BACKGROUND: A lesion-mimic mutant in rice (Oryza sativa L.), spotted leaf 5 (spl5), displays a disease-resistance-enhanced phenotype, indicating that SPL5 negatively regulates cell death and resistance responses. To understand the molecular mechanisms of SPL5 mutation-induced cell death and resistance responses, a proteomics-based approach was used to identify differentially accumulated proteins between the spl5 mutant and wild type (WT). RESULTS: Proteomic data from two-dimensional gel electrophoresis showed that 14 candidate proteins were significantly up- or down-regulated in the spl5 mutant compared with WT. These proteins are involved in diverse biological processes including pre-mRNA splicing, amino acid metabolism, photosynthesis, glycolysis, reactive oxygen species (ROS) metabolism, and defense responses. Two candidate proteins with a significant up-regulation in spl5 - APX7, a key ROS metabolism enzyme and Chia2a, a pathogenesis-related protein - were further analyzed by qPCR and enzyme activity assays. Consistent with the proteomic results, both transcript levels and enzyme activities of APX7 and Chia2a were significantly induced during the course of lesion formation in spl5 leaves. CONCLUSIONS: Many functional proteins involving various metabolisms were likely to be responsible for the lesion formation of spl5 mutant. Generally, in spl5, the up-regulated proteins involve in defense response or PCD, and the down-regulated ones involve in amino acid metabolism and photosynthesis. These results may help to gain new insight into the molecular mechanism underlying spl5-induced cell death and disease resistance in plants.
BACKGROUND: A lesion-mimic mutant in rice (Oryza sativa L.), spotted leaf 5 (spl5), displays a disease-resistance-enhanced phenotype, indicating that SPL5 negatively regulates cell death and resistance responses. To understand the molecular mechanisms of SPL5 mutation-induced cell death and resistance responses, a proteomics-based approach was used to identify differentially accumulated proteins between the spl5 mutant and wild type (WT). RESULTS: Proteomic data from two-dimensional gel electrophoresis showed that 14 candidate proteins were significantly up- or down-regulated in the spl5 mutant compared with WT. These proteins are involved in diverse biological processes including pre-mRNA splicing, amino acid metabolism, photosynthesis, glycolysis, reactive oxygen species (ROS) metabolism, and defense responses. Two candidate proteins with a significant up-regulation in spl5 - APX7, a key ROS metabolism enzyme and Chia2a, a pathogenesis-related protein - were further analyzed by qPCR and enzyme activity assays. Consistent with the proteomic results, both transcript levels and enzyme activities of APX7 and Chia2a were significantly induced during the course of lesion formation in spl5 leaves. CONCLUSIONS: Many functional proteins involving various metabolisms were likely to be responsible for the lesion formation of spl5 mutant. Generally, in spl5, the up-regulated proteins involve in defense response or PCD, and the down-regulated ones involve in amino acid metabolism and photosynthesis. These results may help to gain new insight into the molecular mechanism underlying spl5-induced cell death and disease resistance in plants.
In plants, one of the most common and effective defense responses to pathogen attack is the hypersensitive response (HR), which prevents further spread of pathogens to adjacent cells (Morel and Dangl 1997). Lesion mimic mutants (lmms), displaying HR-like lesions in the absence of pathogen attacks, have been identified from maize (Johal et al. 1995), Arabidopsis (Dietrich et al. 1994), barley (Wolter et al. 1993), and rice (Takahashi et al. 1999). Most lmms constitutively activate immune responses, including callose deposition, induction of Pathogenesis
