Literature DB >> 24378180

Avian hepatitis E virus in chickens, Taiwan, 2013.

Ingrid W-Y Hsu, Hsiang-Jung Tsai.   

Abstract

A previously unidentified strain of avian hepatitis E virus (aHEV) is now endemic among chickens in Taiwan. Analysis showed that the virus is 81.5%-86.5% similar to other aHEVs. In Taiwan, aHEV infection has been reported in chickens without aHEV exposure, suggesting transmission from asymptomatic cases or repeated introduction through an unknown common source(s).

Entities:  

Keywords:  ELISA; ORF1; ORF2; ORF3; Taiwan; avian HEV; avian hepatitis E virus; chickens; complete genome; phylogeny; seropositive rate; viruses

Mesh:

Year:  2014        PMID: 24378180      PMCID: PMC3884734          DOI: 10.3201/eid2001.131224

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Avian hepatitis E virus (aHEV) was first isolated from chickens with big liver and spleen disease or hepatitis-splenomegaly syndrome (,). aHEV infection in chickens can cause death and reduce egg production, resulting in economic losses in the poultry industry (). The zoonotic characteristic of aHEV have not been verified with certainty (); however, the virus may have public health implications related to the consumption of contaminated poultry eggs and meat, the use of poultry viscera as a culinary delicacy, and the handling of poultry. In Taiwan, the prevalence of aHEV in avian livestock has been increasing, but the causative strain has not been known. To increase our knowledge of this growing problem, we determined the seroprevalence of aHEV antibody in chickens in Taiwan and then isolated the infecting virus and sequenced and phylogenetically analyzed its full genome to better determine the origin and evolutionary status of the virus.

The Study

In 2013, we analyzed serum samples from 1,326 chickens in 61 flocks throughout Taiwan to study the prevalence of aHEV antibodies. In addition, we collected bile samples from 150 chickens among the 4 commercial egg-layer flocks in Pingtung County, Taiwan, to isolate and identify the causative aHEV strain. All chickens appeared to be healthy and ranged in age from 30.1 to 62.8 (mean 43.9) weeks for breeders and from 19.0 to 65.1 (mean 53.1) weeks for layers (Table 1). We tested serum samples for aHEV antibodies by using an ELISA (BioChek, Reeuwijk, the Netherlands) essentially as described by the manufacturer. aHEV antibody seroprevalence was 40.57% (538/1,326) among the chickens and 95.08% (58/61) among the flocks (Table 1).
Table 1

Results of avian hepatitis E antibody testing in serum samples from chickens, Taiwan, 2013*

Type of chicken, mean age, wkNo. flocks testedNo. (%) positiveNo. chickens testedNo. (%) positive
Breeders, 43.94139 (97.22)857294 (34.31)
Layers, 53.12019 (95.00)469244 (52.03)
Total, 47.16158 (95.08)1,326538 (40.57)

*ELISA was used to test samples for antibody.

*ELISA was used to test samples for antibody. We used reverse transcription PCR to isolate the aHEV RNA genome from chicken bile, and 3 sets of degenerative primers were designed to amplify a specific region of the genome. The first and the second sets of degenerative primers were designed on the basis of multiple sequence alignments derived from the helicase gene in open reading frame (ORF) 1 and the capsid gene in ORF2 (), respectively. Primers based on ORF1 were AHEV F-1/SD, 5′-TGTTATYACACCCACCAARACGYTG-3′ for positions 2,524–2,548; Helic R-1, 5′-CCTCRTGGACCGTWATCGACCC-3′ for positions 2,975–2,954; AHEV F-2/SD, 5′-GCCACGGCTRTTACACCYCAYGT-3′ for positions 2,573–2,595; and Helic R-2, 5′-GACCCRGGRTTCGACTGCTT-3′ for positions 2,958–2,939. Primers based on ORF2 were AHEV ORF2/F-1/SD, 5′-TCGCCYGGTAAYACWAATGC-3′ for positions 5,473–5,492; AHEV ORF2/R-1/SD, 5′-GCGTTSCCSACAGGYCGGCC-3′ for positions 5,750–5,731; AHEV ORF2/F-2/SD, 5′-ACWAATGCYAGGGTCACCCG-3′ for positions 5,485–5,504; and AHEV ORF2/R-2/SD, 5′-ATGTACTGRCCRCTSGCCGC-3′ for positions 5,726–5,707. The third primer set was designed on the basis of 5 multiple alignments of complete or nearly complete aHEV sequences of other aHEV strains (GenBank accession nos. AM943647, GU954430, AM943646, EF206691, and AY535004) for the aligned results near the end of ORF2. The primers included nt5883/F, 5′-GGAYTATGGGAAYCAGCATG-3′ for positions 5,862–5,881; nt6579/R, 5′-ATCACAATAAATTAAACATAGGG-3′ for positions 6,600–6,578; nt6216/F, 5′-TGGGGRCCYCAGGGCGCTG-3′ for positions 6,196–6,214; and nt6498/R 5′-GAGGGGAATGTYYTACTAAG-3′ for positions 6,515–6,496. Following the primer walking strategy, we designed sequencing primers as detailed in Table 2. We then sequenced the complete genome (6,653 bp) of the aHEV strain isolated from chickens in Taiwan (TWNaHEV; GenBank accession no. KF511797) and determined that it is 1 base pair shorter than that of the prototype aHEV (). The cloned sequence of TWNaHEV RNA is composed of the noncoding region at the 5′ end (1–25 nt); ORF1 (26–4,618 nt), including methytransferase (191–742 nt), helicase (2,429–3,124 nt), and RNA-dependent RNA polymerase (3,167–4,618 nt); ORF3 (4,652–4,915 nt); ORF2 (4,705−6,525 nt); and the noncoding region at the 3′ end (6,525–6,653 nt).
Table 2

