Literature DB >> 24279910

Glabrous Rice 1, encoding a homeodomain protein, regulates trichome development in rice.

Jinjun Li1, Yundong Yuan, Zefu Lu, Liusha Yang, Rongcun Gao, Jingen Lu, Jiayang Li, Guosheng Xiong.   

Abstract

BACKGROUND: Glabrous rice, which lacks trichomes on the rice epidermis, is regarded as an important germplasm resource in rice breeding. Trichomes are derived from aerial epidermal cells and used as a model to study the cell fate determination in plant. In Arabidopsis, the molecular mechanisms of trichome development have been well studied. However, little is known about the molecular basis of trichome development in rice.
RESULTS: In this study, near isogenic lines harboring the glabrous rice 1 locus were developed. By a map-based approach, we narrowed down the locus to a 21-kb DNA region harboring two genes. One of the genes named Glabrous Rice 1 (GLR1), which is most likely the candidate, encodes a homeodomain protein containing the WOX motif. Constitutive Expression of GLR1 could partially complement the glabrous phenotype of NILglr1. The knock down of GLR1 by RNA interference led to a significant decrease in trichome number on the leaves and glumes of the RNAi transgenic plants.
CONCLUSION: GLR1 plays an important role in rice trichome development and will contribute to breeding of glabrous elite rice varieties.

Entities:  

Year:  2012        PMID: 24279910      PMCID: PMC4883694          DOI: 10.1186/1939-8433-5-32

Source DB:  PubMed          Journal:  Rice (N Y)        ISSN: 1939-8425            Impact factor:   4.783


Background

The glabrous feature of rice is considered as a favorite agronomic trait for rice farmers because it has greater packing capability of rice grains and produces less dust that causes itching effect on farmers. Glabrous rice lacks trichomes on leaves and glumes (Khush, et al.2001). Most rice cultivars in America are glabrous and recognized as an important germplasm resource in breeding due to its high yield, good quality, and wide compatibility in crossing with other rice varieties (Guoet al.1999, Luo et al.2000). Trichomes are derived from aerial epidermal cells and serve various protective purposes such as insect herbivore resistance, freezing tolerance, and shade of UV irradiation (Ishida et al. 2008). There are two distinct types of trichomes developed on leaves of monocot plants. One is macrohairs on silica cells, the other is microhairs along the stomata cells (Khush, et al. 2001). So far, a number of glabrous mutants have been identified in many plant species, including Arabidopsis, tomato, cotton, and maize (Machado et al.2009, Moose et al.2004, Rerie et al.1994, Yang et al.2011). However, the molecular mechanism underlying trichome development has only been intensively investigated in Arabidopsis. In Arabidopsis, trichome development has been used as a model system to study the cell fate determination and shown to be regulated by a complex gene network (Ishida et al.2008). A homeodomain-leucine zipper protein GLABRA2 (GL2) and an R3 Myb protein TRIPTYCHON (TRY) play essential roles in trichome initiation and hairless cell differentiation (Rerie et al. 1994, Schellmann et al. 2002). The expression of GL2 and TRY are regulated by the WD-repeat/bHLH/MYB complex including TRANSPARENT TESTA GLABRA1 (TTG1), GLABRA3 (GL3)/ENHANCER OF GLABRA3 (EGL3) and GLABRA1 (GL1). Epidermal cells expressing the GL2 protein are able to differentiate into trichome cells. The TRY protein expressed in trichome cells, however, can move into neighboring cells and compete with GL1 for binding to GL3/EGL3 to repress the GL2 expression. The TRY mediated down regulation of the GL2 expression inhibits trichome formation in neighboring cells (Ishida, et al. 2008). Actually, factors able to modulate this gene network affect the trichome development. Previous studies on mutants defective in the biosynthesis and/or signaling of gibberellins, salicylic acid, jasmonic acid, and cytokinin have showed that phytohormones are involved in trichome initiation (Gan et al.2006, Gan et al.2007b, Perazza et al.1998, Traw and Bergelson 2003, Zhou et al.2011). It has been turned out that roles of these phytohormones in trichome development are mediated by their effect on the expression or activity of the components of the WD-repeat/bHLH/MYB complexes. Roles of gibberellins and cytokinins in trichome initiation are mainly dependent on C2H2 transcription factors including GIS1, GIS2, ZFP5 and ZFP8. These transcription factors are able to promote the GL1 expression (Gan et al.2007a, Maes et al.2008, Perazza, et al.1998, Zhou, et al.2011). In addition, JAZ proteins, the key components in the JA signaling pathway, have been shown to interact with bHLH transcription factors (GL3, EGL3 and TT8) and MYB transcription factors (MYB75 and GL1) (Qi et al.2011). The JA-induced destruction of JAZ proteins results in releasing the transcriptional function of the WD-repeat/bHLH/MYB complex and activating downstream events of trichome initiation. Furthermore, recent studies have shown that the microRNA156 targeted gene SPL9 could bypass the function of GL1 and directly binds to promoters of TCL1 and TRY to activate their expression (Yu et al.2010). In contrast to the sophisticated mechanisms revealed in Arabidopsis, little is known about the molecular mechanisms of trichome development in other plants. It has been noted that a couple of homeodomain-leucine zipper proteins, which are specifically expressed in epidermal cells, are essential in differentiation of epidermal cells. Outer Cell Layer 4 (OCL4), a maize HD-ZIP transcription factor, has been suggested to involve in the repression of macrohair differentiation (Vernoud, et al. 2009), and a HD-Zip protein in tomato, Woolly (Wo) that interacts with Cyclin B2, plays an essential role for trichome formation and embryonic development (Yang et al. 2011). In addition, another subfamily of the homeobox gene, known as WUS-like homeobox genes (WOX), may also play roles in division or differentiation of epidermal cells. Pressed Flower (PRS) is involved in activation of the proliferation of marginal cells. It has been observed that multicellular bulges with trichomes formed on stems and epidermal cells outgrow on sepals of 35S:PRS transgenic plants (Matsumoto and Okada 2001). Moreover, Narrow sheath 1 (NS1) and Narrow sheath 2 (NS2), which are duplicated relatives of PRS in maize, have been suggested to play a role in a lateral domain of shoot apical meristems (Nardmann et al.2004). In addition, OsWOX3 has been found to repress the expression of OsYAB3, which is required for cell differentiation during rice leaf development (Dai et al.2007). Previous study showed that macrohairs on the leaf blade are greatly reduced in the maize macrohairless 1 (mhl1) mutant (Moose, et al.2004). A major QTL controlling macrohairs in Teosinte has been found to locate near the maize gene MHL1 (Lauter et al.2004). In rice, previous genetic analysis has identified a couple of loci that control trichome development. For example, gl regulates glabrous leaf and hull traits, Hl and Hl were related to long hair development on rice leaves and Hg may be responsible for the extreme long hairs on auricles and glumes (Nagao et al.1960). However, no gene controlling these traits has been cloned in rice as yet. Recently, glabrous leaf and hull mutant (gl1) has been reported to locate within a 54-kb region at the short arm of chromosome 5 (Li et al.2010, Wang et al.2009, Yu et al.1995), but the gene has not been identified yet. Here, we report the identification and characterization of the Glabrous Rice 1 (GLR1), which controls the trichome development in rice. Our work extends an insight into the molecular mechanism of trichome development in rice. The identification and characterization of GLR1 will facilitate breeders to develop elite glabrous rice varieties via marker-assisted-selection and genetic modification approaches.

