; Qiagen). The RNA samples were evaluated both spectrophotometrically and on agarose gel by checking the 18S-28S rRNA bands. Then, 1 μg of each sample was used as template for cDNA synthesis using an iScript cDNA synthesis kit (1708891; Bio-Rad). Finally, the upper strand was used as template for real-time polymerase chain reaction (PCR), which was performed using the iTaq Universal SYBR Green Supermix (1725124; Bio-Rad). Specific primers for each marker and for an endogenous control gene (18S rRNA) were designed using Gene Expression 1.1 software. The sequence of primers was run on BLAST to exclude those that would amplify undesired genes. The sequence of the primers was as follows: 18SrRNA: forward—5′ TGCCCTATCAACTTTCGATGGTAGTC 3′, reverse—5′ TTGGATGTGGTAGCCGTTTCTCA 3′; NANOG: forward—5′ TGAGATGCCTCACACGGAGACTG 3′, reverse—5′ GGGTTGTTTGCCTTTGGGACTG 3′; POU5F1: forward—5′ GGTGCCTGCCCTTCTAGGAATG 3′, reverse—5′ TGCCCCCACCCTTTGTGTTC 3′; SOX2: forward—5′ CAACGGCAGCTACAGCATGATG 3′, reverse—5′ GCGAGCTGGTCATGGAGTTGTACT 3′; C-FOS: forward—5′ CCTTCACCCTGCCTCTCCTCAAT 3′, reverse—5′ GCCTGGATGATGCTGGGAACA 3′; C-JUN: forward—5′ CCAACTCATGCTAACGCAGCAGTT 3′, reverse—5′ ACCCTTGGCTTTAGTTCTCGGACAC 3′. The PCR program was as follows: initial denaturation at 95°C are 50 cycles of denaturation at 95°C for 10 sec followed by annealing at 59°C for 30 sec. A final extension step was performed at 72°C for 10 min followed by melting curve analyses. Data were analyzed according to the Livak method [13].

2.5. Flow Cytometry

Cells were stained with PE Annexin V and 7-Amino-Actinomycin (7AAD) (559763; BD Biosciences) for 15 min and then resuspended in 0.5 mL sheath fluid (8546859; Beckman Coulter) followed by flow cytometric analysis of more than 50,000 events. The data were analyzed with FCS Express Software (DeNovo). In each case, positive and negative controls were used.

2.6. Statistical Analysis

The quantitative polymerase chain reaction (qPCR) results were tested according to the Kolmogorov-Smirnov test; all samples had normal distribution. Median values were used for the analysis. Finally, Mann-Whitney U tests were also performed on the qPCR data.

3. Results and Discussion

3.1. Gene Expression

Knockdown was up to 55% for C-FOS and up to 45% when C-FOS and C-JUN were knocked down simultaneously, while lower rates were observed following knockdown of C-JUN. The suppression of C-FOS led to increases in the gene expression of stemness transcription factors. In comparison with the control cells, the increase in gene expression was 2.35-fold for NANOG, 2.93-fold for POU5F1 (Oct3/4), and 2.68-fold for SOX2. Knockdown of C-JUN led to increases in POU5F1 and SOX2 expression of 130% and 30%, respectively, while no changes were observed in NANOG; this was in contrast to data resulting from simultaneous repression of C-JUN and C-FOS. The results also differed depending on the rate of reduction in gene expression. In all cases, an increase was observed in POU5F1 expression, with decreases in the other genes. Suppression of the AP-1 complex by 45% led to a 90% increase in POU5F1 expression and a reduction of 10% and 3% in NANOG and SOX2 expression, respectively. NANOG expression was reduced up to 50% when knockdown reached up to 35%; POU5F1 and SOX2 were less affected. Figures 1, 2, 3, and 4 graphically represent the above results.
Figure 1

Relative gene expression analysis of stemness transcription factors, Nanog, Oct3/4, and Sox2, after C-FOS knockdown. Changes in gene expression caused by the suppression of C-FOS. The percentage of knockdown reached 55%.

Figure 2

Relative gene expression analysis of stemness transcription factors, Nanog, Oct3/4, and Sox2, after C-JUN knockdown. Changes in gene expression caused by the suppression of C-JUN. The percentage of knockdown reached 30%.

Figure 3

Relative gene expression analysis of stemness transcription factors, Nanog, Oct3/4, and Sox2, after AP-1 complex knockdown. Changes in gene expression caused by the suppression of AP-1. The percentage of knockdown reached 45%.

