Literature DB >> 24166501

Aurora-A is a determinant of tamoxifen sensitivity through phosphorylation of ERα in breast cancer.

X Q Zheng1, J P Guo2, H Yang2, M Kanai2, L L He2, Y Y Li2, J M Koomen2, S Minton3, M Gao4, X B Ren5, D Coppola6, J Q Cheng2.   

Abstract

Despite the clinical success of tamoxifen, its resistance remains a major challenge in breast cancer. Here we show that Aurora-A determines tamoxifen sensitivity by regulation of oestrogen receptor (ER)α. Ectopic expression of Aurora-A decreases and depletion of Aurora-A enhances tamoxifen sensitivity in ERα-positive breast cancer. Elevated Aurora-A was significantly associated with the recurrence of ERα-positive tumours. Notably, Aurora-A inhibitor MLN8237, which is currently in clinical trial, synergizes with tamoxifen and overcomes tamoxifen resistance. Furthermore, Aurora-A interacts with and phosphorylates ERα on serine-167 and -305, leading to increase in ERα DNA-binding and transcriptional activity. Elevated levels of Aurora-A are significantly associated with disease-free survival in ERα-positive but not ERα-negative breast cancers. These data suggest that Aurora-A has a pivotal role in tamoxifen resistance and ERα is a bona fide substrate of Aurora-A. Thus, Aurora-A represents a prognostic marker in ERα-positive tumour and a critical therapeutic target in tamoxifen-resistant breast cancer, and Aurora-A inhibitor could be used as either an independent or concurrent agent in tamoxifen-resistant tumour.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24166501      PMCID: PMC4002670          DOI: 10.1038/onc.2013.444

Source DB:  PubMed          Journal:  Oncogene        ISSN: 0950-9232            Impact factor:   9.867


INTRODUCTION

Aurora-A is a mitotic serine/threonine kinase, which is evolutionally conserved and is localized at the centrosome.[1] Activation of Aurora-A is required for mitotic entry, centrosome maturation and separation and G2 to M transition.[2] It has been shown that Aurora-A is frequently amplified and/or overexpressed in breast carcinoma.[3] In animal models, estrogen-induced rat breast cancers expressed high levels of Aurora-A and displayed centrosome amplification and aneuploidy.[4] Moreover, mouse mammary tumour virus (MMTV)-driven Aurora-A transgenic mice developed breast tumours and genetic instability occurred prior to tumorigenesis in mammary epithelial cells.[5] In addition, recent studies have shown that Aurora-A promotes distant metastases only in ERα-positive breast cancer cells.[6, 7] These findings indicate the critical role of Aurora-A in mammary carcinogenesis. However, the role of Aurora-A in endocrine-therapy resistance and ERα signaling remains largely unknown. ERα is a hormone-dependent nuclear transcription factor expressed in approximately 70% of breast tumours.[8] The binding of estrogen to ERα results in ERα dimerization and its recruitment to the estrogen-responsive elements (EREs) on the promoters of ERα target genes.[9, 10] Because ERα plays a major role in the development and progression of breast cancer, current endocrine therapies for breast cancer are mainly based on targeting the ERα signaling pathway. Among the endocrine therapies targeting ERα, the selective estrogen receptor modulator tamoxifen, which inhibits breast cancer growth through competitive binding of ERα, has been the principal endocrine therapy for breast cancer for the past 30 years.[11] However, tamoxifen resistance presents a major challenge in treating the disease.[12-14] ERα is a key determinant of breast cancer susceptibility to endocrine therapy, and post-translational modifications of ERα often lead to endocrine resistance.[15] The phosphorylation of ERα has long been implicated in modulating endocrine response [16, 17] and has been shown to influence ERα-binding potential and gene expression profiles,[16] resulting in tamoxifen resistance. In this study, we demonstrated a critical role of Aurora-A in regulation of tamoxifen sensitivity. Aurora-A inhibitor MLN8237 synergized with tamoxifen to inhibit cell growth and cell survival and to overcome tamoxifen resistance. Furthermore, Aurora-A interacted with ERα and phosphorylated ERα-Ser167/Ser305. The phosphorylation of ERα by Aurora-A resulted in activation of ERα in the absence of estrogen. These data indicate that Aurora-A plays an important role in regulation of ERα activity and tamoxifen resistance, and thus could be a therapeutic target in breast cancer endocrine-therapy. In addition, these findings underscore the potential of MLN8237 as either an independent or concurrent agent in tamoxifen-resistant breast cancer and the pERα-Ser167/Ser305 as potential clinical biomarkers in Aurora-A inhibitor therapy.