Results

Phenotype of the near isogenic line of glabrous rice

The glabrous variety Jia64 is derived from the American rice variety Rico No.1 and near isogenic lines (NIL) of glabrous rice developed by backcrossing Jia64 with a pubescent variety Jia33 for 5 generations. There are no obvious differences of the overall morphology between NIL and NIL plants (Figure 1a). However, the leaves of NIL plants are smooth whereas leaves of NIL plants are rough with many hairs. In contrast to glumes of the NIL plant (Figure 1b), the glumes of the NIL plant showed no trichome or only a few trichomes growing on margins of the hull (Figure 1c). On rice leaves, there are two types of trichomes, macrohairs and microhairs. Scan Electronic Microscope (SEM) analysis showed that both macrohairs and microhairs on the abaxial and adaxial sides of NIL leaves are able to be observed (Figure 1d and Figure 1e). However, neither macrohairs nor microhairs could be observed on both sides of NIL leaves (Figure 1f and Figure 1g).
Figure 1

Phenotypes of NILplant. (a) Mature plants of NIL (left) and NIL (right), Bar = 20 cm. (b, c) The grains of NIL (b) and NIL (c) Bars = 0.1 cm. (d to g) The SEM views of the adaxial (d) and abaxial (e) sides of the NIL leaves, and adaxial (f) and abaxial (g) sides of the NIL leaves . Arrow indicates the macrohair and arrowhead shows the microhair. Bars = 500 μm.

Phenotypes of NILplant. (a) Mature plants of NIL (left) and NIL (right), Bar = 20 cm. (b, c) The grains of NIL (b) and NIL (c) Bars = 0.1 cm. (d to g) The SEM views of the adaxial (d) and abaxial (e) sides of the NIL leaves, and adaxial (f) and abaxial (g) sides of the NIL leaves . Arrow indicates the macrohair and arrowhead shows the microhair. Bars = 500 μm.

