Literature DB >> 24171731

SAA1 gene variants and childhood obesity in China.

Xiao Zhang1, Qi-Zhu Tang, Ai-Ying Wan, Hai-Ju Zhang, Li Wei.   

Abstract

BACKGROUND: Obesity increases the risk for insulin resistance and metabolic syndrome in both adults and children. SAA is a member of apolipoprotein and plays an important role in maintaining glucose and lipid homeostasis. The purpose of this study was to assess SAA1 allelic variants with obesity in young school-age children.
METHODS: A total of 520 consecutive children ages 5-15 years were recruited. Children were divided based on BMI z score into Obese (OB; BMI z score ≥1.65; n = 253) and non-obese (NOB; n = 267). Four SNPs of the human SAA1 gene (rs12218, rs4638289, rs7131332 and rs11603089) were genotyped by use of polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP) method.
RESULTS: Compared to NOB, circulating SAA levels were increased in OB, as were LDL-C, TG and TC concentration. Obese children showed increased frequency of rs12218 and rs4638289 polymorphism compared to control children. There were no differences between OB and NOB for the other 2 polymorphisms. Only the rs4638289 polymorphism showed significant contributions to higher SAA plasma levels.
CONCLUSIONS: SAA1 genetic polymorphism was associated with obesity in Chinese children.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24171731      PMCID: PMC3829107          DOI: 10.1186/1476-511X-12-161

Source DB:  PubMed          Journal:  Lipids Health Dis        ISSN: 1476-511X            Impact factor:   3.876


Childhood obesity is a serious public health problem that has reached epidemic proportions all over the world [1,2]. In children, the presence of obesity has been associated with increased levels of high sensitivity CRP (hsCRP) [3], as well as other inflammatory mediators [4-8], all of which promote the development of endothelial and metabolic dysfunction [9-12]. Serum amyloid A (SAA) is not only a sensitive acute phase proteins in plasma, but also an apolipoprotein that can replace apolipoprotein A1 (apoA1) as the major apolipoprotein of HDL-C, particularly during the acute phase response [13]. Several studies suggested that SAA is associated with obesity in adult [14]. And a meta-analysis found a strong association between body mass index and SAA levels [15]. Previous studies have demonstrated that SAA1 genetic polymorphism can change the plasma SAA levels [16]. Therefore, the genetic polymorphisms in SAA1 may be associated with obesity. Furthermore, several studies have reported that rs12218 in SAA1 gene was associated with carotid atherosclerosis [17], HDL-C concentration [18,19] and peripheral arterial disease [20]. However, the relationship between SAA gene polymorphism and obesity remains unknown. In the present study, we aimed to investigate the relation between SAA1 genetic polymorphism and obesity in Chinese children.

Results and discussion

A total of 253 OB children and 267 age-, gender- and ethnicity-matched NOB children were recruited during January to July 2012. The demographic characteristics of this cohort are shown in Table 1. As anticipated, OB children had higher LDL-C, TC and TG levels compared to NOB children (Table 1). OB children also had significantly higher levels of SAA than NOB (Table 1).
Table 1

Characteristics of the participants

GroupsNAge (years)BMI Kg/m 2 SBP (mmol/L)DBP (mmol/L)GLU (mmol/L)TG (mmol/L)TC (mmol/L)HDL-C (mmol/L)LDL-C (mmol/L)
OB group
253
13.2 ± 0.9
21.1 ± 2.6
99.5 ± 12.6
61.0 ± 7.9
4.43 ± 0.47
0.61 ± 0.28
2.8 ± 0.7
0.87 ± 0.23
1.39 ± 0.49
NOB group
267
13.4 ± 1.0
17.1 ± 1.4
97.7 ± 12.7
61.4 ± 7.0
4.35 ± 0.48
0.52 ± 0.17
2.6 ± 0.6
0.88 ± 0.22
1.25 ± 0.36
P 0.102<0.0010.1130.5060.055<0.0010.0010.734<0.001
Characteristics of the participants The frequency of each of the SAA polymorphisms is shown in Table 2 for OB and NOB children. Obese children showed increased frequency of rs12218 and rs4638289 polymorphism compared to control children. There were no differences between OB and NOB for the other 2 polymorphisms. Only the rs4638289 polymorphism showed significant contributions to higher SAA plasma levels (Table 3).
Table 2

Distributions of SAA1 genotypes (OB = 253, NOB = 267)

SNPsAllels (1/2)GroupsGenotypes (n, %)
P value
1/11/22/2
rs11603089
A/G
NOB group
192 (0.72)
70 (0.26)
5 (0.02)
0.302
 