RESULTS

Knockdown of Aurora-A reverses tamoxifen resistance and ectopic expression of Aurora-A renders cells resistance to tamoxifen

Previously studies showed frequent overexpression/activation of Aurora-A in breast cancer and a critical role of Aurora-A in mammary epithelial cell immortalization and transformation.[5, 18] When we examined Aurora-A expression in a panel of breast cancer cell lines, we found elevated levels of Aurora-A protein and p-Aurora-A-T288 in tamoxifen-resistant BT474 and MCF7-TamR cells as compared to tamoxifen-responsive MCF7 cells (Figure 1a). These findings prompted us to assess the role of Aurora-A in tamoxifen resistance. We initially assessed the tamoxifen sensitivity in 3 ERα-positive and 1 ERα-negative cell lines (Figure S1) and subsequently knocked down Aurora-A in BT474 and MCF7-TamR cells using 2 siRNAs against different coding regions of Aurora-A (Figures 1b and S2a). Following incubation for 2 days, the cells were treated with and without increasing doses of tamoxifen for 72 hours and then subjected to MTT, Annexin V/FACS and colony formation assays. In agreement with previous reports, tamoxifen alone had minimal effect on cell death and colony growth in tamoxifen-resistant BT474 and MCF7-TamR cells.[19] However, knockdown of Aurora-A significantly reduced cell survival and colony formation, and enhanced tamoxifen anti-tumour effects in both BT474 and MCF7-TamR cell lines (Figures 1c–e, and Figures S2b and 2c). To further examine the role of Aurora-A in tamoxifen sensitivity, we ectopically expressed Aurora-A in tamoxifen-responsive MCF7 cells (Figure 2a). The cells transfected with empty vector were used as controls. Following treatment with tamoxifen, we found that overexpression of Aurora-A rendered MCF7 cells resistance to tamoxifen (Figures 2b–d). As controls, we evaluated the effects of Aurora-A on response to tamoxifen in ERα-negative cells. Aurora-A was knocked down and ectopically expressed in MDA-MB-468 and MDA-MB-231 cells, respectively. After administration of tamoxifen, cell viability and colony formation were found no difference between Aurora-A-manipulated and control-siRNA/vector-treated cells in both ERα-negative cell lines (Figure S3). These data indicate that Aurora-A plays a role in tamoxifen resistance and could be a critical therapeutic target for overcoming the resistance in ERα-positive breast cancer cells.
Figure 1

Knockdown of Aurora-A sensitizes tamoxifen-resistant cells to tamoxifen

(A) Western blot was performed with indicated antibodies in a panel cell lines. Note: elevated Aurora-A was detected in tamoxifen-resistant MCF7-TamR and BT474 cells. (B) BT474 cells were transfected with two siRNAs of Aurora-A and control siRNA targeting eGFP. After 72 hours of incubation, immunoblot was carried out with indicated antibodies. (C–E) Aurora-A siRNA- and control siRNA-treated BT474 cells were treated with and without tamoxifen (0–2.0 μM). Total cell viability (C), apoptosis (D) and cell growth (E) were assessed by MTT assays, Annexin V/FACS and focus formation, respectively. Experiments were repeated three times, each experiment was triplicates. Error bars represent mean plus standard deviation. The asterisks denote significance (*P < 0.05 and ** P < 0.01).

Figure 2

Expression of Aurora-A induces tamoxifen-resistance

(A) Immunoblot analysis of MCF7 cells, which were stably transfected with HA-Aurora-A and pHM6 vector, with anti-HA and, -ERα and -actin antibodies. (B–D) Aurora-A- and pHM6 vector-transfected MCF7 cells were treated with and without tamoxifen for 72 hours and then were assayed for cell viability (B), apoptosis (C), and focus formation (D). Experiments were repeated three times, each experiment was triplicated. Error bars represent mean plus standard deviation. The asterisks denote significance (*P < 0.05 and ** P < 0.01).