Map-based cloning of GLR1

Previous genetic analysis has shown that the glabrous phenotype of America rice was controlled by a single recessive nuclear gene (Li et al.1993). To map the GLR1 locus, an F2 mapping population was generated from a cross between Jia64 and a polymorphic japonica variety Jia33. Linkage analysis of 44 F2 plants having the glabrous phenotype showed that the GLR1 locus located between the InDel marker M1 and the SSR marker M2 on chromosome 5 (Figure 2a and Table 1). This region is consistent with the previously mapped gl1 locus on the short arm of chomsome 5 (Li, et al. 2010, Wang, et al. 2009). To fine-map GLR1, 1,447 F2 glabrous plants were analyzed using 7 newly developed markers (Figure 2b and Table 1) and GLR1 was finally pin-pointed within an interval of 21-kb DNA fragment between the markers M6 and M7. Within this region, there are 2 predicted genes, LOC_Os05g02720 (Os05g0118600) and LOC_Os05g02730 (Os05g0118700) (Figure 2c). The former encodes a hypothetic protein and the latter encodes a homeobox-containing protein. Sequence analysis showed that LOC_Os05g02730 shares similarity to PRS in Arabidopsis, NS1 and NS2 in maize, and OsWOX3 in rice (Dai, et al.2007, Matsumoto and Okada 2001, Nardmann, et al.2004). There are a conserved homeodomain at the N terminal and a conserved WOX motif at the C terminal of these proteins (Figure 3). Phylogenic analysis indicated that LOC_Os05g02730 belongs to a small NS/WOX3 subgroup consisting of OsWOX3, PRS, NS1 and NS2 (Dai, et al.2007). We sequenced and compared the 21-kb DNA fragments between markers M6 and M7 from the NIL and NIL. There is no difference in this region between NIL and NIL plants. To understand which gene, LOC_Os05g02720 or LOC_Os05g02730, is responsible for the phenotype, we analyzed their expression levels by RT-PCR. Compare to NIL, the expression level of LOC_Os05g02720 decreased in the NIL plant (Figure 2d). However, the expression of LOC_Os05g02730 was dramatically reduced in the NIL plant (Figure 2d). The previous studies showed that the NS/WOX3 subgroup WOX genes are specifically expressed in the epidermal cells and play important roles in their differentiation (Dai, et al.2007, Ishida, et al.2008, Matsumoto and Okada 2001, Nardmann, et al.2004,Vernoud et al.2009). Therefore, LOC_Os05g02730 is most likely the candidate gene responsible for the rice glabrous phenotype.
Figure 2

Map-based cloning of . (a) The GLR1 locus was mapped in chromosome 5 between markers M1 and M2. Recombinants were identified from 1,447 F2 glabrous plants. (b) Fine mapping of the GLR1 locus. The GLR1 locus was narrowed to a 21-kb genomic DNA region between markers M6 and M7. (c) The LOC_Os05g02720 (green) and LOC_Os05g02730 (red) are predicted in the candidate region. The annotated gene of LOC_Os05g02730 consists of two exons and one intron. (d) The relative expression levels of LOC_Os05g02720, LOC_Os05g02730 and LOC_Os05g02754 in young panicles of NIL and NIL plants (T-test, P<0.05).

Table 1

Molecular markers developed in this study

PrimerPrimer sequence(5′-3′)Primer typesGenetic distance(cM)
M1ForwardTGGTTATTTGTTATTTTAGTTGGGTGInDell1.38
ReverseTAGACTAGAGTTGGAGACG
M2ForwardACGCACGCCATTACAAACSSR0.44
ReverseCAGGAGGTGGGCCTCATT
M3ForwardACGACCCACCAGCAGATAInDell9.43
ReverseAGGGACGTGAATGAAACT
M4ForwardGCCCTTGATCCGGTGCTCTInDell1.07
ReverseGTGTTAGATGCGTGTATT
M5ForwardGGGGAAGCTCATTGTCGGInDell0.10
ReverseCAGTGGTGGAGTCAAAAT
M6ForwardGTAGTAGTAGGAGCACAGCInDell0.07
ReverseCAATGCTGCATGGTGGTA
M7ForwardAACAAATCCTCCTGTTCCCAPS0.07
ReverseCGAGCTACTACTCCTGCT
M8ForwardATTGCTGGCACATTTTCTInDell0.07
ReverseCATTTTCTTCCTATCTAA
M9ForwardCTAAGCAAGCTGACGTGTAATInDell0.07
ReverseAACCAAATAGCACTTTCACA
M10ForwardTCTGTTTCGTTGGATTAGTInDell0.04
ReverseACGAGGCATTCTTGATGG
Figure 3

GLR1 is highly homologous to the WOX3 subgroup proteins. Alignment of rice GLR1, OsWOX3, Arabidopsis PRS, maize NS1 and NS2. Numbers at right refer to the positions of amino acid residues. The conserved homeodomain was indicated by the red box. The conserved WOX-box is indicated by blue box.

