Literature DB >> 24324661

Mechanisms of a human skeletal myotonia produced by mutation in the C-terminus of NaV1.4: is Ca2+ regulation defective?

Subrata Biswas1, Deborah A DiSilvestre, Peihong Dong, Gordon F Tomaselli.   

Abstract

Mutations in the cytoplasmic tail (CT) of voltage gated sodium channels cause a spectrum of inherited diseases of cellular excitability, yet to date only one mutation in the CT of the human skeletal muscle voltage gated sodium channel (hNaV1.4F1705I) has been linked to cold aggravated myotonia. The functional effects of altered regulation of hNaV1.4F1705I are incompletely understood. The location of the hNaV1.4F1705I in the CT prompted us to examine the role of Ca(2+) and calmodulin (CaM) regulation in the manifestations of myotonia. To study Na channel related mechanisms of myotonia we exploited the differences in rat and human NaV1.4 channel regulation by Ca(2+) and CaM. hNaV1.4F1705I inactivation gating is Ca(2+)-sensitive compared to wild type hNaV1.4 which is Ca(2+) insensitive and the mutant channel exhibits a depolarizing shift of the V1/2 of inactivation with CaM over expression. In contrast the same mutation in the rNaV1.4 channel background (rNaV1.4F1698I) eliminates Ca(2+) sensitivity of gating without affecting the CaM over expression induced hyperpolarizing shift in steady-state inactivation. The differences in the Ca(2+) sensitivity of gating between wild type and mutant human and rat NaV1.4 channels are in part mediated by a divergence in the amino acid sequence in the EF hand like (EFL) region of the CT. Thus the composition of the EFL region contributes to the species differences in Ca(2+)/CaM regulation of the mutant channels that produce myotonia. The myotonia mutation F1705I slows INa decay in a Ca(2+)-sensitive fashion. The combination of the altered voltage dependence and kinetics of INa decay contribute to the myotonic phenotype and may involve the Ca(2+)-sensing apparatus in the CT of NaV1.4.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24324661      PMCID: PMC3855693          DOI: 10.1371/journal.pone.0081063

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Precise and coordinated activity of skeletal muscle results from highly regulated signals generated by the orchestrated activities of different ion channels. A spectrum of muscle disorders are caused by the mutations in different ion channels [1]. A number of mutations in different regions of the human voltage-gated Na channel, hNaV1.4 have been reported to cause skeletal muscle disorders [2]. Mutations in the transmembrane domains and linker regions cause cold aggravated myotonia [3], [4], [5], [6] yet only one case of cold aggravated myotonia [7], has been linked to a mutation in the CT of the skeletal muscle sodium channel, hNaV1.4 (F1705I, Figure 1A) and functionally studied. The other mutation in the CT-NaV1.4, E1702K has been linked to paramyotonia congenita [8], but not functionally studied. Interestingly, another mutation Q1633E, causes potassium aggravated myotonia and is located in the EF hand like (EFL) region, that is the region in and around Helix 1, and the loop between Helix 1 and Helix 2 of the CT-hNaV1.4, and about 71 amino acids upstream of the E1705I mutation. Q1633E and F1705I have comparable electrophysiological effects including disruption of fast inactivation, slowed current decay, and a depolarized shift in the voltage dependence of availability [9]. hNaV1.4 mutations that cause myotonic disorders are associated with changes in the kinetics and voltage dependence of gating generally resulting in a gain-of-function.
Figure 1

Ca2+-sensitivity of human NaV1.4F1705I inactivation.

(A) A schematic of the structured region of the C-terminus of hNaV1.4 between amino acids residues 1788 and 2040, the predicted helices are labeled H1–H6. The location of the EFL residues in and around H1 harbors species specific variations in the key Ca2+ sensing residues in hNaV1.4 (G1613S and A1636D) compared with the rat isoform. The CaM binding motif IQ in H6 and, the cold aggravated myotonia mutation F1705I (rat: F1698I) in H5 are illustrated. (B) Representative whole-cell currents through wild type and mutant hNaV1.4F1705I channels expressed in HEK293 cells in [Ca2+]i free conditions. Na+ currents were elicited by the protocol in the inset. (C) [Ca2+]i does not alter the I–V relationship of hNaV1.4F1705I. (D) Representative steady-state inactivation currents from different holding potentials through mutant hNaV1.4F1705I channels in the presence of 0.5 µM or absence of Ca2+. (E) Activation and steady-state inactivation curves of wild type and hNaV1.4F1705I channels in the absence and presence of 0.5 µM intracellular Ca2+. The V1/2 of inactivation of hNaV1.4F1705I is sensitive to [Ca2+]i and significantly shifted in the hyperpolarizing direction in the presence of Ca2+ (p<0.005). The activation relationships are fitted with dotted lines, the V1/2 of activation are unaffected by change in [Ca2+]i. (F) and (G) illustrate the window currents through wild type and hNaV1.4F1705I in presence (F) and absence (G) of intracellular Ca2+, respectively. Dotted lines represent the wild type channel. The symbols and color are the same in plots C, E, F, and G.

Ca2+-sensitivity of human NaV1.4F1705I inactivation.

(A) A schematic of the structured region of the C-terminus of hNaV1.4 between amino acids residues 1788 and 2040, the predicted helices are labeled H1H6. The location of the EFL residues in and around H1 harbors species specific variations in the key Ca2+ sensing residues in hNaV1.4 (G1613S and A1636D) compared with the rat isoform. The CaM binding motif IQ in H6 and, the cold aggravated myotonia mutation F1705I (rat: F1698I) in H5 are illustrated. (B) Representative whole-cell currents through wild type and mutant hNaV1.4F1705I channels expressed in HEK293 cells in [Ca2+]i free conditions. Na+ currents were elicited by the protocol in the inset. (C) [Ca2+]i does not alter the I–V relationship of hNaV1.4F1705I. (D) Representative steady-state inactivation currents from different holding potentials through mutant hNaV1.4F1705I channels in the presence of 0.5 µM or absence of Ca2+. (E) Activation and steady-state inactivation curves of wild type and hNaV1.4F1705I channels in the absence and presence of 0.5 µM intracellular Ca2+. The V1/2 of inactivation of hNaV1.4F1705I is sensitive to [Ca2+]i and significantly shifted in the hyperpolarizing direction in the presence of Ca2+ (p<0.005). The activation relationships are fitted with dotted lines, the V1/2 of activation are unaffected by change in [Ca2+]i. (F) and (G) illustrate the window currents through wild type and hNaV1.4F1705I in presence (F) and absence (G) of intracellular Ca2+, respectively. Dotted lines represent the wild type channel. The symbols and color are the same in plots C, E, F, and G. There is substantial evidence that the CT of NaV channels regulate the kinetics and voltage dependence of inactivation [10], [11], [12], [13]. Moreover, Ca2+ and CaM/CaM kinase (CaMK) distinctly modulate inactivation of different isoforms of NaV channels through interaction with structural motifs in the CT although the mechanisms are not fully understood [10], [11], [14], [15], [16], [17], [18]. There is evidence, particularly in HEK cells, that over expression of CaM will alter NaV1.4 channel gating [10], [15], [16], and this is not unique to this channel but it also observed for other voltage dependent channels [15], [19], [20]. An EFL sequence [21], [22] in the CT of NaV1.5 and NaV1.1 has been shown to influence Ca2+ regulation of channel gating [14], [17], [18], [23], [24], [25]. Other acidic residues in the H1–H2 loop of the proximal C-terminus may affect Ca2+ sensitivity of channel gating as well [24], [26], and the NMR solution and crystal structures in this region reveals binding of Ca2+ [24] or Mg2+ [27]. In addition to the EFL, sites in the III–IV linker are involved in Ca2+/CaM mediated regulation of gating [28], [29], [30]. Similar Ca2+/CaM sites are also present in the CT of NaV1.4; however, their roles in channel regulation and relevance to disease causing mutations of the CT-NaV1.4 are not known. The goals of this study are to understand the pathogenesis of temperature sensitive myotonia caused by the F1705I mutation, and to use this naturally occurring mutation (and the species specific differences) to better understand the regulation of the NaV channels by Ca2+. We demonstrate that the hNaV1.4F1705I alters the voltage dependence of inactivation and the temperature sensitivity of current kinetics. In addition, key residues in the EFL alter the CaM and Ca2+ dependence of channel gating which may also contribute to the myotonia phenotype.

