| Literature DB >> 24177569 |
Tilin Yi1, Jian Sun, Xufang Liang, Shan He, Ling Li, Zhengyong Wen, Dan Shen.
Abstract
Mandarin fish (Siniperca chuatsi) have a peculiar feeding habit of only accepting live fish prey and refusing dead prey and artificial diets. However, previous research has shown that some individuals accept dead prey after gradual domestication. Digestive enzymes are correlated with feeding habits in fish. In the current study, SNPs in the mandarin fish genes for pepsinogen (PEP), amylase (AMY), and trypsin (TRY) were evaluated for associations with feeding habits in domesticated mandarin fish by scanning their complete genomic sequence. In total, two SNPs were found in PEP, one was found in TRY, and none were found in AMY. The D1(CTCC) and D5(TTTT) diplotypes in the PEP gene tended to show strong effects on the feeding habits of domesticated fish (p < 0.01). The results indicate that PEP may be associated with the genetic mechanism for feeding habits in mandarin fish, and the D1(CTCC) and D5(TTTT) diplotypes in the PEP gene may be useful markers for selecting mandarin fish with appropriate feeding habits for domestication.Entities:
Mesh:
Substances:
Year: 2013 PMID: 24177569 PMCID: PMC3856018 DOI: 10.3390/ijms141121504
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Genotype frequencies and genetic diversity parameter at each Single nucleotide polymorphisms (SNPs) located in the pepsinogen (PEP) and trypsin (TRY) gene.
|
| |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Groups | Sample size | Genotype frequencies | Allelic frequencies | HWE | PIC | He | |||
|
|
| ||||||||
| CC | CT | TT | C | T | |||||
| Feeders | 120 | 0.0000(0) | 0.2167(26) | 0.7833(94) | 0.1083 | 0.8917 | 0.1745 | 0.1940 | |
| Nonfeeders | 120 | 0.0000(0) | 0.2917(35) | 0.7083(85) | 0.1458 | 0.8542 | 0.2181 | 0.2502 | |
|
| |||||||||
|
| |||||||||
|
|
| ||||||||
|
| |||||||||
| Feeders | 120 | 0.6667(80) | 0.2750(33) | 0.0583(7) | 0.8042 | 0.1958 | 0.2653 | 0.3163 | |
| Nonfeeders | 120 | 0.5583(67) | 0.3417(41) | 0.1000(12) | 0.7292 | 0.2708 | 0.3169 | 0.3966 | |
|
| |||||||||
|
| |||||||||
|
|
| ||||||||
|
| |||||||||
| Feeders | 120 | 0.2250(27) | 0.4750(57) | 0.3000(36) | 0.4625 | 0.5375 | 0.3734 | 0.4993 | |
| Nonfeeders | 120 | 0.2083(25) | 0.5333(64) | 0.2583(31) | 0.4750 | 0.5250 | 0.3744 | 0.5008 | |
HWE: Hardy-Weinberg equilibrium; He: gene heterozygosity; PIC: polymorphism information content.
Frequencies of five diplotypes of PEP gene among feeders and non feeders in mandarin fish.
| Diplotype | SNPs site | Frequency | ||
|---|---|---|---|---|
|
|
| |||
| T2477C | C2528T | feeders | nonfeeders | |
| Dip1 | CT | CC | 0.1525 | 0.1709 |
| Dip2 | CT | CT | 0.0508 | 0.1026 |
| Dip3 | TT | CC | 0.5254 | 0.4017 |
| Dip4 | TT | CT | 0.2288 | 0.2479 |
| Dip5 | TT | TT | 0.0424 | 0.0769 |
Association analysis between PEP diplotypes and food habit domestication traits among feeders and non-feeders in mandarin fish.
| Diplotype | Feeders | Nonfeeders | |
|---|---|---|---|
| Dip1 | 80 | 20 | 0.000 |
| Non-Dip1 | 38 | 97 | |
| Dip2 | 6 | 12 | 0.136 |
| Non-Dip2 | 112 | 105 | |
| Dip3 | 62 | 47 | 0.057 |
| Non-Dip3 | 56 | 70 | |
| Dip4 | 27 | 29 | 0.732 |
| Non-Dip4 | 91 | 88 | |
| Dip5 | 45 | 9 | 0.000 |
| Non-Dip5 | 73 | 108 |
Primers used to amplify and sequence the genomic DNA sequence of the Siniperca chuatsi PEP, AMY and TRY gene.
| Primer pair name | Primer sequence | Annealing Temperature (°C) | Amplified region |
|---|---|---|---|
| TTACCAGTTAGCACCTTCAGCATG | 59 | 5′ flanking-Intron 1 | |
| TTGAGCCTGTACTCCTCCCATAGA | |||
| AAAAGGCAATGTAGCCGAACG | 57 | Exon 2-Exon 4 | |
| TGTCATATCCAAGGTAGCCAGTCA | |||
| AGGCAAGAGCAGCACCTACAGAAA | 55 | Exon 4-Intron 6 | |
| TGCAAGCCACAACCTGACCATT | |||
| TGGTGTTGACCCCAACCACTACTA | 58 | Exon 6-Exon 9 | |
| ATAATTACAGTAGCACTG | |||
| GTTGCTGCTGAATCCTTG | 57 | 5′ flanking-Intron 2 | |
| GGTAGATGCAGGATTGTA | |||
| CTGTGTTGTTGCTCAGA | 57 | Exon 2-Exon 4 | |
| TGAGCTGAAGCCACTAA | |||
| GAGTGGATGCCTGCAAG | 60 | Exon 4-Exon 5 | |
| CAGTGACCCTTCCCAGATG | |||
| GTGCAGTTAATCTAACCCAT | 58 | Exon 5-Exon 6 | |
| ATCTTGTAGAGCCTGGAAT | |||
| CAACCACGACAACCAGAGAG | 57 | Exon 6-Exon 9 | |
| CACCTGTTTCCTTCCTTC | |||
| TTGTTCTGCACCACATCC | 59 | 5′ flanking | |
| GTGGTGTGCCATGATGC | |||
| TAGAGAGTTGTCAGTCAATGC | 59 | 5′ flanking-Exon 1 | |
| AGGAACTTACAGGCTGCA | |||
| GTACGCTCAGTAGGTG | 55 | Exon 1-Exon 5 | |
| CAGGAGTTGTAGTTGCAGACC |
Primer sets for PCR amplification and genotyping of each SNPs located in the PEP and TRY gene.
| Gene | SNPs locus | Genotyping primer | |
|---|---|---|---|
| T2477C | forward | AGTGTTGTGACCTTCGGTGG | |
| C2528T | reverse | ACTCGTCTTTCTTGGCGCTT | |
| G648A | forward | TAAGGTCATCCGTCACCCCA | |
| reverse | CATACCCCGACGTGTACCAA | ||