Map-based cloning of . (a) The GLR1 locus was mapped in chromosome 5 between markers M1 and M2. Recombinants were identified from 1,447 F2 glabrous plants. (b) Fine mapping of the GLR1 locus. The GLR1 locus was narrowed to a 21-kb genomic DNA region between markers M6 and M7. (c) The LOC_Os05g02720 (green) and LOC_Os05g02730 (red) are predicted in the candidate region. The annotated gene of LOC_Os05g02730 consists of two exons and one intron. (d) The relative expression levels of LOC_Os05g02720, LOC_Os05g02730 and LOC_Os05g02754 in young panicles of NIL and NIL plants (T-test, P<0.05). Molecular markers developed in this study GLR1 is highly homologous to the WOX3 subgroup proteins. Alignment of rice GLR1, OsWOX3, Arabidopsis PRS, maize NS1 and NS2. Numbers at right refer to the positions of amino acid residues. The conserved homeodomain was indicated by the red box. The conserved WOX-box is indicated by blue box.

Altering the expression levels of GLR1 could partially change the glabrous phenotype

To confirm LOC_Os05g02730 is the GLR1 gene, we generated transgenic plants in a pubescence japonica variety Nipponbare background by the RNA interference (RNAi) method (Figure 4a). SEM analysis showed that much fewer trichomes on leaves of the RNAi transgenic lines have been observed (Figure 4b), and a further statistical analysis showed that the macrohair number on the RNAi transgenic leaves was significantly decreased (Figure 4c). When constitutively express GLR1 in NIL, it can partially rescue glabrous phenotype of NIL of T0 transgenic plants (Figure 4 d-g). These results indicate that LOC_Os05g02730 is the gene responsible for the glabrous phenotype of the NIL plant.
Figure 4

Glabrous phenotypes of RNAi transgenic lines. (a, b) The SEM images of the abaxial leaf sides of Nipponbare (a) and GLR1 RNAi transgenic plants (b). (c) The macrohair number was significantly decreased in GLR1 RNAi transgenic plants compared with that in Nipponbare (T-test, P<0.05); (d-f) The SEM images of the abaxial leaf sides of NIL (d), NIL (e) and OE/NIL transgenic plants (f) ; (g) The relative expression levels of LOC_Os05g02730 in leaves of NIL, NIL and OE/NIL plants. Arrows indicate the macrohairs, bar = 1 mm.

Glabrous phenotypes of RNAi transgenic lines. (a, b) The SEM images of the abaxial leaf sides of Nipponbare (a) and GLR1 RNAi transgenic plants (b). (c) The macrohair number was significantly decreased in GLR1 RNAi transgenic plants compared with that in Nipponbare (T-test, P<0.05); (d-f) The SEM images of the abaxial leaf sides of NIL (d), NIL (e) and OE/NIL transgenic plants (f) ; (g) The relative expression levels of LOC_Os05g02730 in leaves of NIL, NIL and OE/NIL plants. Arrows indicate the macrohairs, bar = 1 mm.

DNA methylation may be involved in the expression of GLR1

The findings that no mutation was found in the GLR1-containing mapping region and that the expression of LOC_Os05g02730 was unable to be detected in the NIL plant strongly suggests that GLR1 may be regulated epigenetically through a DNA methylation mechanism. We therefore carried out a bisulfite sequencing experiment to examine whether DNA methylation are involved in the regulation of GLR1. As shown in Figure 5, the bisulfite sequencing of the 2.0-kb promoter region of GLR1 revealed some apparent methylation differences between NIL and NIL, suggesting that an epigenetic mechanism may involve in the regulation of the GLR1 expression.
Figure 5

Comparison of the DNA methylation between NILand NIL . DNA methylation levels (%) of the GLR1 and glr1 DNA sequences of the NIL (red) and NIL (blue) plants are analyzed. The numbers indicate the position in the 2-kb upstream region starting from the start codon.

Comparison of the DNA methylation between NILand NIL . DNA methylation levels (%) of the GLR1 and glr1 DNA sequences of the NIL (red) and NIL (blue) plants are analyzed. The numbers indicate the position in the 2-kb upstream region starting from the start codon.