Materials and Methods

Plasmid Construction

The EYFP fused channel construct NaV1.4-EYFP was prepared as described previously [15]. The myotonia causing mutation in the rat CT, rNaV1.4F1698I, was made by site directed mutagenesis using primer pairs: Forward (F): 5′CATGGAGGAGAAGATTATGGCAGCTAACCCTTC3′ and Reverse (R): 5′GAAGGGTTAGCTGCCATAATCTTCTCCTCCATG3′. The human myotonia construct, hNaV1.4F1705I, was made by site directed mutagenesis of the human hNaV1.4-EYFP construct using primer pairs: Forward (F): 5′ CATGGAGGAGAAGATCATGGCAGCCAAC3′ and hNaV1.4F1705I Reverse (R): 5′ GTTGGCTGCCATGATCTTCTCCTCCATG3′. All the clones were sequence verified.

Transfection of Cells

Approximately 0.75×106 Human embryonic kidney cells (HEK293; American Type Culture Collection, Manassas, VA) were cultured in 6-well tissue culture dishes in DMEM supplemented with 10% FBS, L-glutamine (2 mmol/L), penicillin (100 U/mL), and streptomycin (10 mg/mL). The cells were co-transfected with plasmids encoding the β1 subunit and the appropriate fluorescently–tagged NaV1.4 and CaM variants: human or rat wild type NaV1.4-EYFP, hNaV1.4F1705I-EYFP, rNaV1.4F1698I-EYFP, hNaV1.4F1705I+GA/SD-EYFP and ECFP-CaM or ECFP-CaM1234 alone or in combination. Cells were transfected using Lipofectamine™ 2000 (Invitrogen) according to the manufacturer’s instructions and were studied 48 to 72 hours post-transfection. The total amount of DNA for all transfections was kept constant.

Electrophysiology

HEK293 cells expressing wild type or mutant EYFP-tagged NaV1.4 channels were selected for recording. In some experiments, cells expressing both yellow and cyan fluorophores that were co-transfected with tagged NaV1.4 channel variants and CaM or CaM1234 were selected for patching. Cells were patch clamped with an Axopatch 200B patch-clamp amplifier using pipettes with tip resistances of 1–3 MΩ and typical series resistance compensation of >90% to minimize voltage clamp errors. Current recording was initiated 10 minutes after establishing whole-cell configuration, and currents were filtered at 5 kHz. All the solutions used in this study were prepared as described previously [14], [17], [31], [32]. The bath solution contained (in mmol/L): 145 NaCl, 4 KCl, 1.8 CaCl2, 1 MgCl2, 10 glucose and 10 Na-HEPES (pH 7.4). The Ca2+ free patch pipette solution contained (in mmol/L): 10 NaF, 100 CsF, 20 CsCl2, 20 BAPTA, 0 CaCl2 and 10 HEPES, pH adjusted to 7.35 with CsOH. The 0.5 µmol/L Ca2+ patch pipette solution contained (in mmol/L): 10 NaF, 100 CsF, 20 CsCl2, 5 BAPTA, 4 CaCl2 and 10 HEPES, pH adjusted to 7.35 with CsOH. The osmolarity of the bath and pipette solutions were equalized using glucose. The free [Ca2+] in the solutions was estimated with WEBMAX Standard software (http://www.stanford.edu/~cpatton/webmaxcS.htm) and found to be about 0.5 µM. The free [Ca2+] in the solutions was verified by measurement using a Kwik-Tip Calcium ion-selective electrode (WPI) (Figure S1 and Table S1 in File S1). We studied the effect of intracellular Ca2+ on the voltage dependence of inactivation gating of rNaV1.4 with chloride substituted for fluoride in the pipette solution and found no significant difference in the Ca2+ sensitivity of gating (Figure S2 in File S1). Standard two-pulse protocols were used to generate the steady-state inactivation curves. The voltage dependence of steady-state fast inactivation was studied using 500 ms inactivation pre-pulses over a voltage range from −140 to +30 mV in steps of 5 mV, followed by a 50 ms test pulse at −20 mV. Currents were normalized to the maximal current (Imax) and fit to a Boltzmann function of the form (y = [(A1−A2)/(1+e(x−x0)/dx))]+A2) to determine the membrane potential eliciting half-maximal inactivation (V1/2), where A1 and A2 are maximum and minimum availabilities, respectively, x0 is equivalent to V1/2, and dx represents the slope factor. Activation curves were generated from a family of 50 ms test pulses from −100 mV to +80 mV in 5 mV increments from a holding potential of −120 mV. Peak currents at each membrane potential normalized to Imax, were plotted to generate the I–V curves. Conductance (G) was calculated for peak current (IPeak) at each membrane potential (Vm) using the equation (G = IPeak/(Vm−VReversal)). G was normalized to GMax and fitted to a Boltzmann distribution to determine the membrane potential eliciting half-maximal activation (V1/2). Deactivation was assessed using tail currents elicited by a test pulse of 0.5 ms to +40 mV followed by repolarization to a family of voltages ranging from −180 to −50 mV. INa decay rates were assessed by fitting to a single exponential decay (Figure S3 in File S1). Recovery from inactivation was assessed by a standard two-pulse protocol with a first pulse duration of 30 ms and a second pulse of 30 ms to −20 mV with varying inter pulse intervals from 1 to 200 ms at −120 mV. Exponential functions of the form y = y0+Ae−x/τ were fitted to recovery data to determine time constants (τrec), where y0 is the offset and A is amplitude. Significance was assessed using unpaired student’s t-test (Microcal Origin, Microcal Software Inc. MA), and p<0.05 was considered significant.

Results

hNaV1.4F1705I Alters Current Kinetics and Gating

A mutation (F1705I) in the structured portion of the CT of hNaV1.4 has been associated with cold aggravated myotonia (Figure 1A). We studied the effect of hNaV1.4F1705I on channel function by transient expression in HEK293 cells at RT. Currents through wild type hNaV1.4 and hNaV1.4F1705I channels were elicited by a family of depolarizing pulses ranging from −100 mV to +80 mV from a holding potential of −120 mV (Inset Figure 1B). The normalized peak current-voltage (I–V) relationships of wild type hNaV1.4 and hNaV1.4F11705I were not different in 0.5 µM [Ca2+]i mimicking the average intracellular [Ca2+] in muscle (Figure 1B and 1C). The voltage dependence (V1/2) of activation of the wild type and mutant channels did not differ in the presence of 0.5 µM [Ca2+]i (Figure 1E and Table 1).
Table 1

Biophysical characteristics of NaV1.4 variants.