 
OB group
172 (0.68)
71 (0.28)
10 (0.04)
 
rs4638289
A/T
NOB group
107 (0.40)
134 (0.50)
26 (0.10)
0.001
 
 
OB group
84 (0.33)
114 (0.44)
55 (0.23)
 
rs12218
C/T
NOB group
152 (0.57)
102 (0.38)
13 (0.05)
0.014
 
 
OB group
129 (0.51)
94 (0.37)
30 (0.12)
 
rs7131332
A/G
NOB group
67 (0.25)
160 (0.60)
40 (0.15)
0.897
  OB group65 (0.24)147 (0.58)41 (0.18) 
Table 3

SAA concentration between each genotypes ( M + SD; ug/mL)

Groupnrs11603089
rs4638289
rs12218
rs7131332
AAAGGGAAATTTCCCTTTAAAGGG
OB group
253
71.16 ± 23.22*
68.03 ± 22.11*
70.13 ± 24.13*
62.62 ± 23.22*
78.26 ± 24.32*
88.24 ± 30.13*
73.15 ± 25.23*
70.03 ± 23.44*
69.18 ± 25.14*
68.64 ± 24.91*
73.65 ± 25.86*
70.60 ± 23.12*
NOB group26751.22 ± 21.1352.02 ± 22.1153.12 ± 24.8745.54 ± 20.5359.12 ± 24.8662.44 ± 24.3455.33 ± 24.3150.34 ± 26.1555.29 ± 22.9652.71 ± 21.4350.1 ± 24.4953.71 ± 26.05

Note: compared to NOB group, *P < 0.05; Compared to AA genotype of rs4638289, △P < 0.05.

Distributions of SAA1 genotypes (OB = 253, NOB = 267) SAA concentration between each genotypes ( M + SD; ug/mL) Note: compared to NOB group, *P < 0.05; Compared to AA genotype of rs4638289, △P < 0.05. In the present study, we found that both rs12218 and rs4638289 polymorphism in the SAA1 gene were associated with OB in Chinese Children. And the SAA plasma levels are significantly higher in obese children. Furthermore, there was significant difference in SAA plasma levels between each genotype of rs4638289 in SAA1 gene. As described previously [18,20], SAA1 encodes one important inflammation factor-SAA.. Recently, Xie et al. reported that rs12218 polymorphism in SAA1 gene was associated with IMT [17], HDL-C [18,19], Ankle-brachial index (ABI) [20], and plasma uric acid levels [18] which was related to cardiovascular disease in adults. And Zhang et al. reported SAA1 gene polymorphism was associated with cerebral infarction [21]. Xu et al. also reported SAA1 gene polymorphism was associated with lipid levels [19]. However, the relationship between SAA gene polymorphism and obesity in Children remains unclear. Inflammation is important in the pathogenesis of atherosclerosis and obesity [15]. In 2000, Yamada et al. [22] reported that the SAA1 genetic polymorphism influences the plasma concentration of SAA. In the present study, we performed a case–control study to observe the relationship between SAA1 genetic polymorphism and obesity. We found rs12218 CC genotype and rs4638289 TT genotype are very common in the obesity patients than that in the control subjects. Furthermore, we also find the rs4638289 was associated with SAA level, but the rs12218 was not found to be associated with SAA level in the present study. An elevated level of SAA causes amyloidosis and is a risk factor for atherosclerosis and its clinical complications, type 2 diabetes, as well as various malignancies. The previous study [23] described the first genome-wide association study on baseline SAA concentrations. In a meta-analysis of four genome-wide scans totalling 4,212 participants of European descent, the authors identified two novel genetic susceptibility regions on chromosomes 11 and 1 to be associated with baseline SAA concentrations. The chromosome 11 region contains the serum amyloid A1 gene and the adjacent genes and explains a high percentage of the total estimated heritability. In their study, the also found rs463889 was associated with SAA concentration. Our result was in line with their report. However, the mechanism which may link SAA1 genetic polymorphism to obesity is still unknown. The change of plasma concentration of SAA resulting from the genetic polymorphism of SAA1 may be a possible mechanism which merits further investigation. In conclusion, SAA1 genetic polymorphism was associated with obesity in Chinese children.