Primers used in the generation of the complete genome of the Taiwan avian hepatitis E virus strain*

Primer name†Primer sequence, 5′→3′Direction
TWN6490–6470CTAGAAGTCGGCGTGTCTCAGR
TWN6469–6448GTGACTGGTCCTCAGGTGCTTGR
TWN6244–6270CAGGAGTGGATCTATTTCCTTCAGAACF
TWN6243–6262CCAGGAGTGGATCTATTTCCF
TWN6215–6241GATACTTCTATCAGTACAACAACACACF
TWN5705–5686CGCAGCAGCGTGGATGGTAGR
TWN5506–5526GTTAAGGTGACTGCTCCGCACF
TWN5043–5023GTCCTGAAGTGGCATGAGCGGR
TWN4784–4763CTTCCGGCTGGGAGCGTTTGGGR
TWN3421–3441CCATTGTCGCCTGGCTGCACCF
TWN3227–3247GACGGGTTATTGGATATACCGF
TWN2952–2932GGGTTCGACTGCTTGGCCACCR
TWN2930–2909GAGTAAACACAATTTTTTGGCCR
TWN2569–2588CGGGGCTGTTGCGATTACGCF
TWN1657–1635CATAATGTGCAACGATGGCGGCGR
TWN1607–1582CAGCAAGCTCTTTAAGTGTGAGTAGCR
TWN1570–1546GAGGTCAATCAAATTCTCAGTGCTGR
TWN1145–1123CAGCAATGGCAACAGCCGTCAGCR
TWN1114–1091CTCAGGCTGCCAACCCTCATTGGCR
TWN1048–1026GTAGGTCAGCAAGCGCGAGCAGCR
TWN670–646CTTGTCCGTTGTATTTACGGTATTGR
TWN607–584CTCCTCTGGTAAGTGCAACACGACR
TWN580–557CAGTGTCCGCATATTATGGCGGGCR
HaHEV1–26‡GCGGCCGCTCTAGCTGCAGCGAATACF
HaHEV1410–1433‡CATCCGTGCGGGTACTAAATCTGCF
Anchored-oligo (dT)18 primerNVTTTTTTTTTTTTTTTTTTNA
Oligo d(T)-anchor primerGACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTVNA

*The annealing temperature was set at 60°C for each primer combination. R, reverse; F, forward; NA, not applicable.
†Numbers following TWN in primer names is the nucleotide position extracted by the respective primers.
‡Primers were designed on the basis of the sequence from Hungary (GenBank accession no. JN997392).

*The annealing temperature was set at 60°C for each primer combination. R, reverse; F, forward; NA, not applicable.
†Numbers following TWN in primer names is the nucleotide position extracted by the respective primers.
‡Primers were designed on the basis of the sequence from Hungary (GenBank accession no. JN997392). We compared the sequence of strain TWNaHEV with complete or near-complete sequences in GenBank for 7 other aHEVs that had been isolated from chickens; TWNaHEV shared 81.5%–86.5% sequence identity (GenBank accession nos. AM943647 and JN997392, respectively) with the other aHEVs. Phylogenetic analysis using the maximum likelihood method () with 1,000 bootstraps, based on the sequence variations in nucleotides, indicated high support for a close relationship (98%) between the aHEV genotype IV strains from Hungary and Taiwan (GenBank accession nos. JN997392 and KF511797, respectively) (Figure) (). In addition, the aHEV genotype IV strains are close to the genotype III strains, which are represented by another strain from Hungary and a strain from China (GenBank accession nos. AM943646 and GU954430, respectively), but this relationship is supported by a bootstrap value of only 55%. Moreover, previous studies (–) suggested an association of genetic types of aHEV with geographic regions. In contrast, we found a mixture of strains from Taiwan, China, and Hungary (GenBank accession nos. KF511797; GU954430; and JN997392 and AM943646, respectively) classified into the separate genotype III and IV clades (Figure).
Figure