Discussion

In Arabidopsis, trichomes have been served as an excellent model system to study plant cell differentiation (Ishida et al. 2008). Glabrous mutants that are defective in leaf hair or trichome have been identified in many plant species. However, genes controlling trichome development in rice have not been identified up to date yet. GL1 was previously mapped on the short arm of chromosome 5 (Li, et al. 2010, Wang et al. 2009, Yu et al. 1995) and it was proposed that a single nucleotide mutation (A to T) in the 5’UTR of LOC_Os05g02754 (Os05g0118900), which encode an unknown protein, might be responsible for the gl1 trait (Li, et al. 2010). Our mapping data suggested that glr1 may be allelic to gl1. We compared the sequences of 5’UTR of LOC_Os05g02754 (Os05g0118900) of NIL and NIL and found that the indicated position of 5’ UTR of LOC_Os05g02754 (Os05g0118900) in the NIL plant is A and that in the NIL plant is T. However, our data indicate that instead of LOC_Os05g02754 (Os05g0118900) LOC_Os05g02730 (Os05g0118700), which encode a WUS-like homeodomain protein, controls the glabrous phenotype. First, the mapping data has pinpointed the GLR1 locus within a 21-kb region that contains only two predicted genes, LOC_Os05g02720 (Os05g0118600) and LOC_Os05g02730 (Os05g0118700). Second, comparison of the gene expression levels of LOC_Os05g02720 and LOC_Os05g02730 between NIL and NIL plants showed that LOC_Os05g02730 is dramatically increased in the NIL plant, however, change of LOC_Os05g02720 in the NIL plant is not very significant. In contrast, no difference of expression levels of LOC_Os05g02754 has been detected between NIL and NIL plants (Figure 2d). Third, an apparent decrease in the trichome number on leaves and glumes of GLR1 RNAi transgenic plants have been obtained. Overexpression of GLR1 in NIL partially rescues glabrous phenotype of the NIL plant. Fourth, the sequence alignment showed that GLR1 has high similarity to previously identified homeodomain proteins, whose functions are essential for the differentiation of epidermal cells (Dai, et al. 2007, Matsumoto and Okada 2001, Nardmann, et al. 2004). Taken all these together, we strongly suggest that the WUS-like homeodomain protein encoded by LOC_Os05g02730 is the GLR1 gene and is essential for the trichome development in rice. The RNAi of GLR1 reduced the trichome number in transgenic lines, while the trichome is almost completely lost in NIL. This discrepancy could result from the different genetic background of plant materials or from incomplete suppression of the target gene in transgenic plants. Alternatively, the expression LOC_Os05g02720 is also decreased in the NIL plant, which implies that LOC_Os05g02720 may be also involve in trichome development, thus knockdown of LOC_Os05g02730 alone cannot completely suppress the trichome development. Further knockdown LOC_Os05g02720 along or knockdown it together with LOC_Os05g02730 will clarify the role of LOC_Os05g02720. Chromatin state controls gene expression and plays critical roles in development. In plant, trimethylated K9 of histone H3 (H3K9me3) indicates an open chromatin state, while monomethylated and dimethylated H3K9s (H3K9me1 and H3K9me2) indicate a closed state (Liu et al. 2010). The identification of GL2 EXPRESSION MODULATOR (GEM) indicates that the regulation of GL2 expression is more complicated than previously expected (Caro, et al. 2007). Trichome density increased in gem-1 mutant whereas decreased in GEM-overexpressing plants. Consistent with the phenotype, the GL2 expression has been observed to increase in gem-1 whereas decrease in GEM-overexpressing plants (Caro, et al. 2007). It has been observed that H3K9me3 increases and H3K9me2 decreases in the GL2 promoter in the gem-1 background, but H3K9me3 decreases and H3K9me2 increases in GEM-overexpressing plants (Caro, et al. 2007). This kind of epigenetic control may also be involved in rice trichome development. Rice SET Domain Group Protein 714 (SDG714) functions as a histone H3K9 methyltransferase, which is involved in histone H3K9 methylation, DNA methylation and genome stability (Ding et al. 2007). Loss of macrohairs but not microhairs on leaves of the SDG714 RNAi transgenic plants indicated that regulation of chromatin status of some unidentified regulators may play an important role in the trichome development in rice (Ding et al.2007). In agreeable to these findings, the genomic bisulfite sequencing of GLR1 showed that the DNA methylation pattern at several sites of the GLR1 promoter region in the NIL plants is different from that in the NIL plants, though no sequence difference of GLR1 was found between the NIL and NIL plants. These results indicated that the epigenetic mechanism may be involved in the regulation of the GLR1 expression and the trichome development in rice. Although, different patterns of the DNA methylation in upstream region of LOC_Os05g02730 (Os05g0118700) between NIL and NIL has been observed, we are unable to determine which sites are responsible for suppression of LOC_Os05g02730. Moreover, the GLR1 expression driven by a constitutive promoter dramatically increased the expression of GLR1, but cannot completely rescue the glabrous phenotype in T0 transgenic plants (Figure 4 d-g). It indicates that the regulation of the GLR1 expression and the trichome development in rice is more complicate than expected. Further investigation is needed to uncover the molecular mechanism of GLR1 expression regulation. Glabrous rice varieties are widely cultivated in America and Africa, while most varieties cultivated in Asia are pubescent (Khush, et al.2001). In higher plants, although trichomes are thought to be important for plant defense against biotic and abiotic stresses, glabrous trait may be a selectively neutral trait in rice. Previous studies have indicated that the introduction of glabrous trait into japonica varieties may not cause any obvious disadvantages in plant defense (Li et al.2011). In agriculture, the interest of breeding glabrous elite rice varieties is mainly due to its practical advantages of greater packing capability and less itching effect during the harvest process. The cloning of GLR1 will not only help to understand the molecular mechanism of trichome development in rice but also improve the efficiency of breeding glabrous elite rice varieties by marker-assisted selection and genetic modification approaches.