Figure 4

Relative gene expression analysis of stemness transcription factors, Nanog, Oct3/4, and Sox2, after AP-1 complex knockdown (II). Changes in gene expression caused by the suppression of AP-1. The percentage of knockdown reached 35%.

3.2. Cell Cycle Distribution

The number of cells undergoing apoptosis was three times higher following suppression of both genes by 45%. Under the same conditions, it was observed that there was an increase in dead cells of 1.5 times that of the control cells. C-FOS knockdown only led to a doubling of dead cells; however, there was no change in the number of cells undergoing apoptosis (Table 1).
Table 1

Percentage of dead cells and cells undergoing apoptosis before and after knockdown.

Cell lineCells undergoing apoptosis (%)Dead cells (%)
Control1.484.40
C-FOS knockdown1.687.42
C-JUN knockdown4.934.06
AP-1 knockdown (45%)6.395.76
AP-1 knockdown (35%)2.613.71
CSCs are defined by their ability to self-renew, differentiate, and proliferate. These cells are proposed to initiate tumor formation and propagate metastasis [14]. According to experimental data, there is evidence to indicate that the hallmarks of CSCs are defined by many transcription factors, but the most important are NANOG, OCT3/4, and SOX2. NANOG is expressed in ESCs and has an important role in maintaining pluripotency. Overexpression of NANOG causes self-renewal of ESCs, while its absence leads to differentiation [15-18]. To maintain stemness, the presence and, most likely, collaboration of two further transcription factors, OCT3/4 and SOX2, are required. OCT3/4 expression is also associated with the undifferentiated stage and self-renewal. It forms a heterodimer with SOX2, which binds DNA. SOX2 is a transcription factor essential for maintaining pluripotency, but its ectopic expression may be related to abnormal differentiation of colorectal cancer cells [19-21]. Although little is known about their origin, CSCs are a subpopulation of heterogeneous tumors that has the ability to enter the bloodstream and migrate to colonize secondary sites, thus resulting in metastases and relapses. The epithelial to mesenchymal transition (EMT) and the reverse process (mesenchymal to epithelial transition (MET)) contribute to this [22, 23]. The AP-1 transcription factor consists mainly of the C-FOS and C-JUN proteins. C-FOS is a protooncogene and has a leucine zipper DNA-binding domain [24]. C-JUN is also a proto-oncogene that has important roles in cellular proliferation and apoptosis [25]. The AP-1 transcription factor acts downstream many transduction pathways; therefore, many processes are implicated. Recent studies have demonstrated that C-JUN and C-FOS are also involved in stemness pathways. C-JUN has a pivotal role in the maintenance of self-renewal and tumorigenicity in glioma stem-like cells. In contrast, another study has implicated AP-1 and NF-κB in the differentiation of mouse ESCs [8, 26–28]. Therefore, it is clear that there is a relationship between the AP-1 transcription factor and stemness. The present study aimed to clarify this relationship in colon CSCs. The contribution of the AP-1 complex has been shown in apoptosis, alongside that of the individual proteins. AP-1 seems to play a crucial role in the maintenance of stemness by controlling NANOG, OCT3/4, and SOX2. Suppression of AP-1 led to a reduction in the levels of NANOG and SOX2 gene expression, which in turn led to an increase in the number of cells undergoing apoptosis. It may be that cells which cannot maintain the hallmarks of stemness eventually undergo apoptosis.

4. Conclusions

The present study indicated that the AP-1 transcription factor may be strongly related to the stemness phenotype in colon CSCs. The reduction of its expression leads to changes in the expression of major transcription factors that are essential for maintaining pluripotency and undifferentiation. Further studies need to be performed to further investigate this correlation.
  28 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  Nanog and transcriptional networks in embryonic stem cell pluripotency.

Authors:  Guangjin Pan; James A Thomson
Journal:  Cell Res       Date:  2007-01       Impact factor: 25.617

3.  c-Jun N-terminal kinase has a pivotal role in the maintenance of self-renewal and tumorigenicity in glioma stem-like cells.