Aurora-A inhibitor MLN8237 cooperates with tamoxifen and overcomes tamoxifen-resistance in vitro and in vivo

Since tamoxifen-resistant MCF7-TamR and BT474 cells expressed high levels of Aurora-A and knockdown of Aurora-A reduced the resistance, we further investigated whether Aurora-A inhibitor MLN8237, which is currently in clinical trial,[20] is able to overcome tamoxifen resistance and to cooperate with tamoxifen. We first treated MCF7-TamR and BT474 cells with various concentrations of MLN8237 and tamoxifen alone and in combination and monitored cell survival. Figures 3a and 3c show that MLN8237 alone inhibited p-Aurora-A-T288 and caused a dose-dependent inhibition of cell survival with IC50 values of ~4.0 μm/L, whereas tamoxifen alone had much less effect on cell survival with IC50 values of greater than 5 μm/L. However, combination treatment of cells with Aurora-A inhibitor and tamoxifen resulted in significant cell death with IC50 values of tamoxifen from greater than 5 μm/L (in the absence of MLN8237) to 0.1 μm/L (in the presence of 0.5 μmol/L MLN8237; Figure S4). In addition, we found that combination of MLN8237 and tamoxifen increased cleavage of PARP, caspase-7 (MCF7-TamR) or caspase 3 (BT474) more significantly than either one alone (Figure 3b). Therefore, MLN8237 sensitized MCF7-TamR and BT474 cells to tamoxifen. To further examine if MLN8237 synergizes with tamoxifen, we treated cells with a combination of MLN8237 and tamoxifen and used Calcusyn software to generate Fa-CI plots as described under Methods. Figure S4 shows that almost all the experimental points have CI values of less than 1.0. The resulting Fa-CI plot curve falls well below 1 for the effect range, showing that the combination of MLN8237 and tamoxifen is synergistic in tamoxifen-resistant MCF7-TamR and BT474 cells.
Figure 3

Aurora-A inhibitor MLN8237 overcomes tamoxifen resistance

(A) Following treatment with and without MLN8237, MCF7-TamR and BT474 cells were immunoblotted with indicated antibodies. (B and C) Following treatment of MCF7-TamR and BT474 cells with and without various concentrations of MLN8237 and tamoxifen for 72 hours, cells were processed for MTT assay (C) and Western blot (B, note: cleaved caspase 7 for MCF7-TamR and cleaved caspase 3 for BT474). (D–G) MLN8237 alone and combination with tamoxifen inhibited tamoxifen-resistant tumour growth in orthotopic breast cancer model. BT474 cells were injected to mammary fat pads of nude mice. When tumour reached ~100mm3, mice were treated with MLN8237 or/and tamoxifen as described in “Materials and Methods”. The tumour growth was monitored (D). At the end of experiment, the tumour weight was calculated (E). Representative tumour tissues were proceeded to Western blot (F) and immunohistochemical staining (F) with indicated antibodies.

We next determined whether Aurora-A inhibitor MLN8237 overcomes tamoxifen resistance in vivo. Orthotopic tumours were established by injection of BT474 cells into the mammary fat pads of athymic nude mice. After implanted tumours reached approximately 100 mm3 in size, the mice were randomized in 4 groups (7 mice/group): vehicle, tamoxifen alone, MLN8237 alone, and both tamoxifen and MLN8237. As control, orthopotic tumours with tamoxifen-sensitive MCF7 cells were also established and administered with tamoxifen and vehicle (Figure S5). The mice were treated for 12 consecutive days and the tumour growth was monitored for an additional 1 week (Figure 3d). While the control group tumour reached 1500 mm3 in volume at the endpoint of the assay, the MLN8237-treated tumours grew much slower than control and tamoxifen-treated groups. Treatment with tamoxifen alone completely inhibited MCF7 tumour growth but only caused an approximately 10% reduction in BT474 tumour size compared with the control group (Figures 3d and S5), whereas the combination of both MLN8237 and tamoxifen significantly repressed BT474 tumour growth (Figure 3d). Similarly, the BT474 tumour weight in MLN8237- and the combination-treated groups was dramatically reduced as compared with control and tamoxifen-treated groups (Figure 3e). Immunoblotting analysis of the representative tumours revealed that p-Aurora-A-T288 was inhibited by MLN8237 and that PARP cleavage was induced in the tumours treated with MLN8237 alone and combination of MLN8237 and tamoxifen (Figure 3f). Moreover, immunostaining with cleavage caspase-3 and Ki-67 antibodies showed that inhibition of Aurora-A alone and combination with tamoxifen significantly activated caspase-3 and inhibited proliferation (Figure 3g). Taken together, these data indicate that Aurora-A inhibitor MLN8237 not only overcomes tamoxifen resistance but also synergizes with tamoxifen in vitro and in vivo.