Conclusions

GLR1 plays an important role in rice trichome development and will contribute to breeding of glabrous elite rice varieties

Methods

Plant materials

Jia64 is a glabrous variety derived from American rice variety Rico No.1 and Jia33 is a pubescent variety in southeast China. Rice plants were cultivated in the experimental field of Jiaxing Academy of Agricultural Science in growing seasons from May to October.

Scanning electron microscopy

Samples were prepared as described previously (Li et al.2009). Briefly, samples were fixed with 2.5% (v/v) glutaraldehyde in 0.1 M sodium phosphate buffer (PBS, pH 7.2) at 4°C overnight. After being rinsed with 0.1 M PBS twice, samples were post-fixed in 1% (w/v) osmium tetroxide for 2 h at 4°C. Samples were rinsed with the same buffer for 2 more times and then dehydrated in a graded series of ethanol. For scanning electron microscopy, samples were critical-point dried (Hitachi HCP-2) and observed under a scanning electron microscope (Hitachi S-3000N).

Genetic mapping of GLR1

An F2 mapping population was generated from a cross between Jia64 and Jia33. 24 molecular markers were used for genetic linkage analysis of 44 F2 plants that show the glabrous phenotype. To fine-map GLR1, new PCR-based markers were developed and 1,447 F2 glabrous plants were analyzed using markers as given in Table 1. The GLR1 locus was further narrowed within an interval of 21-kb DNA fragment between the M6 and M7 markers. To sequence the GLR1 locus, the entire genomic region was amplified from NIL and NIL by PCR with LA-Taq (TaKaRa).

RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was isolated from rice plants by Trizol extraction method (Invitrogen Life Technologies). To conduct RT-PCR analyses, cDNA strands are synthesized by the SuperScript III RT kit (Invitrogen Life Technologies). Real-time PCR analysis were performed using the SYBR Green RT-PCR kit (Biorad). Primers RT1-F and RT1-R were used to amplify LOC_Os05g02720, RT2-F and RT2-R to LOC_Os05g02730 and primers RT3-F and RT3-R to LOC_Os05g02754 (Table 2).
Table 2

Primers for RT-PCR and RNAi construct

PrimerPrimer sequence (5′-3′)
RT1-FGGCAAGGCATCAGTTAGTG
RT1-RGCCAGAGGTTCCTTCCAA
RT2-FGCCGCAGCAGCAGCAGCAGCAGCTTACA
RT2-RTCCACTAGCTTCCCCAGCGAGTAGTCCG
RT3-FGTCCTCCCTCAGCTTCTTCATCGTCA
RT3-RGAAGCACATCGCCGCCGTCTCC
RNAi1-1fACGGATCCTTAATCATTGCTTAATCGATCA
RNAi1-1rGAGGTACCCGTCATGCTGCTCTTCCT
RNAi1-2fGGAGCTCTTAATCATTGCTTAATCGATCA
RNAi1-2rGCACTAGTCGTCATGCTGCTCTTCCT
Primers for RT-PCR and RNAi construct

Plasmid construction and rice transformation

To generate the RNAi construct, two DNA fragments RNAi 1-1 and RNAi 1-2 were amplified respectively by primers RNAi 1-1f and RNAi1-1r, RNAi1-2f and RNAi1-2r (Table 2). The construct 1460-RNAi 1-1 was generated by digesting the RNAi 1-1 fragment with Bam H I and Kpn I and ligated to the binary vector 1460 by T4 DNA ligases. The hairpin cassette was generated by digesting the RNAi 1-2 fragment with Sac I and Spe I and ligated in reversed direction of fragment RNAi 1-1 to construct 1460-RNAi 1-1. For construction of the overexpression cassette, the coding region of GLR1 was amplified and liagated to the 1460 vector by BamH I and Spe I. The constructs were confirmed by sequencing and introduced into Agrobacterium tumefaciens strain EHA105 by electroporation. The rice (Nipponbare) transformation was performed as described previously (Hiei et al.1994). For RNAi transgenic plants, T2 lines derived from individual transgenic lines were used for further analysis. T2 Lines RNAi 4-8-7, RNAi 4-8-11 and RNAi 4-8-17 were derived from line RNAi 4-8. T2 Lines RNAi 4-9-4 and RNAi 4-9-11 were derived from line RNAi 4-9. For overexpression transgenic plants, T0 plants were used for analysis.