related (PR) genes, production of reactive oxygen species (ROS), and accumulation of phytoalexins (Staskawicz et al. 1995). Therefore, lmms are very useful genetic tools to dissect molecular mechanisms of programmed cell death (PCD) and defense responses in plants.In rice, more than 43 lmms have been isolated, most of which display enhanced resistance to rice blast and/or bacterial blight pathogens (Takahashi et al. 1999; Yin et al. 2000; Mizobuchi et al. 2002; Jung et al. 2005; Mori et al. 2007; Wu et al. 2008; Qiao et al. 2010). So far, at least 11 lmms have been functionally characterized, including spl7 (Yamanouchi et al. 2002), spl11 (Zeng et al. 2004), Spl18 (Mori et al. 2007), spl28 (Qiao et al. 2010), sl (Fujiwara et al. 2010), ttm1 (Takahashi et al. 2007), rlin1 (Sun et al. 2011), NPR1 (Chern et al. 2005), lsd1 (Wang et al. 2005), acdr1 (Kim et al. 2009), and edr1 (Shen et al. 2011). Interestingly, these LMM genes encode different proteins with distinct functions. For example, SPL7 is a heat stress transcription factor (Yamanouchi et al. 2002); SPL11 is a E3 ubiquitin ligase (Zeng et al. 2004); SPL18, a acyltransferase (Mori et al. 2007); SPL28, a clathrin-associated adaptor protein complex 1 medium subunit 1 (Qiao et al. 2010). These findings indicate that numerous proteins with distinct functions in multiple signaling pathways and/or processes are involved to prevent inappropriate activation of PCD. Thus, lmms have helped to gain an in-depth insight into regulatory mechanisms of PCD and defense responses in plants.Rice spotted leaf 5 (spl5) is a lmm with spontaneous HR-like lesions on its leaves, and broadly enhanced resistance to rice blast and bacterial blight pathogens (Yin et al. 2000; Mizobuchi et al. 2002). The spl5 gene was previously mapped into a 36.4-cM region on rice chromosome 7 (Iwata et al. 1978). Recently, we finely mapped and isolated spl5 by a map-based cloning, and surprisingly, it was found that the protein encoding by SPL5 gene (GeneBank accessioin: KC128660) shares a certain degree of homology with a humansplicing factor 3b subunit 3 (SF3b3), one subunit of the SF3 protein complex involved in binding of U2 snRNP to the branch site in the splicing reaction of pre-mature RNAs (Chen et al. 2009, Chen et al. 2012). Therefore, it is likely that the SPL5 regulated cell death and resistance responses post-transcriptionally.Two-dimensional gel electrophoresis (2-DE) is a most commonly used proteomics technology for monitoring global changes in protein levels in plants (Agrawal and Rakwal 2006). The comparative proteomics has been used to identify differentially expressed proteins between wild type (WT) rice and lmms (Takahashi et al. 2003; Tsunezuka et al. 2005; Jung et al. 2006; Kang et al. 2007; Kim et al. 2008). However, different defense-related proteins and metabolic enzymes were found to be differently accumulated during lesion formation in a lmm-specific manner or in different lmms. For example, two PR proteins (OsPR5 and OsPR10) and three ROS-scavenging enzyames [catalase (CAT), ascorbate peroxidae (APX), and superoxide dismutase (SOD)] were differentially expressed in the blm mutant (Jung et al. 2006); Peroxidase, thaumatin-like protein, probenazole-induced protein (PBZ1) were up-regulated in the spl1 mutant (Kim et al. 2008).Here, we compared the protein profiles of spl5 mutant and WT by 2-DE and found that 14 proteins were differentially accumulated between WT and spl5. Among these 14 proteins, 7 were up-regulated and 7 were down-regulated, respectively, in spl5. The proteins up-regulated in spl5 are those involved in defense response or PCD, and the proteins down-regulated in spl5 involved in amino acid metabolism and photosynthesis. Interestingly, a clear correlation between levels of protein accumulation and levels of gene expression (or induction) was observed for the 7 up-regulated proteins in spl5. However, a corresponding correlation was not observed for the 7 down-regulated proteins in spl5. Together, our results may help to understand molecular mechanisms of lesion formation in spl5.
Results and discussion
2-DE analysis between WT and spl5 mutant
To compare protein expression profiles between WT and the spl5 mutant, total proteins extracted from fully developed leaves with lesions from spl5 and the corresponding leaves from WT were analyzed by 2-DE. After quantitative analysis, 14 spots with > 2-fold changes (p < 0.05) between spl5 and WT were identified (Figures 1 and 2). Compared to those in WT, seven proteins (spots 1, 5, 6, 8, 11, 13, and 14) were up-regulated and seven (spots 2, 3, 4, 7, 9, 10, and 12) were down-regulated, respectively, in spl5 mutant. Relative intensities and fold-changes of the spots differentially expressed between spl5 and WT were shown in Table 1.