Phylogenetic tree was aligned by using the maximum likelihood method (1,000 bootstraps) for 8 complete or nearly complete avian hepatitis E (aHEV) sequences and a swine HEV outgroup. GenBank accession numbers, country abbreviations, and avian genotype are indicated. Scale bar indicates nucleotide substitutions per site.

Phylogenetic tree was aligned by using the maximum likelihood method (1,000 bootstraps) for 8 complete or nearly complete avian hepatitis E (aHEV) sequences and a swine HEV outgroup. GenBank accession numbers, country abbreviations, and avian genotype are indicated. Scale bar indicates nucleotide substitutions per site.

Conclusions

Several cases of aHEV in chickens without aHEV exposure have been reported in Taiwan. No apparent full-scale outbreaks of acute or chronic aHEV disease have occurred, yet the estimated high seroprevalence of aHEV antibodies among chickens in Taiwan indicates that the disease is now endemic. This finding suggests the possibility of aHEV transmission from asymptomatic cases or repeated introduction through an unknown common source(s). Studies on public health issues related to aHEV; the geographic prevalence and genetic diversity of aHEV; and cross-species infection with aHEV are lacking, and studies on the zoonotic properties of aHEV are incomplete but underway. Knowledge of the diffusion pattern of aHEV around Taiwan is also lacking, although it is known that horizontal, but not vertical, transmission of aHEV is possible (,). Given these facts, hepatitis surveillance is essential in Taiwan.
  14 in total

1.  Sequence data suggests big liver and spleen disease virus (BLSV) is genetically related to hepatitis E virus.

Authors:  C J Payne; T M Ellis; S L Plant; A R Gregory; G E Wilcox
Journal:  Vet Microbiol       Date:  1999-08-16       Impact factor: 3.293

2.  Genetic identification and characterization of a novel virus related to human hepatitis E virus from chickens with hepatitis-splenomegaly syndrome in the United States.

Authors:  G Haqshenas; H L Shivaprasad; P R Woolcock; D H Read; X J Meng
Journal:  J Gen Virol       Date:  2001-10       Impact factor: 3.891

3.  Genetic variability and the classification of hepatitis E virus.

Authors:  Donald B Smith; Michael A Purdy; Peter Simmonds
Journal:  J Virol       Date:  2013-02-06       Impact factor: 5.103

4.  Sequence analysis and comparison of avian hepatitis E viruses from Australia and Europe indicate the existence of different genotypes.

Authors:  Ivana Bilic; Barbara Jaskulska; Ana Basic; Chris J Morrow; Michael Hess
Journal:  J Gen Virol       Date:  2009-03-04       Impact factor: 3.891

5.  Genetic identification of avian hepatitis E virus (HEV) from healthy chicken flocks and characterization of the capsid gene of 14 avian HEV isolates from chickens with hepatitis-splenomegaly syndrome in different geographical regions of the United States.

Authors:  Z F Sun; C T Larsen; A Dunlop; F F Huang; F W Pierson; T E Toth; X-J Meng
Journal:  J Gen Virol       Date:  2004-03       Impact factor: 3.891

Review 6.  Hepatitis E virus: animal reservoirs and zoonotic risk.

Authors:  X J Meng
Journal:  Vet Microbiol       Date:  2009-03-20       Impact factor: 3.293

7.  Analysis of the complete genomic sequence of an apparently avirulent strain of avian hepatitis E virus (avian HEV) identified major genetic differences compared with the prototype pathogenic strain of avian HEV.

Authors:  P Billam; Z F Sun; X-J Meng
Journal:  J Gen Virol       Date:  2007-05       Impact factor: 3.891

8.  Egg whites from eggs of chickens infected experimentally with avian hepatitis E virus contain infectious virus, but evidence of complete vertical transmission is lacking.

Authors:  H Guo; E M Zhou; Z F Sun; X-J Meng
Journal:  J Gen Virol       Date:  2007-05       Impact factor: 3.891

9.  Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and attempts to infect rhesus monkeys with avian HEV.

