| Literature DB >> 24192396 |
Ana Paula dos Santos, Juliana Gabriel Ribeiro Andrade, Cristiane Santos Cruz Piveta, Juliana de Paulo, Gil Guerra, Maricilda Palandi de Mello, Andréa Trevas Maciel-Guerra1.
Abstract
BACKGROUND: Partial and mixed gonadal dysgenesis (PGD and MGD) are characterized by genital ambiguity and the finding of either a streak gonad and a dysgenetic testis or two dysgenetic testes. The karyotype in PGD is 46,XY, whereas a 45,X/46,XY mosaicism or its variants (more than two lineages and/or structural abnormalities of the Y chromosome) is generally found in MGD. Such mosaics are also compatible with female phenotype and Turner syndrome, ovotesticular disorder of sex development, and infertility in men with normal external genitalia. During the last few years, evidences of a linkage between Y microdeletions and 45,X mosaicism have been reported. There are also indications that the instability caused by such deletions might be more significant in germ cells. The aim of this work was to investigate the presence of Y chromosome microdeletions in individuals with PGD and in those with 45,X/46,XY mosaicism or its variants and variable phenotypes.Entities:
Mesh:
Year: 2013 PMID: 24192396 PMCID: PMC3827999 DOI: 10.1186/1471-2350-14-115
Source DB: PubMed Journal: BMC Med Genet ISSN: 1471-2350 Impact factor: 2.103
Clinical data from 15 patients with 46,XY partial gonadal dysgenesis
| 1 | M | 14 | 0.5 | PS | - | LS, DT | LS, S |
| 2 | M | 20 | 8 | SCR | - | LS, DT | LS, DT |
| 3 | F | 4 | 2.5 | Normal male | - | AB, DT | I, DT |
| 4 | F | 16 | 0.2 | SCR | - | AB, DT | AB, S |
| M | 9 | 0.7 | Norrnal male | - | I,NB1 | I, NB1 | |
| 6 | M | 25 | 4 | SCR | - | LS, DT | LS, DT |
| 7 | F | 19 | 204 | SCR | - | AB, DT | AB, DT |
| 8 | M | 15 | 8 | Normal male | - | AB, S | AB, DT |
| 9 | M | 23 | 1.7 | PS | - | LS, NB | I, DT |
| 10 | M | 2.5 | PS | - | LS, T | AB, S | |
| 11 | M | 17 | 6 | PS | - | I, S | I, DT |
| 12 | M | 4 | 6 | SCR | - | LS, T | AB, DT |
| 13 | M | 12 | 144 | PS | - | LS, DT | LS, DT |
- absent, + present, AB abdominal, DT dysgenetic testis, F female, I inguinal, LS labioscrotal, M male, NB not biopsied, PER perineal, PS penoscrotal, S streak, SCR scrotal, T testis.
1High FSH levels in the first months of life and infancy.
Clinical data from 15 patients with 45,X/46,XY mosaicism or its variants
| 1 | 45,X/46,XY | - | - | MGD | F | 5 | 1 | SCR | - | I, DT | I, DT |
| 2 | 45,X/46,XY | - | - | MGD | F | 23 | 4 | PER | + | LS, T | AB, S |
| 3 | 45,X/46,XY | - | - | MGD | F | 20 | 3 | SCR | - | I, T | I, S |
| 4 | 45,X/46,XY | - | - | MGD | M | 10 | 21 | PEN | - | LS, T | AB, S |
| 5 | 45,X/46,X,idic(Y)(p11.2) | 45,X.ish(DXZ1+, DYZ3-)/46,X,idic(Y).ish idic(Y)(p11.2) (DXZI+, DYZ3++) | - | MGD ? OT DSD? | M | 1.5 | 18 | PS | - | LS, NB | LS, NB |
| 6 | 45,X/46,X,del(Y)(q12) | - | - | MGD | M | 19 | 180 | SCR or PS1 | - | LS, DT | AB, S |
| 7 | 45,X/46,XY | - | - | MGD | M | 1.75 | 20 | normal male | - | AB, NB2 | AB,NB2 |
| 8 | 45,X/46,XY | - | - | MGD | M | 7 | 45 | SCR | - | AB, S | LS, T |
| 9 | 45,X/46,XY | - | - | TS | F | 6.5 | 75 | normal female | + | AB, S | AB, S |
| 10 | 45,X/46,X,+mar | 45,X.ish(DXZ1+,DYZ3-)/46,X,+mar.ish der (Y) | Y + 3 | MGD | F | 5 | PS | - | LS, T | AB, S | |