Aurora-A induces ERα transactivation activity

Post-translational modification of ERα has been shown to be one of major mechanisms in tamoxifen resistance.[21, 22] Thus, we next investigated if Aurora-A regulates ERα transactivation activity. Reporter assay was performed by introducing ERα responsive element reporter (ERE-Luc) combined with HA-Aurora-A into MCF7 cells, and the results showed that Aurora-A strongly induced ERα transactivation activity in a dose-dependent manner (Figure 4a). In addition, the reporter activity induced by E2 was further increased by expression of Aurora-A (Figure S6a). However, E2- but not Aurora-A-induced ERα activation was inhibited by tamoxifen (Figure S6b). Furthermore, the effect of Aurora-A on ERE-Luc activity was evaluated in ERα-negative MDA-MB-231 cells. Following transfection of ERE-Luc and ERα together with and without Aurora-A, luciferase assay revealed that expression of ERα alone moderately induced ERE-Luc activity. However, the reporter activity was significantly stimulated by co-expression of ERα and Aurora-A (Figure 4b). These data suggest that Aurora-A not only activates ERα activity but also enhances E2 action and that Aurora-A-induced ERα activation could not be inhibited by tamoxifen.
Figure 4

Aurora-A induces ERα transactivation activity and interacts/co-localizes with ERα

(A and B) ERα-positive MCF7 (A) and ERα-negative MDA-MB-231 (B) cells were transfected with ERE-Luc and other indicated plasmids. Following 48 hours of incubation, luciferase activity was measured and normalized to β-galactosidase. Results are the mean ± S.E. of three independent experiments performed in triplicate. (C–E) Aurora-A directly binds to ERα. MDA-MB-231 cells were transfected with HA-Aurora-A and GFP-ERα. After 48 hours of incubation, cells were lysed, immunoprecipitated with anti-GFP antibody and immunoblotted with anti-HA antibody (top panel) and vice versa (panel 2). Panels 3 and 4 show the expression of transfected plasmids (C). For endogenous Aurora-A and ERα interaction, MCF-7 cells were immunoprecipitated with anti-ERα and detected with anti-Aurora-A antibody and vice versa (D). GST pull-down assay was performed by incubation of recombinant ERα with GST-Aurora-A or GST protein (E). (F) MCF7 cells were immunostained with anti-Aurora-A (green; b) and -ERα (red; c) antibodies, and counterstained with DAPI (blue; a). The merged pictures (green, red and blue) were shown as d. The magnified images of the indicated areas in panels i-iii are shown at the right side; Aurora-A: top panel (green), ERα: middle panel (red), overlay: bottom panel.

Aurora-A interacts with and phosphorylates ERα

To determine the mechanism by which Aurora-A induces ERα transactivation activity, we initially performed co-immunoprecipitation in MDA-MB-231 cells following transfection of GFP-ERα and HA-Aurora-A. Figure 4c shows that HA-Aurora-A interacted with GFP-ERα. We next examined if endogenous ERα and Aurora-A forms a complex. Co-immunoprecipitation was carried out in MCF7-TamR cells, which express elevated Aurora-A and ERα (Figure 1a). As shown in Figure 4d, ERα was readily detected in Aurora-A immunoprecipitates and vice versa. Furthermore, GST-pull down assay revealed that GST-Aurora-A but not GST could pull-down the recombinant ERα (Figure 4e). These data indicate that Aurora-A directly binds to ERα. To determine if Aurora-A co-localizes with ERα, we performed immunofluorescence staining in MCF7-TamR cells with anti-ERα and -Aurora-A antibodies and we found that Aurora-A co-localized with ERα not only in the nucleus but also in centrosome (Figure 4f). We next investigated if Aurora-A phosphorylates ERα. In vitro Aurora-A kinase assay was performed by incubation of full-length human recombinant ERα with and without recombinant Aurora-A. Figure 5a shows that ERα was highly phosphorylated in the reaction containing Aurora-A. To determine if Aurora-A phosphorylates ERα in vivo, MDA-MB-231 cells were co-transfected with Myc-ERα and either HA-Aurora-A or vector. After labeling with [32P]-orthophosphate for 3 hours, ERα was immunoprecipitated with anti-Myc antibody and the immunoprecipitates were separated in SDS-PAGE. Following exposure of an x-ray film, we observed that phosphorylation of ERα was induced by Aurora-A (Figure 5b).
Figure 5