Figure 1
A silver-stained 2-DE gel of the proteins extracted from leaf blades of both WT and
mutant. For IEF, 100 μg of total proteins was loaded onto pH 3-10 IPG strips (13 cm, nonlinear), and then transferred to 12.5% SDS-polyacrylamide gel for the second-dimensional electrophoresis. The protein gel was stained with silver nitrate solution. Quantitative analysis of digitized images was carried out using the Image Master software (Amersham, USA). Arrows indicate spots with more than 2-fold change in spl5 mutant compared to WT.
Figure 2
Magnified regions of 2-DE gels. Numbers at the left of images indicate protein spots showed by arrows in Figure 1 with significantly differential accumulation levels between spl5 and WT mutant in 2-DE gel analysis.
Table 1
Identification of proteins differentially expressed between WT and
mutant
Function type
Spot id
Homologous protein
Score
Source
Accession
Coverage (%)
pI
MM (kDa)
Change fold
mRNA level
mRNA splicing
2
Thioredoxin-like protein 4B
71
O. sativa
gi|125576924
25
6.4
23.6
−3.3
-
Amino-acid metabolism
4
Alanine aminotransferase
187
O. sativa
gi|115470235
31
8
54.0
−2.3
-
6
Aspartate aminotransferase
84
O. sativa
gi|125541475
15
6.5
50.6
2.0
up
12
Cysteine synthase
86
O. sativa
gi|115489664
29
5.3
33.9
−3.9
-
5
S-adenosylmethionine synthetase
93
O. sativa
gi|100801534
27
6.5
43.0
2.6
up
Photosynthesis
3
Rubisco large subunit
130
O. sativa
gi|115468792
33
8.5
48.4
−2.7
down
9
Rubisco activase
74
O. sativa
gi|1778414
28
5.4
48.1
−2.0
-
10
Rubisco activase, chloroplast precursor
174
O. sativa
gi|108864712
44
5.1
36.7
−3.1
-
Glycolysis
8
Glyceraldehyde-3-phosphate dehydrogenase
78
O. sativa
gi|115459078
24
7.3
36.9
3.1
up
ROS metabolism
11
Glutathione S-transferase 14
88
O. sativa
gi|46276327
33
6.5
30.8
2.1
up
13
Ascorbate peroxidase 7
264
O. sativa
gi|116310282
47
6.9
38.2
8.1
up
Defense-related
14
Chitinase Chia2a
81
O. sativa
gi|115483206
27
5.4
27.9
3.5
up
Others
1
Retrotransposon Ty3-gypsy subclass
68
O. sativa
gi|77556153
16
4.7
29.1
3.0
down
7
Nad-dependent formate dehydrogenase
164
O. sativa
gi|4760553
40
7.2
41.5
−2.2
-
Spot ID refers to the spot identity as given in Figure 2; Accession, protein accession in GenBank (http://www.ncbi.nlm.nih.gov/); Coverage %, the percentage of sequence coverage; pI, experimental isoelectric points; MM, experimental molecular masses; Change fold, the expression change fold of protein level in spl5 mutant compared to WT; mRNA level, the expression change of mRNA level in spl5 mutant compared to WT.
A silver-stained 2-DE gel of the proteins extracted from leaf blades of both WT and
mutant. For IEF, 100 μg of total proteins was loaded onto pH 3-10 IPG strips (13 cm, nonlinear), and then transferred to 12.5% SDS-polyacrylamide gel for the second-dimensional electrophoresis. The protein gel was stained with silver nitrate solution. Quantitative analysis of digitized images was carried out using the Image Master software (Amersham, USA). Arrows indicate spots with more than 2-fold change in spl5 mutant compared to WT.Magnified regions of 2-DE gels. Numbers at the left of images indicate protein spots showed by arrows in Figure 1 with significantly differential accumulation levels between spl5 and WT mutant in 2-DE gel analysis.Identification of proteins differentially expressed between WT and
mutantSpot ID refers to the spot identity as given in Figure 2; Accession, protein accession in GenBank (http://www.ncbi.nlm.nih.gov/); Coverage %, the percentage of sequence coverage; pI, experimental isoelectric points; MM, experimental molecular masses; Change fold, the expression change fold of protein level in spl5 mutant compared to WT; mRNA level, the expression change of mRNA level in spl5 mutant compared to WT.
Characterization of differentially expressed proteins in spl5 mutant
The 14 differentially expressed spots represent 14 annotated proteins, which could be categorized into seven functional classes including pre-mRNA splicing, amino acid metabolism, photosynthesis, glycolysis, ROS metabolism, defense-related, and other processes (Table 1). Interestingly, these proteins are mostly associated with cell death and defense responses in different organisms.