Bisulfite sequencing

Genomic DNA extracted by the CTAB method and 1.0 μg DNA was bisulfite treated using the Bisulfite kit (Qiagen 59104). The candidate 2-kb upstream of the coding region of LOC_Os05g02730 was amplified using listed bisulfite primers (Table 3). The PCR products were cloned into the pGEM-T easy vector (Promega) for sequencing.
Table 3

Primers for Bisulfite sequencing

PrimerPrimer sequence(5′-3′)
ME-3FAGAGTTTGTTATGGGTGTAATGTTTGTTTA
MEQ-3FGATTTGTTATTATAGGTATTATAAAGAGA
ME-3RTTACATCTCATAAAAATATTTTATTAACT
MEQ-3RTAAAAAACAAACACCTATCCCTATCCTAC
ME-4FTTTTTGAGAATTATTAGATTTTTTTATGGT
MEQ-4FTTGTTTTTTTATTAATTATTTTATTAAT
ME-4RAATACTAATAAACAATACATCAATCCTCTT
MEQ-4RCCACAATAAAACATAAAAATCACAAAACTA
ME-5FAATATAATGGATTATTTGGTGGATTAGTTT
MEQ-5FGGTAATTTTTTTTTTTTATTTTTAGTGTTA
ME-5RACATAACACACTAAAACAAAAAATTCATA
MEQ-5RCTTTTACATCATCACTATATAATAACAATT
ME-6FGGTTATTTTGGATTATGTTAATATGTTAGG
MEQ-6FTTTAAGTTGGTAGTTTTTTTTGGTTTTTAG
ME-7FATATTATATTAGATGTGGGAGTATTAATT
MEQ-7FAGGTTATTTTGGATTATGTTAATATGTTAG
ME-7RATATAACTATTATTTAATTAATACCTAACT
MEQ-7RTAAATATAATTACTTCCAATCAATTAAA
ME-8FTTGAATAAAATATGTAGTAATATGTTTATT
MEQ-8FTTTGTATATTTTGGGGTGGTAATTTTATT
ME-8RATCAACCCCACCACCACCACCCCCATCAA
MEQ-8RTCCACCACCACCACCACTCTACTACTACTA
ME-9FATATAAGAAAATTTAGTTATTTAGGTAG
MEQ-9FATAGGAGGAGGGATATATGGTGTTGGTGGT
ME-9RAAAAATAATAAAAAATACAAAAACAACAA
MEQ-9RCAAAACTTCTAACAATCACAAACCTTATA
Primers for Bisulfite sequencing
  27 in total

1.  SDG714, a histone H3K9 methyltransferase, is involved in Tos17 DNA methylation and transposition in rice.

Authors:  Yong Ding; Xia Wang; Lei Su; Jixian Zhai; Shouyun Cao; Dongfen Zhang; Chunyan Liu; Yuping Bi; Qian Qian; Zhukuan Cheng; Chengcai Chu; Xiaofeng Cao
Journal:  Plant Cell       Date:  2007-01-26       Impact factor: 11.277

Review 2.  A genetic regulatory network in the development of trichomes and root hairs.

Authors:  Tetsuya Ishida; Tetsuya Kurata; Kiyotaka Okada; Takuji Wada
Journal:  Annu Rev Plant Biol       Date:  2008       Impact factor: 26.379

3.  The MYB transcription factor GhMYB25 regulates early fibre and trichome development.

Authors:  Adriane Machado; Yingru Wu; Youming Yang; Danny J Llewellyn; Elizabeth S Dennis
Journal:  Plant J       Date:  2009-02-26       Impact factor: 6.417

4.  A homeobox gene, PRESSED FLOWER, regulates lateral axis-dependent development of Arabidopsis flowers.

Authors:  N Matsumoto; K Okada
Journal:  Genes Dev       Date:  2001-12-15       Impact factor: 11.361

Review 5.  Histone methylation in higher plants.

Authors:  Chunyan Liu; Falong Lu; Xia Cui; Xiaofeng Cao
Journal:  Annu Rev Plant Biol       Date:  2010       Impact factor: 26.379

6.  Temporal control of trichome distribution by microRNA156-targeted SPL genes in Arabidopsis thaliana.

Authors:  Nan Yu; Wen-Juan Cai; Shucai Wang; Chun-Min Shan; Ling-Jian Wang; Xiao-Ya Chen
Journal:  Plant Cell       Date:  2010-07-09       Impact factor: 11.277

7.  Zinc finger protein5 is required for the control of trichome initiation by acting upstream of zinc finger protein8 in Arabidopsis.