Channel/MutantSteady-state inactivationActivationτRec
V1/2 (mV)V1/2 (mV)(ms)
rNaV1.4 +Ca2+ −64.2±0.1(7)−29.0±0.3(6)2.3±0.1(7)
−Ca2+ −72±0.1(11)a −31±1.5(13)2.5±0.3(5)
rNaV1.4 CaM−69.3±0.1(5)a −30.6±0.2(6)2.2±0.1(10)
(0.5 µM Ca2+) CaM1234 −64.3±0.3(6)−29.4±0.3(6)2.6±0.1(5)
rNaV1.4F1698I +Ca2+ −49.7±0.5(6)a −16.6±1(6)a 1.7±0.1(5)
−Ca2+ −49.7±0.8(9)−15.3±1.3(7)1.5±0.2(6)
rNaV1.4F1698I CaM−54.7±0.6(11)b −17.9±0.7(9)2.6±0.3(9)
(0.5 µM Ca2+) CaM1234 −47.9±1.9(6)−18.7±2(8)3±0.3(5)
rNaV1.4SD/GA +Ca2+ −70.0±0.2(8)a −18.9±0.3(5)2.3±0.1(8)
−Ca2+ −70.4±0.2(6)−19.0±0.3(6)2.0±0.1(5)
rNaV1.4SD/GA CaM−62.9±0.1(6)c −20.8±0.3(5)2.9±0.1(6)
(0.5 µM Ca2+) CaM1234 −64.1±0.1(8)c −19.0±0.4(9)2.3±0.1(9)
rNaV1.4F1698I+SD/GA +Ca2+ −62.9±0.1(8)−26±0.2(6)2.1±0.1(8)
−Ca2+ −57.3±0.1(5)d −28.6±0.2(5)2.0±0.1(5)
rNaV1.4F1698I+SD/GA CaM−51.5±0.1(6)d −21.4±0.3(6)2.3±0.1(7)
(0.5 µM Ca2+) CaM1234 −52.9±0.1(5)d −22.9±0.3(5)2.1±0.1(6)
hNaV1.4 +Ca2+ −73.5±0.1(9)−23±0.1(8)2.4±0.1(6)
−Ca2+ −71.2±0.1(7)−24.4±0.3(5)1.9±0.1(5)
hNaV1.4 CaM−63.8±0.1(7)e −15.4±0.2(6)e 2.8±0.1(5)
(0.5 µM Ca2+) CaM1234 −65.1±0.1(6)e −15.5±0.2(5)e 2.9±0.1(6)
hNaV1.4 CaM−80.4±0.2(5)f −15.5±0.2(5)3.3±0.1(5)
(0 Ca2+) CaM1234 −72.1±0.2(5)−15.5±0.2(5)2.4±0.1(5)
hNaV1.4F1705I +Ca2+ −62.7±0.1(5)e1 −24.6±0.3(5)1.7±0.1(5)
−Ca2+ −57.5±0.1(7)g −23±0.2(7)3.1±0.1(5)
hNaV1.4F1705I CaM−56.8±0.1(5)g −22.7±0.1(6)2.7±0.1(5)
(0.5 µM Ca2+) CaM1234 −52.4±0.1(5)g −21.7±0.1(5)2.2±0.1(5)
hNaV1.4F1705I CaM−61.7±0.1(5)−22.9±0.1(6)2.8±0.(3)
(0 Ca2+) CaM1234 −60.4±0.5(5)−21.7±0.1(5)2.8±0.2(3)
hNaV1.4GS/AD +Ca2+ −62.2±0.1(6)e −19.8±0.2(6)2.3±0.1(6)
−Ca2+ −67.2±0.1(7)h −16.0±0.2(8)2.7±0.1(5)
hNaV1.4GS/AD CaM−70.2±0.1(5)h1 −20.5±0.2(6)3.4±0.1(5)
(0.5 µM Ca2+) CaM1234 −65.3±0.1(5)−18±0.2(5)3.3±0.2(5)
hNaV1.4F1705I+GS/AD +Ca2+ −54.8±0.1(6)g −23.3±0.3(6)3.1±0.2(5)
−Ca2+ −53.9±0.1(5)−24.2±0.2(5)2.4±0.1(5)
hNaV1.4F1705I+GS/AD CaM−59.3±0.1(5)i −21.2±0.2(5)2.7±0.1(5)
(0.5 µM Ca2+) CaM1234 −56.8±0.1(7)−20.3±0.3(9)3.2±0.1(6)

Values: Mean±S.E(n); +Ca2+ = 0.5 µM Ca2+:

vs. rNaV1.4 (0.5 µM Ca2+);

vs. rNaV1.4F1698I (0.5 µM Ca2+);

vs. rNaV1.4SD/GA (0.5 µM Ca2+);

vs. rNaV1.4F1698I+SD/GA (0.5 µM Ca2+);

vs. hNaV1.4 (0.5 µM Ca2+);

vs. hNaV1.4 (0.5 µM Ca2+);

vs. hNaV1.4 (0 and 0.5 µM Ca2+);

vs. hNaV1.4F1705I (0.5 µM Ca2+);

vs. hNaV1.4GS/AD (0.5 µM Ca2+);

vs. hNaV1.4GS/AD (0.5 µM Ca2+);

vs. hNaV1.4F1705I+GS/AD (0.5 µM Ca2+).

Values: Mean±S.E(n); +Ca2+ = 0.5 µM Ca2+: vs. rNaV1.4 (0.5 µM Ca2+); vs. rNaV1.4F1698I (0.5 µM Ca2+); vs. rNaV1.4SD/GA (0.5 µM Ca2+); vs. rNaV1.4F1698I+SD/GA (0.5 µM Ca2+); vs. hNaV1.4 (0.5 µM Ca2+); vs. hNaV1.4 (0.5 µM Ca2+); vs. hNaV1.4 (0 and 0.5 µM Ca2+); vs. hNaV1.4F1705I (0.5 µM Ca2+); vs. hNaV1.4GS/AD (0.5 µM Ca2+); vs. hNaV1.4GS/AD (0.5 µM Ca2+); vs. hNaV1.4F1705I+GS/AD (0.5 µM Ca2+). The voltage dependence of steady-state inactivation was altered by hNaV1.4F1705I. Compared to the wild type channel, the V1/2 of the steady-state inactivation curve of hNaV1.4F1705I was significantly shifted ∼+11 mV in 0.5 µM [Ca2+]i (V1/2 hNaV1.4: −73.5±0.1 mV and V1/2 hNaV1.4F1705I: −62.7±0.1 mV, p<0.001; Figure 1E and Table 1). In the absence of a significant shift in the activation curve this produces a significant increase in the window current of hNaV1.4F1705I compared to wild type hNaV1.4 in the presence or absence of [Ca2+]i (Figures 1F and 1G). Thus, hNaV1.4F1705I destabilizes steady-state inactivation and increases window current; however, the mechanism by which the mutation produces altered voltage dependence of gating is unknown. Given the importance of the CT of NaV channels in the regulation of gating by Ca2+/CaM signaling we assessed whether hNaV1.4F1705I interfered with channel modulation by Ca2+ or CaM.

hNaV1.4F1705I Alters Ca2+ Sensitivity

Intracellular Ca2+ has been shown to regulate the cardiac isoform of NaV channels, NaV1.5. It is not yet known if [Ca2+]i similarly regulates skeletal muscle NaV1.4 channels and if mutations in the CT of the channel affect Ca2+ regulation. In order to understand Ca2+ mediated regulation of hNaV1.4 and hNaV1.4F1705I we measured Na+ currents with 20 mM BAPTA in the pipette solution to create the Ca2+-free intracellular condition. The I–V relationships of wild type hNaV1.4 and hNaV1.4F1705I are almost identical (Figure 1C); and the V1/2s of the activation (G−V) curves were unchanged in the absence of Ca2+ (Figure 1E and Table 1). The decay rate of wild type hNaV1.4 was insensitive to the intracellular [Ca2+]. The decay of hNaV1.4F1705I currents is up to 2.5 times slower in the absence of Ca2+ compared to 0.5 µM [Ca2+]i (Figures 2A, 2B and Table 2). The decay of hNaV1.4F1705I was significantly slower than wild type hNaV1.4 at all negative voltages at RT in both low and 0.5 µM [Ca2+]i (Figures 2A, 2B and Table 2). We studied the effect of hNaV1.4F1705I on current decay at 37°C, as patients with the mutation do not exhibit myotonia at normal body temperature. In contrast to RT, at 37°C in 0.5 µM [Ca2+]i, the current decay of hNaV1.4F1705I is markedly hastened (Figure 2C) and is not significantly different from wild type except at −30 mV (Figures 2C, and 2D, Table 2). At 37°C the V1/2 of steady-state inactivation of hNaV1.4F1705I was significantly shifted in hyperpolarizing direction compared to RT (V1/2 at 37°C: −71.6±0.1 mV and V1/2 at RT: −62.7±0.1 mV, p<0.001; Figure 2E). INa decay, particularly at negative voltages, results from both inactivation and deactivation. We found no significant difference in the rates of deactivation at voltages between −180 and −100 mV (p<0.05; Figure S3 in File S1) similar to previous results [33]. However, at voltages from −90 mV to −60 mV, τDeactivation of hNaV1.4F1705I in the Ca2+ free condition is significantly larger than in the wild type channel, with or without Ca2+ (p<0.05; Figure S3 in File S1).
Figure 2

Current decay of myotonia mutant channels.