| (DXZ1+, DYZ3+) | | | | | | | | | | ||
| 11 | 45,X/46,XY | - | - | MGD | M | 3 | 1.5 | PS | - | I, S | LS, T |
| 12 | 45,X/46,XY | - | - | OTDSD | M | 0.2 | 0.1 | SCR | - | LS, T | AB, O |
| 13 | 45,X/46,X,+mar | 45,X.ish(DXZ1+,DYZ3-)/46,X,+mar.ish der(Y) | Y + 3 | MGD | M | 17 | 192 | SCR | - | LS,NB2 | AB, S |
| (DXZ1+, DYZ3+) | | | | | | | | | | ||
| 14 | 45,X/46,X,idic(Y)(p11.2)/47,X,idic(Y)(p11.2),idic(Y)(p11.2) | 45,X.ish(DXZ1+, DYZ3-)/46,X,idic(Y).ish idic(Y)(p11.2) (DXZ1+,DYZ3++)/ | | MGD | F | 1.5 | 0.33 | PS | | LS, T | AB, S |
| 47,X,idic(Y),idic(Y).ish idic(Y)(p11.2)(DXZ1+, DYZ3++), idic(Y)(p11.2)(DXZ1+,DYZ3++) | | | | | | | | | | ||
| 15 | 45,X/46,X,+mar1/46,X,+mar2/ 47,X,+2mar1/47,X,+mar1,+mar2 | 45,X.ish(DXZ1+,DYZ3-)/46,X,+mar1.ish dic der(Y) | Y + 3 | MGD | F | 0.2 | 1 | SCR | - | LS, T | I, S |
| (DXZ1+, DYZ3++)/ | | | | | | | | | | ||
| 46,X,+mar2.ish der(Y) | | | | | | | | | | ||
| (DXZ1+, DYZ3+)/ | | | | | | | | | |||
| | | 47,X,+mar1. ish dic der(Y) | | | | | | | | | |
| (DXZ1+, DYZ3++),+mar2.ish der(Y)(DYZ3x1) |
AB abdominal, del deletion, DT dysgenetic testis, F female, i isochromosome, I inguinal, M male, mar marker, MGD mixed gonadal dysgenesis, NB not biopsied, O ovary, OT DSD ovotesticular disorder of sex development, PEN penile, PER perineal, PS penoscrotal, S streak, SCR scrotal, LS labioscrotal, T testis, TS Turner syndrome. 1surgery performed before the first visit; 2normal testicular macroscopic appearence on surgery; 3positive Y chromosome sequences.
Order and location of STS along the Y chromosome, sequence of the primers used and expected size of the amplified product
| sY14 | SRY | 2715341-2715810 | p11.31 | GAATATTCCCGCTCTCCGGA | GCTGGTGCTCCATTCTTGAG | 472 |
| sY1301 | BV703591 | 2881785-2882279 | p11.31 | GTCTTGTTGCAGCCCATGT | CAAAGGGAGAATAGCAGGC | 495 |
| Amely-3 | BV678972 | 6737830-6738427 | p11.2 | GGTGGGAGAAGGATGTTGTT | AGTCAATCCGAATGGTCAGG | 598 |
| sY3218 | BV704083 | 7234129-7234319 | p11.2 | CTTTTTCGTTGGAGTCTCGC | GCAAAACCCCGTCTCTACAA | 191 |
| sY1059 | G66106 | 7561835 – 7562133 | q11.223 | GATCATTCTCAAGGGGCTCA | TTGTTGTTGTTGTCATTGTGG | 299 |
| TSPY | NG022996 | 9236076-9307357 | p11.2 | CGATAGGCCTCCACTTCATA | GATGACATAATGGCGGAG | 1300 |
| DYZ3 | - | - | Centromérica | ACACATCACAAAGAACTATG | TGAAAACTACACAGNAAGCTG | 1100 |
| sY81 | DYS271 | 12606410-12606618 | q11.1 | AGGCACTGGTCAGAATGAAG | AATGGAAAATACAGCTCCCC | 209 |
| sY82 | DYS272 | 12838080-12838343 | q11.1 | ATCCTGCCCTTCTGAATCTC | CAGTGTCCACTGATGGATGA | 264 |
| Y6HP35pr | DYS274 | ND | - | GGTACACACTCCATCCTGGAC | CTACAGGCTACCTTTTAGGTGG | 226 |
| sY86 | DYS148 | 13117503-13117820 | q11.1 | GTGACACACAGACTATGCTTC | ACACACAGAGCGACAACCCT | 320 |
| sY84 | DYS273 | 13299428-13299753 | q11.1 | AGAAGGGTCTGAAAGCAGGT | GCCTACTACCTGGAGGCTTC | 326 |
| sY609 | G65840 | 13488371-13488514 | q11.21 | CATAGCCCAGAGCAATCCAT | TAGGCATAGGAAGTGGCTGG | 144 |
| sY88 | DYS276 | 14113358-14113480 | q11.21 | TTGTAATCCAAATACATGGGC | CACCCAGCCATTTGTTTTAC | 123 |
| sY94 | DYS279 | 14790821-14790970 | q11.21 | TCATGACAGCCAGGGTATTT | TTTGGACATAGTTTTTTGGTCC | 150 |
| sY95 | DYS280 | 15053332-15053634 | q11.21 | TCCTACAGATGTCCAAAGTGC | GATGAGTGACCCCAGAATTG | 303 |