Authors:  Zhongjing Zhou; Lijun An; Lili Sun; Shuijin Zhu; Wanyan Xi; Pierre Broun; Hao Yu; Yinbo Gan
Journal:  Plant Physiol       Date:  2011-07-29       Impact factor: 8.340

8.  Interactive effects of jasmonic acid, salicylic acid, and gibberellin on induction of trichomes in Arabidopsis.

Authors:  M Brian Traw; Joy Bergelson
Journal:  Plant Physiol       Date:  2003-10-09       Impact factor: 8.340

9.  The GLABRA2 gene encodes a homeo domain protein required for normal trichome development in Arabidopsis.

Authors:  W G Rerie; K A Feldmann; M D Marks
Journal:  Genes Dev       Date:  1994-06-15       Impact factor: 11.361

10.  Genetic and molecular regulation by DELLA proteins of trichome development in Arabidopsis.

Authors:  Yinbo Gan; Hao Yu; Jinrong Peng; Pierre Broun
Journal:  Plant Physiol       Date:  2007-08-17       Impact factor: 8.340

View more
  13 in total

Review 1.  Quantitative trait loci from identification to exploitation for crop improvement.

Authors:  Jitendra Kumar; Debjyoti Sen Gupta; Sunanda Gupta; Sonali Dubey; Priyanka Gupta; Shiv Kumar
Journal:  Plant Cell Rep       Date:  2017-03-28       Impact factor: 4.570

2.  A Core Regulatory Pathway Controlling Rice Tiller Angle Mediated by the LAZY1-Dependent Asymmetric Distribution of Auxin.

Authors:  Ning Zhang; Hong Yu; Hao Yu; Yueyue Cai; Linzhou Huang; Cao Xu; Guosheng Xiong; Xiangbing Meng; Jiyao Wang; Haofeng Chen; Guifu Liu; Yanhui Jing; Yundong Yuan; Yan Liang; Shujia Li; Steven M Smith; Jiayang Li; Yonghong Wang
Journal:  Plant Cell       Date:  2018-06-18       Impact factor: 11.277

3.  Genome-Wide Identification and Comparative Analysis of WOX Genes in Four Euphorbiaceae Species and Their Expression Patterns in Jatropha curcas.

Authors:  Zhanjun Wang; Qianwen Cai; Haimeng Xia; Bingqing Han; Minhui Li; Yue Wang; Minhui Zhu; Chunyan Jiao; Dandan Wang; Junjie Zhu; Wenya Yuan; Di Zhu; Congcong Xu; Hongyan Wang; Minghui Zhou; Xie Zhang; Jisen Shi; Jinhui Chen
Journal:  Front Genet       Date:  2022-06-30       Impact factor: 4.772

Review 4.  Molecular Mechanisms of Plant Trichome Development.

Authors:  Guoliang Han; Yuxia Li; Zongran Yang; Chengfeng Wang; Yuanyuan Zhang; Baoshan Wang
Journal:  Front Plant Sci       Date:  2022-06-01       Impact factor: 6.627

5.  Reverse genetic approaches for breeding nutrient-rich and climate-resilient cereal and food legume crops.

Authors:  Jitendra Kumar; Ajay Kumar; Debjyoti Sen Gupta; Sachin Kumar; Ron M DePauw
Journal:  Heredity (Edinb)       Date:  2022-03-05       Impact factor: 3.832

6.  Ectopic expression of R3 MYB transcription factor gene OsTCL1 in Arabidopsis, but not rice, affects trichome and root hair formation.

Authors:  Kaijie Zheng; Hainan Tian; Qingnan Hu; Hongyan Guo; Li Yang; Ling Cai; Xutong Wang; Bao Liu; Shucai Wang
Journal:  Sci Rep       Date:  2016-01-13       Impact factor: 4.379

7.  An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana.

Authors:  Florian Hahn; Otho Mantegazza; André Greiner; Peter Hegemann; Marion Eisenhut; Andreas P M Weber
Journal:  Front Plant Sci       Date:  2017-01-24       Impact factor: 5.753

8.  A hairy-leaf gene, BLANKET LEAF, of wild Oryza nivara increases photosynthetic water use efficiency in rice.

Authors:  Norimitsu Hamaoka; Hideshi Yasui; Yoshiyuki Yamagata; Yoko Inoue; Naruto Furuya; Takuya Araki; Osamu Ueno; Atsushi Yoshimura
Journal:  Rice (N Y)       Date:  2017-05-12       Impact factor: 4.783

9.  Comparative transcriptomic and metabolic analysis of wild and domesticated wheat genotypes reveals differences in chemical and physical defense responses against aphids.

Authors:  Zhaniya S Batyrshina; Beery Yaakov; Reut Shavit; Anuradha Singh; Vered Tzin
Journal:  BMC Plant Biol       Date:  2020-01-13       Impact factor: 4.215

10.  Homologs of SCAR/WAVE complex components are required for epidermal cell morphogenesis in rice.

Authors:  Wenqi Zhou; Yuchuan Wang; Zhongliang Wu; Liang Luo; Ping Liu; Longfeng Yan; Suiwen Hou
Journal:  J Exp Bot       Date:  2016-06-01       Impact factor: 6.992

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.