Authors:  C-H Yoon; M-J Kim; R-K Kim; E-J Lim; K-S Choi; S An; S-G Hwang; S-G Kang; Y Suh; M-J Park; S-J Lee
Journal:  Oncogene       Date:  2012-01-16       Impact factor: 9.867

4.  Transcription factor SOX2 up-regulates stomach-specific pepsinogen A gene expression.

Authors:  Yasuyo Tani; Yoshimitsu Akiyama; Hiroshi Fukamachi; Kazuyoshi Yanagihara; Yasuhito Yuasa
Journal:  J Cancer Res Clin Oncol       Date:  2006-11-28       Impact factor: 4.553

5.  Involvement of NF-kappaB and AP-1 activation in icariin promoted cardiac differentiation of mouse embryonic stem cells.

Authors:  Yanbo Wo; Danyan Zhu; Yongping Yu; Yijia Lou
Journal:  Eur J Pharmacol       Date:  2008-03-07       Impact factor: 4.432

Review 6.  The basics of epithelial-mesenchymal transition.

Authors:  Raghu Kalluri; Robert A Weinberg
Journal:  J Clin Invest       Date:  2009-06       Impact factor: 14.808

7.  Crystal structure of the heterodimeric bZIP transcription factor c-Fos-c-Jun bound to DNA.

Authors:  J N Glover; S C Harrison
Journal:  Nature       Date:  1995-01-19       Impact factor: 49.962

8.  Prolonged expression of c-fos suppresses cell cycle entry of dormant hematopoietic stem cells.

Authors:  S Okada; T Fukuda; K Inada; T Tokuhisa
Journal:  Blood       Date:  1999-02-01       Impact factor: 22.113

9.  Correlation between Cancer Stem Cells and Circulating Tumor Cells and Their Value.

Authors:  Maria Toloudi; Panagiotis Apostolou; Marina Chatziioannou; Ioannis Papasotiriou
Journal:  Case Rep Oncol       Date:  2011-01-29

10.  Embryonic NANOG activity defines colorectal cancer stem cells and modulates through AP1- and TCF-dependent mechanisms.

Authors:  Elsayed E Ibrahim; Roya Babaei-Jadidi; Anas Saadeddin; Bradley Spencer-Dene; Sina Hossaini; Mohammed Abuzinadah; Ningning Li; Wakkas Fadhil; Mohammad Ilyas; Dominique Bonnet; Abdolrahman S Nateri
Journal:  Stem Cells       Date:  2012-10       Impact factor: 6.277

View more
  6 in total

1.  Loss of fructose-1,6-bisphosphatase induces glycolysis and promotes apoptosis resistance of cancer stem-like cells: an important role in hexavalent chromium-induced carcinogenesis.

Authors:  Jin Dai; Yanli Ji; Wei Wang; Donghern Kim; Leonard Yenwong Fai; Lei Wang; Jia Luo; Zhuo Zhang
Journal:  Toxicol Appl Pharmacol       Date:  2017-06-15       Impact factor: 4.219

2.  Involvement of c-Fos in the Promotion of Cancer Stem-like Cell Properties in Head and Neck Squamous Cell Carcinoma.

Authors:  Naoshad Muhammad; Sourav Bhattacharya; Robert Steele; Nancy Phillips; Ratna B Ray
Journal:  Clin Cancer Res       Date:  2016-12-13       Impact factor: 12.531

3.  Conversion of differentiated cancer cells into cancer stem-like cells in a glioblastoma model after primary chemotherapy.

Authors:  B Auffinger; A L Tobias; Y Han; G Lee; D Guo; M Dey; M S Lesniak; A U Ahmed
Journal:  Cell Death Differ       Date:  2014-03-07       Impact factor: 15.828

4.  Identification of genes involved in breast cancer and breast cancer stem cells.

Authors:  Panagiotis Apostolou; Maria Toloudi; Ioannis Papasotiriou
Journal:  Breast Cancer (Dove Med Press)       Date:  2015-07-15

5.  Identification of molecular signature of head and neck cancer stem-like cells.

Authors:  Shubham Shrivastava; Robert Steele; Melanie Sowadski; Susan E Crawford; Mark Varvares; Ratna B Ray
Journal:  Sci Rep       Date:  2015-01-15       Impact factor: 4.379

6.  Cervical cancer stem cells manifest radioresistance: Association with upregulated AP-1 activity.

Authors:  Abhishek Tyagi; Kanchan Vishnoi; Harsimrut Kaur; Yogesh Srivastava; Bal Gangadhar Roy; Bhudev C Das; Alok C Bharti
Journal:  Sci Rep       Date:  2017-07-06       Impact factor: 4.379

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.