| sY182 | KAL-Y | 15980790-15980914 | q11.221 | TCAGAAGTGAAACCCTGTATG | GCATGTGACTCAAAGTATAAGC | 125 |
| sY97 | DYS281 | 16263633-16263736 | q11.221 | AACTTCATCAGTGTTACATCAAGG | TGTGGCATTTTGTTATGTGG | 104 |
| sY151 | KAL-Y | 16020619-16020801 | q11.221 | AAATCTGTAGTCTCATATCAATCTG | TTACTTGATTTAGCAATAAAAAGG | 183 |
| sY102 | DYS198 | 17080238-17080455 | q11.221 | CACTACCACATTTCTGGTTGG | CGCTGAGTCCATTCTTTGAG | 218 |
| sY105 | DYS201 | 17866681-17866981 | q11.221 | AAGGGCTTCTTCTCTTGCTT | AGGGAGCTTAAACTCACCGT | 301 |
| Y6D14pr | DYS205 | ND | - | GGCTAGGTGCCAGCAAGTAGATCA | GTTCTCTTCCCCTGCATCAAG | 134 |
| sY117 | DS209 | 19171254-19171515 | q11.221 | GTTGGTTCCATGCTCCATAC | CAGGGAGAGAGCCTTTTACC | 262 |
| Y6PHc54pr | ND | ND | - | GCAGAAGAGTTCAGC | GTGGAGTGCTGCATTAAAGG | 166 |
| sY1287 | G75509 | 19491288-19491607 | q11.221 | GCAACATAGATGGACCCAGAA | ATAGCAAAGAGCCTCCCAGA | 320 |
| sY1752 | BV682283 | 20229909-20230117 | q11.222 | TCAGTGTGTCACCAAGCAGG | GAGGCAAGTGGACCATCTGT | 209 |
| sY127 | DYS218 | 20979804-20980078 | q11.222 | GGCTCACAAACGAAAAGAAA | CTGCAGGCAGTAATAAGGGA | 274 |
| sY134 | DYS224 | 21965448-21965750 | q11.222 | GTCTGCCTCACCATAAAACG | ACCACTGCCAAAACTTTCAAA | 301 |
| sY143 | DYS231 | 22387291-22387601 | q11.223 | GCAGGATGAGAAGCAGGTAG | CCGTGTGCTGGAGACTAATC | 311 |
| sY1059 | G66106 | 22822646-22822944; 23252550-23252848 | q11.223 | GATCATTCTCAAGGGGCTCA | TTGTTGTTGTTGTCATTGTGG | 299 |
| sY149 | DYS1 | 23725053-23725184 | q11.223 | TGTCACACTGCCCTAATCCT | TGGTCATGACAAAAGACGAA | 132 |
| sY147 | DYS232 | 23882766-23882865 | q11.223 | TTTCTCGTTTGATGATCCTAG | TTAATATGAGAATGAGAACAGATGT | 100 |
| Fr15-Hpr | ND | ND | - | TACCTTGGTTTTGCACCAGACGC | CACCCTCTGTATATGACCTGGC | 313 |
| Y6HP52pr | DYS239 | ND | - | GGAACTGGCAGGATTAGCTTC | GCTCAGAATCTGCGATCAG | 258 |
| sY1059 | G66106 | 24054410-24054708 | q11.223 | GATCATTCTCAAGGGGCTCA | TTGTTGTTGTTGTCATTGTGG | 299 |
| sY157 | DYS240 | 24284845-24285134 | q11.223 | CTTAGGAAAAAGTGAAGCCG | CCTGCTGTCAGCAAGATACA | 285 |
| sY1191 | G73809 | 24875620-24876004 | q11.23 | CCAGACGTTCTACCCTTTCG | GAGCCGAGATCCAGTTACCA | 385 |
| sY1059 | G66106 | 26726968-26727266 | q11.223 | GATCATTCTCAAGGGGCTCA | TTGTTGTTGTTGTCATTGTGG | 299 |
| sY3168 | BV704033 | 28761338-28761820 | q11.23 | GCACCACTGTACTGAAGCATG | TCCCAGCTCACATTGATGATTA | 483 |
*Bp basepairs.
Figure 1Agarose gel stained with ethidium bromide showing the PCR fragments of MIX 7 and 4. A – Five STS were amplification in all patients of DGP group. M – Molecular weight marker (Ladder 1Kb); B – Blank; Individuals: 2, 3, 4, 5, 6, 9, 7, 8, 13 e 12 (Table 1) e 4* (Table 2); ♀ – Female control; ♂ - Male control. B – Absent amplification of STS sY149 for individuals 10 and 6, and no amplification of STS sY127 for individual 6. M – Molecular weight marker (Ladder 1Kb); B - Blank; Individuals 5*, 10*, 12* (Table 1) and individuals 10, 1, 9, 3, 6, 2, 5 (Table 2); ♀ – Female control; ♂ - Male control.
Figure 2Schematic description of microdeletions found in six individuals in the MOS group. The figure shows the location of identified deletions for each patient and the position of each deletion in relation to the AZFa, AZFb and AZFc regions. = Fragment present. = Fragment absent.