The time constant of decay is altered in hNaV1.4F1705I compared to wild type hNaV1.4 channels. (A) Superimposed normalized currents through wild type and hNaV1.4F1705I channels at test pulses of −30, −20, and −10 mV exhibiting slowing of current decay in the mutant channel. (B) The time constants of current decay of hNaV1.4F1705I channels are significantly different compared to wild type in the absence (p<0.05) or presence of 0.5 µM of Ca2+ (p<0.001). The inset is an expanded view −20 mV to 0 mV. (C) Raw current traces of hNaV1.4F1705I channels at RT and at 37°C. Currents were measured at −20 mV, in the same cell at different temperatures with 0.5 µM of Ca2+ in the pipette. (D) Plot of the time constants of current decay of wild type and hNaV1.4F1705I channels at RT and at 37°C in 0.5 µM of Ca2+. Paired measurements were made at RT and at 37°C. The current decay of hNaV1.4F1705I is significantly different at 37°C compared to RT (p<0.05). (E) Plot of the steady-state inactivation of hNaV1.4F1705I channels at 37°C in 0.5 µM of Ca2+. For comparison the steady-state inactivation of wild type and hNaV1.4F1705I from Figure 1E are re-plotted. The symbols are the same in plots B, D and E.

Table 2

Na current decay time constants of hNaV1.4 and myotonia mutant hNaV1.4F1705I.

Channel/MutantτDecay (ms)
−30 mV−20 mV−10 mV0 mV
hNaV1.40.5 µM Ca2+ 0.96±0.1(8)0.54±0.05(8)0.36±0.04(8)0.26±0.02(8)
Ca2+ free1.5±0.3(5)0.71±0.11(5)0.42±0.05(5)0.3±0.02(5)
37°C (0.5 µM Ca2+)0.43±0.01(5)0.35±0.01(5)0.3±0.02(5)0.25±0.02(5)
hNaV1.4F1705I 0.5 µM Ca2+ 2.9±0.4(5)# 1.04±0.09(5)# 0.59±0.03(5)# 0.4±0.01(5)#
Ca2+ free6.8±1.3(7)% 1.6±0.2(7)$ 0.78±0.03(7)$ 0.52±0.03(7)$
37°C (0.5 µM Ca2+)0.95±0.3(5)* @ 0.56±0.1(5)* 0.35±0.01(5)* 0.25±0.01(5)*

Values: Mean±S.E(n);

vs. hNaV1.4 in 0.5 µM Ca2+;

vs. hNaV1.4F1705I (0.5 µM Ca2+);

vs. hNaV1.4F1705I (0.5 µM Ca2+);

@vs. hNaV1.4 (37°C, 0.5 µM Ca2+);

vs. hNaV1.4F1705I (0.5 µM Ca2+).

Current decay of myotonia mutant channels.

The time constant of decay is altered in hNaV1.4F1705I compared to wild type hNaV1.4 channels. (A) Superimposed normalized currents through wild type and hNaV1.4F1705I channels at test pulses of −30, −20, and −10 mV exhibiting slowing of current decay in the mutant channel. (B) The time constants of current decay of hNaV1.4F1705I channels are significantly different compared to wild type in the absence (p<0.05) or presence of 0.5 µM of Ca2+ (p<0.001). The inset is an expanded view −20 mV to 0 mV. (C) Raw current traces of hNaV1.4F1705I channels at RT and at 37°C. Currents were measured at −20 mV, in the same cell at different temperatures with 0.5 µM of Ca2+ in the pipette. (D) Plot of the time constants of current decay of wild type and hNaV1.4F1705I channels at RT and at 37°C in 0.5 µM of Ca2+. Paired measurements were made at RT and at 37°C. The current decay of hNaV1.4F1705I is significantly different at 37°C compared to RT (p<0.05). (E) Plot of the steady-state inactivation of hNaV1.4F1705I channels at 37°C in 0.5 µM of Ca2+. For comparison the steady-state inactivation of wild type and hNaV1.4F1705I from Figure 1E are re-plotted. The symbols are the same in plots B, D and E. Values: Mean±S.E(n); vs. hNaV1.4 in 0.5 µM Ca2+; vs. hNaV1.4F1705I (0.5 µM Ca2+); vs. hNaV1.4F1705I (0.5 µM Ca2+); @vs. hNaV1.4 (37°C, 0.5 µM Ca2+); vs. hNaV1.4F1705I (0.5 µM Ca2+). Our previous work showed that the cardiac isoform hNaV1.5 is [Ca2+]i sensitive, and lowering intracellular Ca2+ shifts the V1/2 of steady-state fast inactivation of hNaV1.5 in hyperpolarizing direction [14]. However, hNaV1.4 was insensitive to [Ca2+]i and altering [Ca2+]i does not significantly affect the voltage dependence of steady-state inactivation of wild type hNaV1.4 channels (Figure 1E). In contrast, the V1/2 of steady-state inactivation of hNaV1.4F1705I was shifted significantly (∼5 mV) in the depolarizing direction in the absence of intracellular Ca2+ compared with the 0.5 µM [Ca2+]i (Figures1D, 1E and Table 1). Thus hNaV1.4F1705I exhibits Ca2+ sensitivity of steady-state inactivation distinct from wild type hNaV1.4 which is insensitive to changes in [Ca2+]i.

hNaV1.4F1705I Alters CaM Modulation

The F1705I mutation which is remote from the EFL region modifies the Ca2+ sensitivity of gating. F1705 is predicted to be in Helix 5 of the CT hNaV1.4 and is closer in the linear amino acid sequence to the CaM binding IQ motif in Helix 6 (Figure 1A). Previously we have shown that CaM binds to the IQ motif and shifts the voltage dependence of inactivation of rat NaV1.4 (rNaV1.4) and Ca2+ binding-deficient hNaV1.5 channels that are mutated in the EFL [10], [14], [15]. We tested the hypothesis that the large changes in Na+ current inactivation exhibited by hNaV1.4F1705I compared to wild type hNaV1.4 are due to functional alterations in CaM interaction with the IQ motif. We examined the effects of CaM over expression on hNaV1.4F1705I and wild type hNaV1.4 gating. As Ca2+ can bind to CaM and modulate channel gating, we also studied effect of Ca2+ binding deficient CaM or apo-CaM (CaM1234) to delineate direct effects of Ca2+ on the channel compared to Ca2+ effects through CaM. In contrast to the wild type rat NaV1.4 channel [15], over expression of both CaM and CaM1234 with wild type human NaV1.4 shifts the channel’s I–V relation in the depolarizing direction in 0.5 µM [Ca2+]i (Figure 3A and Table 1). Co-expression of CaM and CaM1234 with hNaV1.4 significantly shifts the voltage dependence of activation in the depolarizing direction (Figure 3D). In contrast, neither the I–V relationships or voltage dependence of activation of hNaV1.4F1705I were affected by co-expression with CaM or CaM1234 (Figures 3B, 3E and Table 1).
Figure 3

CaM-induced shift of inactivation in hNaV1.4 channels.

Representative Na+ currents and I–V relationships for wild type (A) and hNaV1.4F1705I channels (B) elicited by the same pulse protocol shown in the inset of Figure 1B. CaM and CaM1234 over expression significantly (p<0.05) shifts the wild type but not the hNaV1.4F1705I I–V in the depolarizing direction. (C) Representative steady-state inactivation currents elicited from different holding potentials. (D, E) Plots of the steady-state inactivation and activation relationships of wild type hNaV1.4 (D) and hNaV1.4F1705I channels (E). The solid lines are the fits to steady-state inactivation data with CaM and CaM1234 over expression. There is a significant (p<0.005) depolarizing shift of the inactivation curve by CaM and CaM1234 compared to the expression of hNaV1.4F1705I alone. The symbols and colors are the same in all panels of the figure.