Aurora-A phosphorylates ERα-Ser167/Ser305 in vitro and in vivo

(A) In vitro kinase was performed by incubation of recombinant ERα with and without recombinant Aurora-A (top panel). Bottom panels are immunoblots showing the proteins used for in vitro kinase assay. (B and C) In vivo labeling. MDA-MB-231 cells were transfected with Myc-ERα or -ERα-2A (Ser167A/Ser305A) together with and without HA-Aurora-A. After 36 hours of transfection, cells were labeled with [32P]Pi (0.5 mCi/ml) in phenol red-free MEM without phosphate and serum for 4 hours. Myc-ERα was immunoprecipitated, separated on SDS-PAGE and exposed (top panel). NS stands for non-specific band. Bottom panels show expression of the transfected plasmids. (D) MDA-MB-231 cells were transfected with indicated plasmids. After 48 hours of transfection, cells were immunoprecipitated with anti-ERα antibody and immunoblotted with indicated antibodies. (E) MCF7 cells were transfected with Aurora-A and BT474 cells were treated with siRNA of Aurora-A. Following 72 hours of incubation, cells were immunoprecipitated with anti-ERα antibody and then immunoblotted analysis with indicated antibodies (upper 2 panels). Bottom panels are Western blots probed with indicated antibodies.

We further defined the amino acid(s) of ERα that is phosphorylated by Aurora-A. In vitro Aurora-A kinase assay was carried out using GST fusion proteins containing different portions of ERα as substrates (Figure S7a). Since ERα/1–200 and ERα/1–318 but not ERα/1–150 were phosphorylated by Aurora-A, a potential phosphorylation site(s) was mapped to the amino acid 150–318 region of ERα (Figure S7b). Mass spectrometry analysis revealed serine-167 (Ser167), Ser212 and Ser305 as putative Aurora-A phosphorylation sites. To verify if these 3 serine residues are phosphorylated by Aurora-A, we further created 3 different GST-ERα fusion proteins that contain Ser167, Ser212 or Ser305 and their serine-alanine mutation S167A, S212A and S305A individually (Figure S7a). In vitro kinase assays revealed that Aurora-A phosphorylated wild-type GST-ERα-S167, even it is not perfect match with Aurora-A phosphorylation consensus motif,[23] and -S305 but not GST-ERα-S212, -S167A, and -S305A (Figure S7c). Furthermore, in vivo [32P]orthophosphate labeling and Western blotting analysis revealed that Aurora-A phosphorylation of wild-type ERα but not ERα-S167A/S305A (ERα-2A) mutant (Figures 5c and 5d), suggesting that Ser167 and Ser305 of ERα are phosphorylated by Aurora-A. These findings were further confirmed by immunoblotting of Aurora-A overexpressing MCF7 and Aurora-A knocking down BT474 cells (Figure 5e) as well as of cold in vitro Aurora-A kinase reaction (Figure S7d) using specific phospho-ERα-Ser167 and -Ser305 antibodies. In addition, we observed that Aurora-A inhibitor MLN8237 significantly inhibited p-ERα-Ser167/Ser305 levels in MCF7-TamR and BT474 cells (Figures S8a and S8b) and the xenografts (Figure S8c). Based on these findings, we conclude that ERα-Ser167 and -Ser305 are phosphorylated by Aurora-A in vitro and in vivo.