Pre-mRNA splicing protein
A protein component of RNA spliceosome, thioredoxin-like protein 4B (TXNL4B, Dim2, or DLP), was down-regulated in the spl5 mutant. In eukaryotes, the pre-mRNA splicing that removes intronic sequences is undertaken by the spliceosome, a macromolecular complex containing four snRNPs (U1, U2, U4/U6, and U5) and numerous auxiliary proteins (Kramer 1996). DLP functions in the cell nucleus and interacts with an U5 protein subunit of the spliceosome, and blocking DLP protein activity leads to insufficient pre-mRNA splicing (Sun et al. 2004).
Amino-acid metabolism enzymes
In differently expressed proteins, four enzymes including alanine aminotransferase (ALT; down), aspartate aminotransferase (AST; up), cysteine synthase (CSase; down), and S-adenosylmethionine synthetase (SAMS; up) (Table 1) are involved in amino acid transport and metabolism. SAMS catalyzes the biosynthesis of S-adenosylmethionine, which is a co-substrate for methylation reactions and serves as substrate for the synthesis of ethylene and the polyamines (Burstenbinder et al. 2010). Ethylene is an important hormone involved in plant responses to various stress situations (e.g. pathogen attack); and exposure of plants to ethylene can induce disease resistance (Geraats 2003). Polyamines can contribute to hydrogen peroxide (H2O2) formation in response to pathogen infections, which led to increased necrosis and resistance to disease (Marina et al. 2008; Moschou et al. 2009; Gonzalez et al. 2011). The up-regulation of SAMS was also found in the mutant cdr2 (Tsunezuka et al. 2005).
Photosynthesis proteins
Rubisco is a critical enzyme involved in photosynthetic CO2 assimilation and photorespiratory carbon oxidation. Rubisco is inactivated by ROS, and degraded during senescence and oxidative stresses (Ranjan et al. 2001; Sedigheh et al. 2011). The reduction of the Rubisco large subunit (Rubisco-L) in spl5 mutant might be caused by H2O2 over-accumulation (Chen et al. 2012). Moreover, in the present study we found that Rubisco activases (Rubisco-A), which catalyze Rubisco activation, were also down-regulated in spl5 mutant (Table 1). The reduction of Rubisco and/or Rubisco-A was also found in the lmms of spl1 (Kim et al. 2008), spl6 (Kang et al. 2007), crd2 (Tsunezuka et al. 2005), and blm (Jung et al. 2006), suggesting that the reduction in Rubisco and Rubisco-A accumulation is a shared phenomenon among lmms.
Glycolysis protein
A key enzyme of glycolysis, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was up-regulated in spl5 mutant (Table 1), as also observed in lmms spl1 (Kim et al. 2008) and cdr2 (Tsunezuka et al. 2005). GAPDH catalyzes the oxidation of dihydroxyacetone phosphate to glycerol-3-phosphate. More recently, GAPDH emerged as a multifunctional protein in several non-metabolic processes, namely a primary role in apoptosis. S-nitrosylated GAPDH initiates apoptotic cell death by nuclear translocation following Siah1 binding (Hara et al. 2005); GAPDH accumulates in mitochondria during apoptosis and induces the pro-apoptotic mitochondrial membrane permeabilization (Tarze et al. 2007); and it also mediates cell death by its nuclear translocation under oxidative stress (Nakajima et al. 2009). Additionally, it was reported that GLY1-encoded GAPDH plays an important role in plastidal oleic acid-mediated signaling and resistant signaling in Arabidopsis (Kachroo et al. 20042005; Chandra-Shekara et al. 2007; Xia et al. 2009). Compared to WT, Arabidopsis mutant gly1 is much more susceptible to pathogens, while plants with GLY
1 overexpression have enhanced resistance (Venugopal et al. 2009). Increased level of GAPDH protein in the spl1, spl5, and cdr2 mutants suggests that GAPDH may function in stimulating cell death and defense responses in rice.
