| Literature DB >> 24303203 |
K N Kashkin1, I P Chernov, E A Stukacheva, E P Kopantzev, G S Monastyrskaya, N Ya Uspenskaya, E D Sverdlov.
Abstract
Core promoters with adjacent regions of the human genes CDC6, POLD1, CKS1B, MCM2, and PLK1 were cloned into a pGL3 vector in front of the Photinus pyrails gene Luc in order to study the tumor specificity of the promoters. The cloned promoters were compared in their ability to direct luciferase expression in different human cancer cells and in normal fibroblasts. The cancer-specific promoter BIRC5 and non-specific CMV immediately early gene promoter were used for comparison. All cloned promoters were shown to be substantially more active in cancer cells than in fibroblasts, while the PLK1 promoter was the most cancer-specific and promising one. The specificity of the promoters to cancer cells descended in the series PLK1, CKS1B, POLD1, MCM2, and CDC6. The bidirectional activity of the cloned CKS1B promoter was demonstrated. It apparently directs the expression of the SHC1 gene, which is located in a "head-to-head" position to the CKS1B gene in the human genome. This feature should be taken into account in future use of the CKS1B promoter. The cloned promoters may be used in artificial genetic constructions for cancer gene therapy.Entities:
Keywords: cancer gene therapy; cancer-specific; cloning; promoter
Year: 2013 PMID: 24303203 PMCID: PMC3848069
Source DB: PubMed Journal: Acta Naturae ISSN: 2075-8251 Impact factor: 1.845
Primers used for promoter amplification
| Promoter | Primer (5’ – > 3’) |
|---|---|
| POLD1 | GGTACCTGAATACAATCCAGCCCGGAG |
|
CDC6 |
GCTAGCGATCATGGCACGGCACTCA |
|
CKS1B |
GGTACCGGTCCCACAAAGATAAAGCTCC |
|
MCM2 |
ATCCGAGGTGCATCCTTCAC |
|
PLK1 |
GCAAGACTCCATCTCAACAACA |
* Coordinates of promoter with respect to the transcription start site of the gene.
| Promoter | CDC6 | POLD1 | CKS1B | MCM2 | PLK1 | BIRC5 | CMV |
|---|---|---|---|---|---|---|---|
| M | 5.95 | 9.37 | 12.19 | 6.80 | 220.00 | 2.94 | 0.78 |
* Coordinates of promoter with respect to the transcription start site of the gene.