Subjects and methods

Subjects

The study was approved by the Wuhan University Human Research Committee, and informed consent was obtained from the legal caregiver of each participant. Consecutive children between the ages of 5 to 15 years attending public schools in Wuhan city were invited to participate in the study, after they underwent a school based health screening, which included height and weight measurements. Based on such screening, children were identified when their BMI z score was ≥ 1.65 (OB) and age-, gender-, ethnicity-, and area-of residence-matched children with BMI z scores <1.65 (NOB) were then identified and recruited to serve as controls. Of note, all children were otherwise healthy, and were representative of the demographic characteristics of the general population of the city of Wuhan. Children were excluded if they had known diabetes or pre-diabetes, any defined genetic abnormality or underlying systemic disease including hypertension, or if they were within a month from any acute infectious process.

Genotyping

The selection and genotyping of SNPs was performed according to Xie et al.’s protocol [20]. Briefly, we analyzed four tagging SNPs (rs12218, rs4638289, rs7131332 and rs11603089) in the present study. Genomic DNA was extracted from the peripheral blood leukocytes using a DNA extraction Kit (Beijing Bioteke Co. Ltd). Genotyping was confirmed by polymerase chain reaction (PCR) – restriction fragment length polymorphism (RFLP) analysis. The primer pair sequences, annealing temperatures and restriction enzymes for these four SNPs were described in the previous study [18-20].

Anthropometry

To verify the school-health screening initial reports, children were weighed in a calibrated scale to the nearest 0.1 kg and height (to 0.1 cm) was measured with a stadiometer (Holtain, Crymych, UK). Body mass index (BMI) was calculated and BMI z-score was computed using CDC 2000 growth standards http://www.cdc.gov/growthcharts and online software http://www.cdc.gov/epiinfo. A BMI z score ≥ 1.65 was considered as fulfilling the criteria for obesity.

Blood based assays

Blood samples were drawn by venipuncture in the morning after an overnight fast. Blood samples were immediately centrifuged and plasma was frozen at -80°C until assay. Serum lipids including total cholesterol, high-density lipoprotein (HDL) cholesterol, calculated low-density lipoprotein cholesterol (LDL), and triglycerides (TG) were assessed using Flex Reagent Cartridges (Dade Behring). Plasma SAA level was measured using enzyme-linked immunosorbent assay (ELISA kit, Beijing Nothern Biotechnology Institute, Beijing, China).

Statistical analyses

Analyses were carried out using SPSS version 17.0 (SPSS, Chicago, IL, USA). The Hardy–Weinberg equilibrium was assessed by chi-square analyses. The differences in the distribution of genotypes between OB and NOB were analyzed using the chi-square test. General linear model (GLM) analysis was performed to test for associations between SNP genotypes and BMI after adjusting for confounding variables. Normality was assessed by plotting the residuals. Correction for multiple testing was applied for the number of individual risk factors per genotype to achieve a probability value for significance to be assumed before analysis was undertaken.

Abbreviations

SAA: Serum amyloid A; OB: Obesity; TG: Triglycerides; TC: Total cholesterol; HDL-C: High-density lipoprotein; LDL-C: Low-density lipoprotein.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

XZ and QZT carried out the molecular genetic studies and drafted the manuscript. AYW and HJZ carried out the genotyping. LW, XZ and QZT participated in the design of the study and performed the statistical analysis. XZ and HJZ conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.
  23 in total

1.  Polymorphisms in the SAA1 gene are associated with ankle-to-brachial index in Han Chinese healthy subjects.

Authors:  Xiang Xie; Yi-Tong Ma; Yi-Ning Yang; Zhen-Yan Fu; Xiao-Mei Li; Ying-Ying Zheng; Ding Huang; Xiang Ma; Bang-Dang Chen; Fen Liu
Journal:  Blood Press       Date:  2011-03-30       Impact factor: 2.835

Review 2.  Association between serum amyloid A and obesity: a meta-analysis and systematic review.

Authors:  Yulan Zhao; Xuelian He; Xuegui Shi; Chengjin Huang; Jie Liu; Shuli Zhou; Chew-Kiat Heng
Journal:  Inflamm Res       Date:  2010-02-07       Impact factor: 4.575

3.  Genome-wide association study identifies two novel regions at 11p15.5-p13 and 1p31 with major impact on acute-phase serum amyloid A.

Authors:  Carola Marzi; Eva Albrecht; Pirro G Hysi; Vasiliki Lagou; Melanie Waldenberger; Anke Tönjes; Inga Prokopenko; Katharina Heim; Hannah Blackburn; Janina S Ried; Marcus E Kleber; Massimo Mangino; Barbara Thorand; Annette Peters; Christopher J Hammond; Harald Grallert; Bernhard O Boehm; Peter Kovacs; Ludwig Geistlinger; Holger Prokisch; Bernhard R Winkelmann; Tim D Spector; H-Erich Wichmann; Michael Stumvoll; Nicole Soranzo; Winfried März; Wolfgang Koenig; Thomas Illig; Christian Gieger
Journal:  PLoS Genet       Date:  2010-11-18       Impact factor: 5.917

4.  High body mass index for age among US children and adolescents, 2003-2006.

Authors:  Cynthia L Ogden; Margaret D Carroll; Katherine M Flegal
Journal:  JAMA       Date:  2008-05-28       Impact factor: 56.272

5.  Human SAA1-derived amyloid deposition in cell culture: a consistent model utilizing human peripheral blood mononuclear cells and serum-free medium.