Authors:  F F Huang; Z F Sun; S U Emerson; R H Purcell; H L Shivaprasad; F W Pierson; T E Toth; X J Meng
Journal:  J Gen Virol       Date:  2004-06       Impact factor: 3.891

10.  Analysis of avian hepatitis E virus from chickens, China.

Authors:  Qin Zhao; En Min Zhou; Shi Wei Dong; Hong Kai Qiu; Lu Zhang; Shou Bin Hu; Fei Fei Zhao; Shi Jin Jiang; Ya Ni Sun
Journal:  Emerg Infect Dis       Date:  2010-09       Impact factor: 6.883

View more
  20 in total

1.  Identification and characterization of avian hepatitis E virus genotype 2 from chickens with hepatitis-splenomegaly syndrome in Korea.

Authors:  Hyun-Woo Moon; Byung-Woo Lee; Haan Woo Sung; Byung-Il Yoon; Hyuk Moo Kwon
Journal:  Virus Genes       Date:  2016-05-10       Impact factor: 2.332

Review 2.  Hepatitis E virus: An ancient hidden enemy in Latin America.

Authors:  Nora A Fierro; Mauricio Realpe; Tzintli Meraz-Medina; Sonia Roman; Arturo Panduro
Journal:  World J Gastroenterol       Date:  2016-02-21       Impact factor: 5.742

3.  Chicken Organic Anion-Transporting Polypeptide 1A2, a Novel Avian Hepatitis E Virus (HEV) ORF2-Interacting Protein, Is Involved in Avian HEV Infection.

Authors:  Huixia Li; Mengnan Fan; Baoyuan Liu; Pinpin Ji; Yiyang Chen; Beibei Zhang; Yani Sun; Baicheng Huang; Yuchen Nan; Zhenzhao Sun; James P Stewart; Julian A Hiscox; Qin Zhao; En-Min Zhou
Journal:  J Virol       Date:  2019-05-15       Impact factor: 5.103

4.  Construction of an infectious cDNA clone of genotype 1 avian hepatitis E virus: characterization of its pathogenicity in broiler breeders and demonstration of its utility in studying the role of the hypervariable region in virus replication.

Authors:  Soo-Jeong Park; Byung-Woo Lee; Hyun-Woo Moon; Haan Woo Sung; Byung-Il Yoon; Xiang-Jin Meng; Hyuk Moo Kwon
Journal:  J Gen Virol       Date:  2015-01-15       Impact factor: 3.891

5.  Seroprevalence and risk factors associated with hepatitis E virus infection in three species of pet birds in northwest China.

Authors:  Wei Cong; Qing-Feng Meng; Xiao-Feng Shan; Wu-Wen Sun; Si-Yuan Qin; Xiao-Xuan Zhang; Si-Yang Huang; Ai-Dong Qian
Journal:  ScientificWorldJournal       Date:  2014-10-30

6.  Consensus proposals for classification of the family Hepeviridae.

Authors:  Donald B Smith; Peter Simmonds; Shahid Jameel; Suzanne U Emerson; Tim J Harrison; Xiang-Jin Meng; Hiroaki Okamoto; Wim H M Van der Poel; Michael A Purdy
Journal:  J Gen Virol       Date:  2014-07-02       Impact factor: 3.891

Review 7.  Zoonotic Hepatitis E Virus: Classification, Animal Reservoirs and Transmission Routes.

Authors:  Virginie Doceul; Eugénie Bagdassarian; Antonin Demange; Nicole Pavio
Journal:  Viruses       Date:  2016-10-03       Impact factor: 5.048

8.  Identification of a Putative Novel Genotype of Avian Hepatitis E Virus from Apparently Healthy Chickens in Southwestern Nigeria.

Authors:  Fisayo Temilade Osamudiamen; Olusola Aanuoluwapo Akanbi; Steffen Zander; Daniel Oladimeji Oluwayelu; Claus-Thomas Bock; Patrycja Klink
Journal:  Viruses       Date:  2021-05-21       Impact factor: 5.048

9.  Development and evaluation of a SYBR Green real-time RT-PCR assay for detection of avian hepatitis E virus.

Authors:  Qin Zhao; Sha Xie; Yani Sun; Yiyang Chen; Jiming Gao; Huiya Li; Xinjie Wang; Shahid Faraz Syed; Baoyuan Liu; Lizhen Wang; Gaiping Zhang; En-Min Zhou
Journal:  BMC Vet Res       Date:  2015-08-11       Impact factor: 2.741

10.  Effect of housing arrangement on fecal-oral transmission of avian hepatitis E virus in chicken flocks.

Authors:  Baoyuan Liu; Yani Sun; Yiyang Chen; Taofeng Du; Yuchen Nan; Xinjie Wang; Huixia Li; Baicheng Huang; Gaiping Zhang; En-Min Zhou; Qin Zhao
Journal:  BMC Vet Res       Date:  2017-09-07       Impact factor: 2.741

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.