ROS metabolism proteins
Two major enzymes of ROS-detoxification, glutathione S-transferase 14 (GST14) and APX7, were up-regulated in spl5 mutant (Table 1). ROS, such as superoxide anion (O2–) and H2O2, are toxic byproducts of aerobic metabolism (Mittler et al. 2004). Upon pathogen attack, ROS were immediately induced to kill the infected cells and also served as a signal to activate the defense response (Shigeoka et al. 2002). To avoid the oxidative damage to other cells in plants, the ROS must be scavenged by the antioxidant enzymes SOD, CAT, APX, or GST etc. H2O2 has been reported to up-regulate expression of APX (Lee et al. 1999; Morita et al. 1999). According to our previous results, H2O2 is over-accumulated in leaves of spl5 mutant (Chen et al. 2012). It is likely that the high level of H2O2 in this mutant induces the HR and increases the resistance to pathogens. Therefore, up-regulation of APX7 and GST14 might be responsible for scavenging excessive accumulation of ROS in spl5 mutant. However, inductions of APX7 and GST14 were apparently insufficient to detoxify the overproduction of ROS, which resulted in cell death in spl5 mutant.
Defense-related protein
A PR protein, Chia2a, was found to be differently expressed between WT and spl5 mutant (Table 1). Chia2a is a class II chitinase belonging to the PR-3 group (Muthukrishnan et al. 2001). Chitinase can break down glycosidic bonds in chitin, which is the main structural component of fungal cell walls and insect exoskeletons (Sela-Buurlage et al. 1993). The expression of the chitinase gene was significantly stimulated by fungi (Xu et al. 2008). Transgenic plants over-expressing chitinase gene showed enhanced resistance to fungal (Brogue et al. 1991; Dunsmuir et al. 1993; Oldach et al. 2001) and bacterial pathogens (Oldach et al. 2001). It is likely that the increased level of Chia2a is responsible, at least partially, for the enhanced resistance in spl5 mutant.
mRNA level of differentially expressed proteins in spl5 mutant
To assay the mRNA levels of 14 differentially expressed proteins in spl5 mutant, the semi-quantitative RT-PCRs were performed. We analyzed the expressions of these 14 genes in WT leaf blades and the three different parts of spl5 leaf blades, based on the degree of lesion formation: no lesion (NL), leaf area without any lesions; few lesions (FL), leaf area with 10–20% lesions; and many lesions (ML), leaf area with 70–80% lesions (Figure 3a). As shown in Figure 3b, in spl5 mutant, the expression of 6 genes were induced and 2 genes were suppressed, and 6 genes did not changed at mRNA level.
Figure 3
Gene expressions of candidate proteins by semi-quantitative RT-PCR. (a) Lesion-mimic phenotypes of spl5 mutants. WT (control), the leaf blades of WT; NL, FL and ML indicate no lesion, few lesions, and many lesions, respectively, in the leaf blades of spl5 mutant. Arrows indicate leaf lesions in spl5 mutant. (b) Semi-quantitative RT-PCR of 14-proteins’ genes in WT leaves and leaf parts with different lesions of spl5 mutant. The protein ID numbers are listed in the left of images, and the corresponding gene names are listed in the right of images. The Actin was used as a reference gene.
Gene expressions of candidate proteins by semi-quantitative RT-PCR. (a) Lesion-mimic phenotypes of spl5 mutants. WT (control), the leaf blades of WT; NL, FL and ML indicate no lesion, few lesions, and many lesions, respectively, in the leaf blades of spl5 mutant. Arrows indicate leaf lesions in spl5 mutant. (b) Semi-quantitative RT-PCR of 14-proteins’ genes in WT leaves and leaf parts with different lesions of spl5 mutant. The protein ID numbers are listed in the left of images, and the corresponding gene names are listed in the right of images. The Actin was used as a reference gene.We compared the genes expression profile to our 2-DE data (Table 1). Most of the 7 up-regulated proteins (except spot 1) were transcriptionally induced in spl5 mutant. As expected, many of them (SAMS, GAPDH, GST14, APX7 and Chia2a) are defense- or PCD-related. It is likely that the SPL5 protein negatively regulates expression of these genes at transcriptional level. In contrast, the genes encoding down-regulated proteins (except spot 3) did not change significantly at the transcriptional level in spl5 mutant, and most of these proteins involve in amino-acid metabolism and photosynthesis. Based on the fact that the SPL5 gene encodes a subunit of splicing factor (Chen et al. 2012), it is likely that the genes encoding these down-regulated proteins might be controlled directly or indirectly by SPL5 through the post-transcriptional mRNA processing.