Aurora-A-induced ERα transactivation activity and CCND1 expression via phosphorylation of ERα-Ser167 and Ser305

Since Aurora-A induces ERα transactivation, we next investigated whether Aurora-A-induced ERα activity depends on phosphorylation of ERα-Ser167 or/and Ser305. ERα-negative MDA-MB-231 cells were transfected with wild-type ERα, ERα-S167A, ERα-S305A or ERα-S167A/S305A (ERα-2A) together with ERE-Luc. Reporter assay showed that expression of Aurora-A significantly induced wild-type ERα but not ERα-S167A/S305A transactivation activity (Figure 6a). Furthermore, Aurora-A also stimulated ERα-S167A- and ERα-S305A-induced ERE-Luc activity to a much lesser extent than wild-type ERα (Figure 6a)
Figure 6

Aurora-A induces ERα transactivation and upregulates CCND1 through phosphorylation of ERα-Ser167/Ser305

(A) Luciferase assay. MDA-MB231 cells were transfected with indicated plasmids. Following 48 hours of incubation, luciferase assay was performed as described in Figure 4. (B and C) Semi-quantitative RT-PCR (upper panels) and Western blot (lower panels) analyses were carried out in Aurora-A transfected MCF7 and Aurora-A-knockdown BT474 cells. (D–F) ERα-negative MDA-MB-231 cells were transfected with indicated plasmids and subjected to RT-PCR and Western blot (D), luciferase (E) and ChIP (F) assays.

Since CCND1 (cyclin D1) is a major target of ERα and overexpression of CCND1 has been implicated in tamoxifen resistance,[25, 26] we also examined whether Aurora-A induces CCND1 expression and, if present, whether the induction depends on phosphorylation of ERα-Ser167/SerS305. ERα-positive MCF7 and ERα-negative MDA-MB-231 cells were transfected with Aurora-A. Following 72 hours of incubation, semi-quantitative RT-PCR and immunoblot analyses revealed that mRNA and protein levels of CCND1 were induced by Aurora-A in MCF7 but not in MDA-MB-231 cells (Figure 6b and Figure S9). Furthermore, knockdown of Aurora-A decreased CCND1 expression in BT474 cells (Figure 6c), suggesting Aurora-A induction of CCND1 through ERα. To determine if Aurora-A phosphorylation of ERα mediates this action, we expressed wild-type ERα, ERα-S167A/S305A, ERα-S167A and ERα-S305A together with and without Aurora-A in MDA-MB-231 cells. As shown in Figures 6d–f, co-expression of Aurora-A and wild-type ERα significantly increased CCND1 protein and mRNA levels and ERα transactivation and DNA-binding activity towards the CCND1 promoter. However, Aurora-A failed to exert these effects when co-transfected with ERα-S167A/S305A. Expression of ERα-S167A or ERα-S305A partially inhibited Aurora-A-induced CCND1 (Figure 6d and 6e). In addition, we examined the relationship between Aurora A and CCND1 mRNA levels in patient samples from GEO gene expression datasets and found the significant positive correlation of Aurora-A with CCND1 expression in ERα-positive but not ERα-negative breast cancers (Figure S10). Taken together, these data indicate that Aurora-A induces ERα and ERα-targeted gene CCND1 through phosphorylation of Ser167 and Ser305.

Upregulation of Aurora-A correlates with p-ERα-Ser167/Ser305, endocrine therapy resistance and disease-free survival in ERα-positive breast cancer

Having demonstrated Aurora-A phosphorylation of ERα-Ser167/Ser305 in cells, we next investigated if this event occurs in human breast tumour samples. Of the 167 ERα-positive breast cancers examined by immunohistochemical staining and Western blot, 73 had Aurora-A overexpression and 34 had elevated both p-ERα-Ser167 and p-ERα-Ser305 (Figures 7a–c and Table S1). Further, p-ERα-Ser167 and p-ERα-Ser305 were detected in 88 and 71 tumours, respectively, which include 34 cases with positive p-ERα-Ser167/Ser305 (Figure 7c). Of the 34 tumours with elevated levels of p-ERα-Ser167/Ser305, 32 (94.1%) also had elevated Aurora-A (p < 0.00001; Figure 7d). The other 2 cases with elevated p-ERα-Ser167/Ser305 could be resulted from activation of other kinases (Figure 8). Further analyses showed that Aurora-A expression level, p-ERα-Ser167 and p-ERα-Ser305 status were not related to tumour size, lymph node metastasis, tumour stage and grade (Table S1). However, p-ERα-Ser167/Ser305 and pERα-Ser167 alone, but not p-ERα-Ser305, are significantly associated disease-free survival (DFS; Figure S11a–c and Table S2). All 32 patients with elevated Aurora-A and positive pERα-Ser167/Ser305 relapsed from tamoxifen/nolvadex treatment and had poor DFS (Figure S11d). Notably, elevated levels of Aurora-A were found to be significantly associated with DFS (Figure 7d and Table S2).
Figure 7