CaM-induced shift of inactivation in hNaV1.4 channels.

Representative Na+ currents and I–V relationships for wild type (A) and hNaV1.4F1705I channels (B) elicited by the same pulse protocol shown in the inset of Figure 1B. CaM and CaM1234 over expression significantly (p<0.05) shifts the wild type but not the hNaV1.4F1705I I–V in the depolarizing direction. (C) Representative steady-state inactivation currents elicited from different holding potentials. (D, E) Plots of the steady-state inactivation and activation relationships of wild type hNaV1.4 (D) and hNaV1.4F1705I channels (E). The solid lines are the fits to steady-state inactivation data with CaM and CaM1234 over expression. There is a significant (p<0.005) depolarizing shift of the inactivation curve by CaM and CaM1234 compared to the expression of hNaV1.4F1705I alone. The symbols and colors are the same in all panels of the figure. We previously demonstrated that CaM is tethered to the CT of NaV1.4, and CaM binding to the IQ motif shifts the steady-state inactivation of the rat isoform in a hyperpolarizing direction [10], [15] (Table 1). In contrast, co-expression of CaM with hNaV1.4 significantly shifts wild type channel availability in the depolarizing direction in 0.5 µM [Ca2+]i (Figures 3C and D) and in the hyperpolarizing direction in the Ca2+ free intracellular condition, when compared with the absence of exogenous CaM (Table 1; p<0.05). CaM1234 over expression in 0.5 µM [Ca2+]i shifts the V1/2 of inactivation of hNaV1.4 in the depolarizing direction compared to the absence of CaM1234 (Figure 3D; p<0.05). Upon removal of [Ca2+]i, the V1/2 of inactivation of hNaV1.4 is not affected by CaM1234 over expression (Table 1; p<0.05). Co-expression of CaM or CaM1234 with the mutant, hNaV1.4F1705I also significantly shifts channel availability in the depolarizing direction compared to the absence of CaM co-expression (Figures 3C, 3E and Table 1; p<0.05). Similar to wild type, in Ca2+ free conditions, CaM or CaM1234 co-expression shifts V1/2 of steady-state inactivation in the hyperpolarizing direction (Table 1; p<0.05). Notably, in Ca2+ free conditions the CaM-induced hyperpolarizing shifts of steady-state inactivation of the wild type and mutant hNaV1.4 channels are in same direction as in the rat NaV1.4 channel. We speculate that the difference in the voltage dependence of gating of wild type human and rat NaV1.4 channels when co-expressed with Ca2+-CaM/apo-CaM [15] may provide insights into the mechanisms of the Ca2+ modulation of channel function in the myotonia mutation and in wild type channels.

Effect of rNaV1.4F1698I on Ca2+/CaM Regulation of Channel Gating

The wild type rat and human isoforms of NaV1.4 exhibit distinct differences in gating and regulation by Ca2+ and CaM. The orthologous mutation of hNaV1.4F1705I in the rat is rNaV1.4F1698I. The activation curve of rNaV1.4F1698I is significantly (p<0.05) shifted in the depolarizing direction (∼+12 mV) compared to wild type rNaV1.4 in 0.5 µM [Ca2+]i (Figures 4A, 4B and Table 1). In contrast to rNaV1.4F1698I, no activation shift was seen with the F1705I mutation in human NaV1.4 (Figure 1E). Similar shifts in the activation curves of other NaV1.4 mutants that cause myotonia have previously been reported [34], [35], [36].
Figure 4

Ca2+ regulation of the rat NaV1.4.

Whole-cell rNaV1.4 and rNaV1.4F1698I expressed currents (A) are not affected by [Ca2+]i. (B) The voltage dependence of activation (dotted lines) and steady-state inactivation (solid lines) of rNaV1.4. (C) rNaV1.4F1698I significantly (p<0.05) shifts the activation and inactivation curves in the depolarizing direction and eliminates the sensitivity of inactivation to changes in [Ca2+]i. The dotted lines represent the wild type channel in the absence of [Ca2+]i. The symbols are the same in plots B and C.

Ca2+ regulation of the rat NaV1.4.

Whole-cell rNaV1.4 and rNaV1.4F1698I expressed currents (A) are not affected by [Ca2+]i. (B) The voltage dependence of activation (dotted lines) and steady-state inactivation (solid lines) of rNaV1.4. (C) rNaV1.4F1698I significantly (p<0.05) shifts the activation and inactivation curves in the depolarizing direction and eliminates the sensitivity of inactivation to changes in [Ca2+]i. The dotted lines represent the wild type channel in the absence of [Ca2+]i. The symbols are the same in plots B and C. We next examined whether Ca2+ altered rNaV1.4F1698I gating. The V1/2s of the activation of both the wild type rNaV1.4 and rNaV1.4F1698I were not different in 0.5 µM Ca2+ compared with the absence of Ca2+ (Figures 4B, C and Table 1). Unlike wild type rNaV1.4, the voltage dependence of the steady-state inactivation of rNaV1.4F1698I was not affected by the [Ca2+]i (Figures 4B, 4C and Table 1). Neither rNaV1.4 nor rNaV1.4F1698I exhibit [Ca2+]i sensitivity to recovery from inactivated states (Table 1). Thus the Ca2+ sensitivity of steady-state inactivation of rNaV1.4 was eliminated with a mutation remote in the linear amino acid sequence from the EFL motif. Although the rNaV1.4F1698I results in loss of Ca2+ sensitivity of the channel, it also dramatically affects steady-state inactivation of the channel producing approximately ∼+15 mV shift of the V1/2 compared to the wild type rNaV1.4 in presence of 0.5 µM Ca2+ (Figures 4B, 4C and Table 1; p<0.05).

IQ-CaM Interaction is Unaffected by rNaV1.4F1698I

The significant alteration in Na+ current properties demonstrated by rNaV1.4F1698I suggests the possibility of a disruption of CaM interaction with the IQ motif which is in vicinity of F1698. CaM or CaM1234 co-expression does not alter the current kinetics (Figure 5A) or the voltage dependence of activation of rNaV1.4F1698I (Figure 5C). Similarly, CaM and CaM1234 do not affect the activation of wild type rNav1.4 (Table 1). However, co-expression of CaM with rNaV1.4F1698I significantly shifts channel availability in the hyperpolarizing direction compared to the absence of CaM co-expression (Figures 5B and 5C; p<0.05). CaM1234 has no effect on the voltage dependence of steady-state inactivation in 0.5 µM [Ca2+]i (Figure 5C). CaM and CaM1234 also have similar effects on wild type rNav1.4 availability (Table 1). The time constants of recovery from inactivated states of rNaV1.4F1698I are unaffected by over expression of CaM or CaM1234 (Table 1). In both species the orthologous myotonia mutations in the CT affect the Ca2+ regulation of channel gating. In the rat channel rNaV1.4F1698I abolished the Ca2+ sensitivity observed in the wild type rNaV1.4. In contrast, hNaV1.4F1705I imparts sensitivity to Ca2+ which is absent in wild type hNaV1.4. We postulated that differences in the EFL region of the two channels contribute to the difference in Ca2+ response of the orthologous myotonia mutations in the human and rat channels.
Figure 5

CaM shifts inactivation of rat NaV1.4F1698I.

(A) Representative families of rNaV1.4F1698I activation currents co-expressed with either CaM or CaM1234. (B) Representative steady-state inactivation currents elicited from different holding potentials through rNaV1.4F1698I channels in presence and absence of CaM over expression. (C) Activation and steady-state inactivation relationships. The solid lines are the fits to steady-state inactivation data of rNaV1.4F1698I with CaM and CaM1234 over expression. There is a significant (p<0.05) shift of the inactivation curve by CaM compared to the expression of rNaV1.4F1698I alone. Over expression of CaM1234 has no significant effect compared with the absence of CaM over expression. In contrast, the V1/2 of activation of rNaV1.4F1698I, is not changed by co-expression of CaM or CaM1234. The dotted lines in panel (C) represent wild type channel in 0.5 µM Ca2+.