Further analysis of APX7 and Chia2a in spl5 mutant
Since the APX7 and Chia2a are directly involved in mediating PCD or defense responses, the gene expression of these proteins were further confirmed by qPCR. The qPCR results were similar to that of semi-quantitative RT-PCR (Figure 3b and Figure 4). The expression of APX7 increased in NL, FL, and ML of spl5 leaves, while the expression of Chia2a increased only in FL and ML but not in NL (Figure 4). The expression levels of these two genes were positively correlated with lesion numbers on the leaves of the spl5 mutant. Moreover, we further examined enzyme activities of APX and chitinase both in WT and spl5 mutant. As expected, APX and chitinase activities were proportional to the number of lesions on spl5 leaves (Figure 5).
Figure 4
qPCR confirmation of gene expression for
and
. qPCR results for APX7 and Chia2a in the leaf blades of WT (control) and leaf parts with different degree of lesions of spl5 mutant (see Figure 3a). Single and double asterisks indicate P < 0.05 and P < 0.01 (Student’s t-test), respectively.
Figure 5
Enzyme activities of APX and Chitinase in
mutant. Leaf parts with different number of lesions of spl5 mutant (see Figure 3a) were used to analyze enzyme activity: (a) APX and (b) chitinase. Single and double asterisks indicate P < 0.05 and P < 0.01 (Student’s t-test), respectively.
qPCR confirmation of gene expression for
and
. qPCR results for APX7 and Chia2a in the leaf blades of WT (control) and leaf parts with different degree of lesions of spl5 mutant (see Figure 3a). Single and double asterisks indicate P < 0.05 and P < 0.01 (Student’s t-test), respectively.Enzyme activities of APX and Chitinase in
mutant. Leaf parts with different number of lesions of spl5 mutant (see Figure 3a) were used to analyze enzyme activity: (a) APX and (b) chitinase. Single and double asterisks indicate P < 0.05 and P < 0.01 (Student’s t-test), respectively.
Conclusions
According to our 2-DE data and the proteomic results of other rice lmms (Takahashi et al. 2003; Tsunezuka et al. 2005; Jung et al. 2006; Kang et al. 2007; Kim et al. 2008), proteins involved in ROS scavenging, defense responses or cell death such as SOD (spl1, blm), CAT (spl6, blm), Peroxidase (spl1), APX (spl5, blm), GST (cdr2, spl5), were likely to be induced in lmms, whereas proteins involved in photosynthesis and glycolysis such as Rubisco (spl1, spl5, spl6, blm, crd2), Rubisco-A (spl5, spl6), and GAPDH (spl1, spl5, cdr2) were often deceased in lmms; defense-related protein like OsPR5 (spl1), OsPR10 (blm), PBZ1 (spl1, cdr2, blm), Chia2a (spl5) were significantly activated in lmms. This suggests that the differential accumulation of these proteins is common features for lmms.
Methods
Plant materials and growth conditions
An original spl5 mutant was screened from a γ-radiation-mutagenesis population of Norin8 (Oryza sativa L. ssp. japonica) by Iwata et al. (1978) in Japan. Zeng et al. (2003) crossed the spl5 mutant with WT Zhefu802 (a Chinese indica cultivar) through repeated backcrossing, and produced the mutant Zhefu802 with spl5 lesion mimic phenotype as used in this study. The seeds of spl5 mutant and Zhefu802 were germinated in an incubator at 28°C and then incubated in nutrient solution (Yoshida et al. 1976) in a growth chamber at 28/24°C (day/night). The nutrient solution was maintained at pH 5.6 and refreshed each 5 d. The fully developed leaves of 60-days-old seedlings were collected from each plant and immediately frozen in liquid nitrogen and stored at −80°C.
Protein extraction
Total proteins were extracted from collected leaf samples of 10 plants and independently repeated three times. Leaf blades were ground in liquid nitrogen, and the tissue powder produced was immediately suspended in an extraction buffer containing 9.5 M urea, 4% w/v 3-[(3-cholamidopropyl) dimethylammonio]-1-propane-sulfonate (CHAPS), 65 mM dithiothreitol (DTT), and 2% v/v immobilized pH gradient (IPG) buffer pH 3–10. Crude homogenates were centrifuged at 4°C (9,000 × g for 30 min). The supernatants were precipitated by 10% TCA for 1 h at −20°C, followed by centrifugation at 13,000 × g for 30 min. The pellets were washed twice with cold acetone and allowed to air dry, and then resuspended with the extraction buffer and finally stored at −80°C. Protein contents were determined by the Bradford method (Bradford 1976) using a protein assay reagent (Bio-Rad, USA).