Authors:  Wataru Ishii; Juris J Liepnieks; Toshiyuki Yamada; Merrill D Benson; Barbara Kluve-Beckerman
Journal:  Amyloid       Date:  2013-03-06       Impact factor: 7.141

6.  SAA1 genetic polymorphisms are associated with plasma glucose concentration in non-diabetic subjects.

Authors:  Xiang Xie; Yi-Tong Ma; Yi-Ning Yang; Xiao-Mei Li; Ying-Ying Zheng; Zhen-Yan Fu; Xiang Ma; Fen Liu; Ying Huang; Bang-Dang Chen
Journal:  Clin Chem Lab Med       Date:  2013-12       Impact factor: 3.694

7.  Serum uric acid levels are associated with polymorphism in the SAA1 gene in Chinese subjects.

Authors:  Xiang Xie; Yi-Tong Ma; Yi-Ning Yang; Xiao-Mei Li; Zhen-Yan Fu; Ying-Ying Zheng; Xiang Ma; Bang-Dang Chen; Fen Liu; Ying Huang; Zi-Xiang Yu; You Chen
Journal:  PLoS One       Date:  2012-06-29       Impact factor: 3.240

8.  Serum amyloid A is found on ApoB-containing lipoproteins in obese humans with diabetes.

Authors:  Anisa Jahangiri; Patricia G Wilson; Tianfei Hou; Aparna Brown; Victoria L King; Lisa R Tannock
Journal:  Obesity (Silver Spring)       Date:  2013-05       Impact factor: 5.002

9.  Rs12218 In SAA1 gene was associated with serum lipid levels.

Authors:  Xiao-Lin Xu; Xiao-Tian Sun; Liewen Pang; Guoqian Huang; Jiechun Huang; Meng Shi; Yi-Qing Wang
Journal:  Lipids Health Dis       Date:  2013-07-30       Impact factor: 3.876

10.  Associations of genetic polymorphisms of SAA1 with cerebral infarction.

Authors:  Li-Jun Zhang; Bin Yuan; He-Hua Li; Sheng-Bo Tao; Hai-Qing Yan; Li Chang; Jian-Hua Zhao
Journal:  Lipids Health Dis       Date:  2013-08-29       Impact factor: 3.876

View more
  5 in total

Review 1.  Serum amyloid A1: Structure, function and gene polymorphism.

Authors:  Lei Sun; Richard D Ye
Journal:  Gene       Date:  2016-03-03       Impact factor: 3.688

2.  [Association of rs4638289 and rs7131332 polymorphisms of the serum amyloid A1 gene with Kawasaki disease].

Authors:  Ying Chen; Cheng Wang; Qing Ji; Juan Zhang; Cheng Tan; Shuang-Shuang Wang; Xiu-Ying Yi
Journal:  Zhongguo Dang Dai Er Ke Za Zhi       Date:  2020-06

3.  Silencing of SAA1 inhibits palmitate- or high-fat diet induced insulin resistance through suppression of the NF-κB pathway.

Authors:  Yong Wang; Feng Cao; Yang Wang; Gang Yu; Ben-Li Jia
Journal:  Mol Med       Date:  2019-05-06       Impact factor: 6.354

4.  Relationship Between Serum Amyloid A1 (SAA1) Gene Polymorphisms Studies with Obesity in the Saudi Population.

Authors:  Khalid Khalaf Alharbi; Amal F Alshammary; Omar Sammar Aljabri; Imran Ali Khan
Journal:  Diabetes Metab Syndr Obes       Date:  2021-03-01       Impact factor: 3.168

5.  Identification of key pathways and genes in polycystic ovary syndrome via integrated bioinformatics analysis and prediction of small therapeutic molecules.

Authors:  Praveenkumar Devarbhavi; Lata Telang; Basavaraj Vastrad; Anandkumar Tengli; Chanabasayya Vastrad; Iranna Kotturshetti
Journal:  Reprod Biol Endocrinol       Date:  2021-02-23       Impact factor: 5.211

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.