CaM shifts inactivation of rat NaV1.4F1698I.

(A) Representative families of rNaV1.4F1698I activation currents co-expressed with either CaM or CaM1234. (B) Representative steady-state inactivation currents elicited from different holding potentials through rNaV1.4F1698I channels in presence and absence of CaM over expression. (C) Activation and steady-state inactivation relationships. The solid lines are the fits to steady-state inactivation data of rNaV1.4F1698I with CaM and CaM1234 over expression. There is a significant (p<0.05) shift of the inactivation curve by CaM compared to the expression of rNaV1.4F1698I alone. Over expression of CaM1234 has no significant effect compared with the absence of CaM over expression. In contrast, the V1/2 of activation of rNaV1.4F1698I, is not changed by co-expression of CaM or CaM1234. The dotted lines in panel (C) represent wild type channel in 0.5 µM Ca2+.

EFL Residues Mediate the Differences in Ca2+ Regulation

We compared the amino acid sequences in the CT of the rat and human NaV1.4 channels in the EFL and IQ motifs. In the region that includes the EFL (Figure 1A), the amino acids at positions 1613 and 1636 in hNaV1.4 are glycine (G) and alanine (A), and the corresponding residues in rNaV1.4 are serine (S) and aspartic acid (D) respectively (Figure 6A). Position 1613 is within the predicted EFL region whereas residue 1636 is outside the EFL in H1–H2 loop region. We tested the hypothesis that hNaV1.4F1705I altered channel gating by disruption of Ca2+ sensing through the EFL motif. We generated a triple mutant human channel, containing F1705I and replacing the non-conserved residues in the human EFL with the corresponding amino acids from the rat sequence hNaV1.4F1705I,G1613S,A1636D (hNaV1.4F1705I+GS/AD). hNaV1.4F1705I+GS/AD and hNaV1.4 have comparable peak current I–V relationships, and in both cases the voltage dependences of activation were not altered by the absence or presence of 0.5 µM Ca2+ (Figures 6B, 6C and Table 1). Similar to rNaV1.4F1698I, steady-state inactivation of hNaV1.4F1705I+GS/AD was insensitive to changes in the [Ca2+]i (Figure 6D and Table 1). Thus key residues in the EFL region contributed to the species differences in Ca2+ sensitivity of mutations in NaV1.4 that produce myotonia.
Figure 6

Exchange of human and rat EFL residues in hNaV1.4.

(A) Amino acid sequence alignment of the proximal CT of rat and human wild type NaV1.4 channel and hNaV1.5 demonstrate the similarity of rNaV1.4 and hNaV1.5 at key positions in the EFL. In hNaV1.4F1705I+GA/SD residues G1613S and A1636D are substituted in the human channel hNaV1.4F1705I to match the corresponding residues of rNaV1.4. (B) Representative families of hNaV1.4F1705I+GA/SD activation currents in the presence and absence of [Ca2+]i. (C) Normalized I–V relationships hNaV1.4F1705I+GA/SD are not affected by altered [Ca2+]i or CaM and CaM1234 over expression. (D) The steady-state inactivation of hNaV1.4F1705I+GA/SD channels are not sensitive to changes in [Ca2+]i. The dotted lines in panel (D) represent hNaV1.4 in 0.5 µM Ca2+. (E) Representative steady-state inactivation currents elicited from different holding potentials through hNaV1.4F1705I+GA/SD channels in the presence and absence of CaM over expression. (F) There is a significant (p<0.004) hyperpolarizing shift of the inactivation curve by CaM over expression compared to the expression of hNaV1.4F1705I+GA/SD (in dotted line) alone. Over expression of CaM1234 has no significant effect compared with the absence of CaM over expression. (G) Representative steady-state inactivation currents elicited from different holding potentials through hNaV1.4GA/SD channels in the presence and absence of [Ca2+]i. (H) Steady-state inactivation of hNaV1.4GA/SD channel exhibited sensitivity to changes in [Ca2+]i similar to the wild type rat channel.

Exchange of human and rat EFL residues in hNaV1.4.

(A) Amino acid sequence alignment of the proximal CT of rat and human wild type NaV1.4 channel and hNaV1.5 demonstrate the similarity of rNaV1.4 and hNaV1.5 at key positions in the EFL. In hNaV1.4F1705I+GA/SD residues G1613S and A1636D are substituted in the human channel hNaV1.4F1705I to match the corresponding residues of rNaV1.4. (B) Representative families of hNaV1.4F1705I+GA/SD activation currents in the presence and absence of [Ca2+]i. (C) Normalized I–V relationships hNaV1.4F1705I+GA/SD are not affected by altered [Ca2+]i or CaM and CaM1234 over expression. (D) The steady-state inactivation of hNaV1.4F1705I+GA/SD channels are not sensitive to changes in [Ca2+]i. The dotted lines in panel (D) represent hNaV1.4 in 0.5 µM Ca2+. (E) Representative steady-state inactivation currents elicited from different holding potentials through hNaV1.4F1705I+GA/SD channels in the presence and absence of CaM over expression. (F) There is a significant (p<0.004) hyperpolarizing shift of the inactivation curve by CaM over expression compared to the expression of hNaV1.4F1705I+GA/SD (in dotted line) alone. Over expression of CaM1234 has no significant effect compared with the absence of CaM over expression. (G) Representative steady-state inactivation currents elicited from different holding potentials through hNaV1.4GA/SD channels in the presence and absence of [Ca2+]i. (H) Steady-state inactivation of hNaV1.4GA/SD channel exhibited sensitivity to changes in [Ca2+]i similar to the wild type rat channel. Remarkably hNaV1.4F1705I+GS/AD exhibits CaM regulation that recapitulates that of rNaV1.4F1698I. Over expression of CaM with hNaV1.4F1705I+GS/AD produces a hyperpolarizing shift in V1/2 of steady-state inactivation compared to the mutant channel in the absence of CaM over expression (Figures 6E, 6F and Table 1; p<0.05). Similar to rNaV1.4F1698I, CaM1234 over expression with hNaV1.4F1705I+GS/AD does not alter the voltage dependence of steady-state inactivation compared to the mutant channel without CaM1234 over expression (Figure 6F and Table 1). The orthologous myotonia mutation on the rat channel background exhibits changes in Ca2+/CaM regulation that are completely different from that of hNaV1.4F1705I. However substituting the EFL residues present in the rat channel into the hNaV1.4F1705I background is sufficient to recapitulate the Ca2+/CaM regulation exhibited by rNaV1.4F1698I (Figures 6 and Table 1). This holds true for wild type channels, as mutation of the non-conserved amino acids of the wild type hNaV1.4 EFL to match that of the rat sequence (G1613S and A1636D) reestablished Ca2+ and CaM sensitivity of inactivation gating mimicking that of wild type rat NaV1.4 (Figures 6G and 6H, Table 1). Additionally, changing the EFL residues (G and A) from human channel into the wild type rat NaV1.4 (rNaV1.4SG/DA) or mutant rNaV1.4F1698I (rNaV1.4F1698I+SG/DA) background restored Ca2+/CaM regulation similar to that displayed by hNaV1.4 or hNaV1.4F1705I respectively (Table 1). Thus the differences in the key amino acids in the EFL region are associated with species-specific differences in Ca2+/CaM regulation of the wild type and mutant, human and rat NaV1.4 channels.