2-DE
Extracted proteins were analyzed by 2-DE and biologically repeated trice using different samples. For 2-DE, 100 and 500 μg of total proteins were loaded onto analytical and preparative gels, respectively. The Ettan IPGphor Isoelectric Focusing System (Amersham, USA) and pH 3–10 IPG strips (13 cm, nonlinear; Amersham) were used for isoelectric focusing (IEF). The IPG strips were rehydrated for 12 h in 250 μL of rehydration buffer containing the protein samples. IEF was performed in five steps: 30 V for 12 h, 500 V for 1 h, 1000 V for 1 h, 8000 V for 8 h, and 500 V for 4 h. The gel strips were equilibrated for 15 min in equilibration buffer [50 mM Tris–HCl (pH 8.8), 6 M urea, 2% sodium dodecyl sulfate (SDS), 30% glycerol, and 1% DTT]. This step was repeated using the same buffer with 4% iodoacetamide in place of 1% DTT. The strips were then subjected to the second-dimensional electrophoresis after transfer onto 12.5% SDS-polyacrylamide gels. Electrophoresis was performed using the Hofer SE 600 system (Amersham) at 15 mA per gel until the bromophenol blue reached the end of the gel. Both the proteins of WT and spl5 mutant were done 2-DE for 3 gels, respectively.
Gel staining and image analysis
After 2-DE, analytical gels were stained with ammoniacal silver nitrate based on the procedure described by Hochstrasser (1988), and preparative gels were stained with Coomassie Blue G250 (Bio-Rad). Resulting 2-D gels were scanned using an UMax Powerlook 2110XL Scanner (Amersham). The stained protein spots were detected using software Image Master (Amersham). After quantitative detection, the intensities of each spot were normalized by total valid spot intensity. The spots displaying significant changes were considered to be differentially expressed proteins. Expression differences per protein spot between the spl5 mutant and WT from 3 independent experiments were estimated by t-test (p < 0.05). Protein spots were selected based on the significant differences of spots quantities between the spl5 mutant and WT.
In-gel digestion
Protein spots were excised from preparative 2-DE gels and destained with 100 mM NH4HCO3 and 30% acetonitrile (ACN). After removing the destaining buffer, the gel pieces were lyophilized and rehydrated in 30 μL of 50 mM NH4HCO3 containing 50 ng of sequencing grade, modified trypsin (Promega, USA). After digestion overnight at 37°C, these peptides were extracted thrice with 0.1% trifluoroacetic acid (TFA) in 60% ACN, and extracts were pooled together and lyophilized. Peptide mixtures were redissolved in 0.1% TFA, desalted and concentrated using ZipTips from Millipore. Peptide solution (0.75 mL) was mixed with 0.75 mL of matrix [α-cyano-4-hydroxycinnamic acid (CHCA) in 30% ACN, 0.1% TFA] spotted on a target disk and allowed to air dry.
MALDI-TOF/TOF analysis and database searching
Mass spectra were acquired on a MALDI-TOF/TOF mass spectrometer, the Bruker-Daltonics AutoFlex TOF-TOF LIFT (Bruker, Germany). Protein database searching was performed with the MASCOT search engine (http://www.matrixscience.com) using monoisotopic peaks against the NCBI nonredundant protein database (http://www.ncbi.nlm.nih.gov/). The species selected was Oryza sativa.
Semi-quantitative RT-PCR and qPCR
Total RNAs of leaves were isolated by TRIzol Reagent (Invitrogen, USA). The first-strand synthesis of cDNAs was carried out by SuperScript® III First-Strand Synthesis System (Invitrogen) according to the manufacturer’s instruction. Semi-quantitative RT-PCR was performed for 25 cycles of 30 s at 94°C, 30 s at 60°C, and 1 min at 72°C. qPCR was performed in StepOne™ Real-Time PCR System (Applied Biosystems, USA) using the Fast SYBR Green Master Mix reagent (Applied Biosystems) by the manufacturer’s instructions, and the thermal cycle used was as follows: 95°C for 20 s; and 40 cycles of 95°C for 3 s, and 60°C for 30 s. OsRAc1 (GenBank accession: X16280), a rice constitutively expressed gene of Actin, was used as a standardization control, using the primer pair 5’-GGAACTGGTATGGTCAAGGC-3’ and 5’-AGTCTCATGGATACCCGCAG-3’ for semi--quantitative RT-PCR, 5’-TGGCATCTCTCAGCACATTCC-3’ and 5’-TGCACAATGGATGGGTCAGA-3’ for qPCR. Gene-specific primers of candidate genes for semi-quantitative PCR and qPCR are listed in Table 2 and Table 3, respectively. Independent biological repetitions of each experiment were performed three times.