Discussion

Myotonic mutations in hNaV1.4 have been reported to affect Na+ current inactivation properties. Wu et al. demonstrated a destabilization of fast inactivation without significant changes in activation or slow inactivation by the F1705I mutation [7]. However, the mechanism of the change in gating is uncertain as is the role of alteration of Ca2+ or CaM modulation of the function of the mutant channel. We have demonstrated that the CT myotonia mutation, hNaV1.4F1705I slows the INa decay, depolarizes the voltage dependence of inactivation and augments the window current, effects that may contribute to the cold-induced myotonic phenotype. Notably, hNaV1.4F1705I imparts intracellular Ca2+ sensitivity to inactivation gating, a feature that is distinct from the wild type hNaV1.4. However, the direction of the shift of steady-state inactivation of hNaV1.4F1705I channels is opposite to the direction of the Ca2+-induced shift observed with cardiac channel, hNaV1.5 [14]. Our data suggest that two key residues in the EFL (Figure 6, Table 1) modify gating of wild type hNaV1.4 and the myotonia mutant hNaV1.4F1705I. Sodium channel mediated myotonia is characterized electrophysiologically by a delay in inactivation that predisposes to repetitive depolarization and contraction of skeletal muscle after a brief stimulus. Previous studies suggested that a defect in fast inactivation, as in the CT mutant F1705I mutation, was sufficient to produce myotonia [7], [37]. Our data shows, that along with a depolarizing shift in steady-state inactivation and slowed INa decay, reduced intracellular Ca2+ levels exaggerate both the depolarizing shift of inactivation (Figures 1D, 1E and 1G) and the slowing of INa decay of the current (Figures 2A and 2B). It appears that the largest effect of the F1705I mutation is on the voltage dependence and temperature sensitivity of gating but our data suggest that altered [Ca2+]i sensitivity of the mutant channel potentiates symptoms of myotonia at low temperature. The experiments were designed to test the effects of Ca2+ on channel gating and we explored the extremes of the range of concentrations. We do not believe that bulk Ca2+ levels ever reach these levels but sub cellular distribution of ion concentrations are heterogeneous and local changes in Ca2+ in this range are feasible [38]. Slowing of INa decay, increased window current, altered voltage dependence of inactivation, along with disruption of Ca2+ sensitivity of hNaV1.4F1705I could explain myotonia, but it is not clear what triggers cold-induced symptoms or why these patients are free from symptoms at normal body temperature. Our study indicates hastening of INa decay of hNaV1.4F1705I at normal body temperature eliminates current changes that are associated with the myotonic phenotype. At 37°C, the INa decay of hNaV1.4F1705I (at −30 mV) is ∼5 times faster than at RT and is nearly identical to the decay rate of wild type hNaV1.4 current at 37°C (Figures 2C and 2D). Additionally, at 37°C, V1/2 of steady-state inactivation of hNaV1.4F1705I significantly shifted ∼10 mV in hyperpolarizing direction compared to RT, and is comparable to V1/2 of wild type channel at RT (Figure 2E). The temperature dependent shift we observed in the human mutant channel is more than the previously reported ∼3 mV temperature dependent shift in steady-state inactivation of native rat skeletal muscle Na channels [39]. Rescue of INa decay and steady-state inactivation at 37°C could explain why the patients with the F1705I mutation are free from myotonia at normal body temperature. Slowing of deactivation of hNaV1.4 may cause sustained skeletal muscle contraction by delaying repolarization thereby prolonging action potential duration [34]. Differential temperature-induced changes in mutant channel gating; particularly slowing of deactivation resulting in persistent membrane depolarization has been proposed for some hNaV1.4 mutations causing myotonia [40]; however, the F1705I mutation does not alter deactivation [33]. Additionally, it has been suggested that at normal temperatures more wild type channels are activated compared to mutant channels and with lowering of temperature mutant channels dominate membrane excitability [41]. Alternatively changes in temperature may be associated with changes in intracellular [Ca2+] [42] that exaggerate the inactivation gating defects of the mutant channel. We speculate that temperature sensitive changes in intracellular Ca2+ could alter cold aggravated myotonia in F1705I mutant muscle. The biophysical effects of hNaV1.4F1705I and the orthologous rat mutation rNaV1.4F1698I are consistent with a key role for the CT in inactivation gating. Residues in and around the EFL motif [21], [22] of the CT of hNaV1.5 and NaV1.1 regulate the Ca2+ sensitivity of channel gating [14], [17], [18], [23], [24], [25], which may occur at low levels of free [Ca2+] in the cell [43]. In addition to the EFL, sites in the III–IV linker are involved in Ca2+/CaM mediated regulation of gating [28], [29]. We exploited the differences in the EFL sequences and Ca2+ sensitivity of inactivation gating of the human and rat orthologous NaV1.4 channels to better understand the mechanisms of Ca2+ modulation of wild type and mutant channels. Inactivation gating of hNaV1.4F1705I is sensitive to changes in intracellular [Ca2+], in contrast wild type hNaV1.4 exhibits no such sensitivity to Ca2+. The inverse is true for the wild type and mutant rat isoforms of NaV1.4. Mutating the non-conserved amino acids of the hNaV1.4 EFL region to match that of the rat sequence (G1613S and A1636D), abolishes the Ca2+ sensitivity of hNaV1.4F1705I+GS/AD mimicking that of rNaV1.4F1698I. Similarly, mutating the non-conserved amino acids of the wild type hNaV1.4 EFL region to match that of the rat sequence (G1613S and A1636D) restores the Ca2+ sensitivity of the channel mimicking that of wild type rat NaV1.4 (Figures 6G, 6H, Table 1). To our knowledge, this is the first report of a mutation in the CT remote from the EFL region that abolishes Ca2+ sensitivity of gating of NaV1.4 channels; however, it is not clear that the rNaV1.4F1698I or hNaV1.4F1705I has compromised channel gating through a long range conformational effect on the EFL motif. Notably, both rat and human myotonic mutant channels dramatically shift the voltage dependence of inactivation gating in the depolarizing direction. A similar depolarizing shift in inactivation due to a mutation in the CT hNaV1.4 (Q1633E) has been reported, implicating the EFL region of the CT in inactivation gating [9]. Thus it may be that these mutants introduce a significant local structural change in the predicted H5 which in turn influences the neighboring H4 and alters helical interactions in the EFL leading to a disruption of Ca2+ sensing. Hydrophobic helical interactions in the cardiac NaV1.5 EFL, particularly H1–H4, appear to stabilize the structure of the proximal CT of the channel which is postulated to be a prerequisite for durable inactivation [44]. Although most of the mutations at the hydrophobic interfaces of the EFL helices shift inactivation in the hyperpolarizing direction, there are important exceptions to this generalization [44]. The mechanism of the Ca2+ regulation of gating by residues in the CT is not fully understood and the role of direct Ca2+ binding to this region is debated. In fact the crystal structure of a ternary complex of the CT-hNaV1.5, CaM and FHF fails to show Ca2+ in the EFL region [27], [30]. The structure needs to be viewed in the context of functional studies of the intact channel where mutations of the EFL residues consistently alter the Ca2+ sensitivity of hNaV1.5 gating [14], [17], [18], [24], [45]. This does not prove that Ca2+ is binding to this region; an alternative is that the mutation(s) produce an allosteric change that alters Ca2+ sensitivity of gating. It is interesting that this myotonic mutation in H5 does not affect CaM regulation of the channel. This finding is consistent with previous observations [15] that CaM is an integral part of NaV1.4 and it remains tethered to the mutant channels in all conformations. An alternative explanation is that the IQ-containing H6 interacts with the EFL [24], [45] bringing the H5 into physical proximity of the EFL. Thus mutations such as rNaV1.4F1698I or hNaV1.4F1705I in H5 could alter the conformation and disrupt Ca2+-sensing but this would have to occur without altering the interaction between CaM and the IQ as myotonic mutant channels of both the species are normally regulated by over expression of CaM (Table 1). It is clear from our study that intracellular Ca2+ has the capacity to regulate some skeletal muscle NaV1.4 isoforms in a manner similar to the cardiac isoform NaV1.5 [14], [17], [18], [24], [32], provided the NaV1.4 channel isoforms have proper residues in the EFL sequence. For example, channels with the rNaV1.4 EFL (Figure 6A) or engineered mutant human channels with the orthologous rat residues in the EFL, hNaV1.4GS/AD, are regulated by [Ca2+]i. In contrast, channels with the native human sequence (hNaV1.4) or mutated residues in the EFL (rNaV1.4SG/DA) are insensitive to [Ca2+]i. This study also demonstrates that detailed regulation of inactivation of variants of NaV1. 4 channels by CaM over expression is determined by the composition of the EFL and the ability of intracellular Ca2+ to regulate gating (Figure 7). Irrespective of NaV1.4 channel isoform, CaM mediated regulation of NaV1.4 depends on the EFL residues and [Ca2+]i. The voltage dependence of inactivation gating of the skeletal muscle Na channel variants is either Ca2+ sensitive (rat NaV1. 4, hNaV1.4GA/DS) or insensitive (human NaV1. 4, rNaV1.4DS/GA). The Ca2+ sensitivity is in part determined by the amino acid sequence in the EFL. This sequence divergence is associated with differences in the baseline voltage dependence of inactivation as well as the response to CaM over expression (Figure 7).
Figure 7

Ca2+ sensitivity, inactivation gating and calmodulation.

This schematic illustrates the relationship between the Ca2+ sensitivity of inactivation gating and the effect of CaM over expression. Channel variants that exhibit shifts in the voltage dependence of inactivation as a function of changes in intracellular [Ca2+] exhibit a depolarized V1/2 compared with variants insensitive to Ca2+. The Ca2+ sensitivity is associated with the direction of the gating shift induced by CaM over expression. Residues in the EFL are key determinants of the Ca2+ sensitivity and effect of CaM over expression on inactivation gating. The red curves in plots indicate steady-state inactivation in the presence of CaM.

Ca2+ sensitivity, inactivation gating and calmodulation.

This schematic illustrates the relationship between the Ca2+ sensitivity of inactivation gating and the effect of CaM over expression. Channel variants that exhibit shifts in the voltage dependence of inactivation as a function of changes in intracellular [Ca2+] exhibit a depolarized V1/2 compared with variants insensitive to Ca2+. The Ca2+ sensitivity is associated with the direction of the gating shift induced by CaM over expression. Residues in the EFL are key determinants of the Ca2+ sensitivity and effect of CaM over expression on inactivation gating. The red curves in plots indicate steady-state inactivation in the presence of CaM.

Conclusion

The cold aggravated myotonia mutation, hNaV1.4F1705I in the CT of the skeletal muscle channel remote from the EFL region produces temperature-dependent slowing of current decay and significant destabilization of inactivation, and is associated with a disruption or alteration of Ca2+ regulation. Alteration of [Ca2+]i sensitivity at low temperature could potentiate myotonia symptoms. These changes result in greater Na current availability at depolarized voltages, and thus prolongation of the cellular action potential which is likely to be the proximate cause of myotonia. Moreover the data suggests a mechanism by which drugs that stabilize Na current inactivation may be useful in controlling muscle symptoms. This disease causing mutation and isoform specific amino acid variation in the CT EFL provide important insights into the differences in Ca2+ regulation of NaV1 channels. Includes Methods, Figures S1 – S3 with legends, Table S1, and References. (DOCX) Click here for additional data file.
  45 in total

1.  Effects of temperature on slow and fast inactivation of rat skeletal muscle Na(+) channels.

Authors:  R L Ruff
Journal:  Am J Physiol       Date:  1999-11

2.  Role of the C-terminal domain in inactivation of brain and cardiac sodium channels.

Authors:  M Mantegazza; F H Yu; W A Catterall; T Scheuer
Journal:  Proc Natl Acad Sci U S A       Date:  2001-12-11       Impact factor: 11.205

3.  Secondary structure of the human cardiac Na+ channel C terminus: evidence for a role of helical structures in modulation of channel inactivation.

Authors:  Joseph W Cormier; Ilaria Rivolta; Michihiro Tateyama; An-Suei Yang; Robert S Kass
Journal:  J Biol Chem       Date:  2001-12-10       Impact factor: 5.157

4.  Isoform-specific modulation of voltage-gated Na(+) channels by calmodulin.

Authors:  Isabelle Deschênes; Nathalie Neyroud; Deborah DiSilvestre; Eduardo Marbán; David T Yue; Gordon F Tomaselli
Journal:  Circ Res       Date:  2002-03-08       Impact factor: 17.367

5.  Temperature-sensitive defects in paramyotonia congenita mutants R1448C and T1313M.

Authors:  Margaret S Dice; Jennifer L Abbruzzese; James T Wheeler; James R Groome; Esther Fujimoto; Peter C Ruben
Journal:  Muscle Nerve       Date:  2004-09       Impact factor: 3.217

6.  A calcium sensor in the sodium channel modulates cardiac excitability.

Authors:  Hanno L Tan; Sabina Kupershmidt; Rong Zhang; Svetlana Stepanovic; Dan M Roden; Arthur A M Wilde; Mark E Anderson; Jeffrey R Balser
Journal:  Nature       Date:  2002-01-24       Impact factor: 49.962

Review 7.  Interacting ions in biophysics: real is not ideal.

Authors:  Bob Eisenberg
Journal:  Biophys J       Date:  2013-05-07       Impact factor: 4.033

8.  Functional stoichiometry and local enrichment of calmodulin interacting with Ca2+ channels.

Authors:  Masayuki X Mori; Michael G Erickson; David T Yue
Journal:  Science       Date:  2004-04-16       Impact factor: 47.728

9.  An EF-hand in the sodium channel couples intracellular calcium to cardiac excitability.

Authors:  Tammy L Wingo; Vikas N Shah; Mark E Anderson; Terry P Lybrand; Walter J Chazin; Jeffrey R Balser
Journal:  Nat Struct Mol Biol       Date:  2004-02-22       Impact factor: 15.369

10.  The Na+ channel inactivation gate is a molecular complex: a novel role of the COOH-terminal domain.

Authors:  Howard K Motoike; Huajun Liu; Ian W Glaaser; An-Suei Yang; Michihiro Tateyama; Robert S Kass
Journal:  J Gen Physiol       Date:  2004-02       Impact factor: 4.086

View more
  6 in total

1.  Enhanced slow inactivation of the human skeletal muscle sodium channel causing normokalemic periodic paralysis.

Authors:  Lei Wu; Baorong Zhang; Ying Kang; Weiping Wu
Journal:  Cell Mol Neurobiol       Date:  2014-03-29       Impact factor: 5.046

2.  Interactions between N and C termini of α1C subunit regulate inactivation of CaV1.2 L-type Ca(2+) channel.

Authors:  Adva Benmocha Guggenheimer; Lior Almagor; Vladimir Tsemakhovich; Debi Ranjan Tripathy; Joel A Hirsch; Nathan Dascal
Journal:  Channels (Austin)       Date:  2016       Impact factor: 2.581

3.  Conservation of Ca2+/calmodulin regulation across Na and Ca2+ channels.

Authors:  Manu Ben-Johny; Philemon S Yang; Jacqueline Niu; Wanjun Yang; Rosy Joshi-Mukherjee; David T Yue
Journal:  Cell       Date:  2014-06-19       Impact factor: 41.582

4.  Calmodulation meta-analysis: predicting calmodulin binding via canonical motif clustering.

Authors:  Karen Mruk; Brian M Farley; Alan W Ritacco; William R Kobertz
Journal:  J Gen Physiol       Date:  2014-06-16       Impact factor: 4.086

Review 5.  Calmodulin and Ca(2+) control of voltage gated Na(+) channels.

Authors:  Sandra B Gabelli; Jesse B Yoder; Gordon F Tomaselli; L Mario Amzel
Journal:  Channels (Austin)       Date:  2015-07-28       Impact factor: 2.581

6.  Finite element analysis predicts Ca2+ microdomains within tubular-sarcoplasmic reticular junctions of amphibian skeletal muscle.

Authors:  Oliver J Bardsley; Hugh R Matthews; Christopher L-H Huang
Journal:  Sci Rep       Date:  2021-07-13       Impact factor: 4.379

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.