Table 2
Gene-specific primers for RT-PCR in this study
aSpot id
bAccession
Forward primer (5’-3’)
Reverse primer (5’-3’)
c Tm (°C)
1
LOC_Os12g37540
AACAAGGTAGGGATAGTTACTT
CCTTGTATGTGGGTTTTTTAGAA
55
2
AK067692
AATGAAATCTTGCTTGCTGC
CTAAATCTTCTTGGGACATA
60
3
AK067692
GCCTACTTCTTCACATTCAC
ATTTCATTACCTTCACGAGC
55
4
AK067732
ACCCGCTTTATTCTGCTG
ATCCTTTTGACACAGTATGG
60
5
AK104875
AGATGCTGTGCTTGATGCCT
CAATGACGAAGCGACCAGAT
55
6
AK105059
CAAACAGGGTGAAGAGCCAG
CTCGCATTTAGCCAGGGACA
62
7
AK065872
ACGCCGACAAGAATCCCAAC
CAATACGACCAGCCCCAACA
60
8
AK064960
TTCATCACCACCGACTACAT
AACCCTCAACAATACCAAAC
55
9
AK060847
GAAGCTGAAGAAGCAGGTGACATC
CGAAGACGAGCTCACACTGGAAG
55
10
AK104332
ATGGGTGAATTCTGTGGTGAG
CCCTTCTTGATGATGTCTGCC
58
11
AK102889
CTCGTTGCGGTAGTGCTGCT
AATGAAATCTTGCTTGCTGC
55
12
AK099598
TGGCAGCGAAGACAAACAAC
CTGGAAGAGCACCGACGAAA
62
13
AK063934
GCTTGAGATTTGATGTTGAG
GTCCTCTGCGTATTTTTCTG
62
14
AK070067
CGACTTCTCCACCCTACTAT
ATGATGTTGGTGATGACGCC
55
a Spot identity of protein in 2-D gel image; bmRMA accession of the corresponding protein in GenBank (http://www.ncbi.nlm.nih.gov/), except for spot 1 protein whose gene accession was only deposited in TIGR database (http://rice.plantbiology.msu.edu/index.shtml); cAnneal temperature of primer pair used in RT-PCR.
Table 3
Gene-specific primers for qPCR in this study
Gene name
Forward primer (5’-3’)
Reverse primer (5’-3’)
APX7
ATACGCAGAGGACCAAGAAGCAT
CTACGAGCAAGATAAATAGCAGA
Chia2a
CCAACATCATCAACGGCGGCAT
TTGGGATACTACATCACTACAT
Gene-specific primers for RT-PCR in this studya Spot identity of protein in 2-D gel image; bmRMA accession of the corresponding protein in GenBank (http://www.ncbi.nlm.nih.gov/), except for spot 1 protein whose gene accession was only deposited in TIGR database (http://rice.plantbiology.msu.edu/index.shtml); cAnneal temperature of primer pair used in RT-PCR.Gene-specific primers for qPCR in this study
Assay of enzyme activities
About 0.5–1 g of leaves were homogenized for activity assay of APX or chitinase, according to the methods previously described by Mishra et al. (1993) and Boller et al. (1983), respectively. Each experiment was independently repeated three times.
Authors: Mawsheng Chern; Heather A Fitzgerald; Patrick E Canlas; Duroy A Navarre; Pamela C Ronald Journal: Mol Plant Microbe Interact Date: 2005-06 Impact factor: 4.171
Authors: A Tarze; A Deniaud; M Le Bras; E Maillier; D Molle; N Larochette; N Zamzami; G Jan; G Kroemer; C Brenner Journal: Oncogene Date: 2006-10-30 Impact factor: 9.867