Expression of Aurora-A correlates with p-ERa-Ser167/Ser305 and is associated with recurrence-free survival

(A and B) Immunohistochemical staining (A) and immunoblot (B) analyses were performed with indicated antibodies in ERα-positive human breast tumours. (C) Chi-square test analysis of Aurora-A expression and p-ERα-Ser167/Ser305 in ERα-positive breast cancer specimens. (D – F) Kaplan-Meier curves show the recurrence free-survival in ERα-positive breast cancer patients from Moffitt Cancer Center patients (D), 4 breast cancer datasets (E) and the KM Plotter database (F; note: there are 8 datasets in KM Plotter including 3 datasets from panel E). The log-rank test p values reflect the significance of association between high Aurora-A and shorter survival.

Figure 8

Diagram represents a proposed model of Aurora-A regulation of ERα leading to tamoxifen resistance and disease recurrence in ERα-positive breast cancer.

To further confirm these findings, we took advantage of the available gene expression datasets summing up to 854 ERα-positive primary breast cancers with associated clinical data, including endocrine therapy, disease recurrence and survival (Table S3). We defined each dataset into two groups of tumours with respectively high and low level of expression of Aurora-A (Figure S12). Strikingly, the univariate Kaplan-Merier survival analysis revealed that the group expressing high levels of Aurora-A displayed a significant higher probability to develop recurrence when compared to the “low” group (p values ranged from 0.0064 to 3E-01, depending on the datasets; Figure 7e, S12, S13 and Table S4). In addition, the KM Plotter database (http://www.kmplot.com;[24] analysis of breast cancers also showed that Aurora-A levels were significantly associated with recurrence-free survival in ERα-positive breast cancers treated with endocrine therapy (Figure 7f and Table S5) but not in ERα-negative and basal breast tumours (Figure S14 and Table S5). Since antiestrogen therapy was used in ERα-positive tumours collected in these datasets, the recurrence largely represents the resistance to endocrine therapy. Therefore, these data suggest that elevated Aurora-A has significant implication in recurrence of ERα-positive breast cancers which are mostly due to Aurora-A inducing endocrine therapy-resistance by phosphorylation of ERα.

DISCUSSION

Here we show that overexpression of Aurora-A sufficed to induce tamoxifen resistance, whereas inhibition of Aurora-A by small molecule inhibitor MLN8237 or siRNA knockdown overcame the resistance. Previous reports demonstrated that overexpression/activation of Aurora-A is a recurrent event in human breast cancer.[3] A recent study showed that Aurora-A promotes distant metastases by inducing epithelial-to-mesenchymal transition in ERα-positive breast cancer cells,[6] suggesting a link between Aurora-A and ERα, which plays a critical role in disease progression in ERα-positive breast cancer. Our data showed that Aurora-A directly interacted with ERα and phosphorylated ERα-Ser167/Ser305 in vitro and in vivo (Figures 4 and 5). Co-existence of overexpression of Aurora-A and phospho-ERα-Ser167/Ser305 was detected in tamoxifen resistance breast cancer cells and primary tumours with poor prognosis (Figures 1, 7c and S11d). Furthermore, data mining analysis of ~2,400 breast cancers revealed that elevated Aurora-A was significantly associated with short recurrence-free survival only in ERα-positive and antiestrogen-treated breast cancers (Figures 7e, 7f and S12–S14, and Table S4 and S5). Thus, these findings indicate that ERα is a bona fide substrate of Aurora-A and that elevated level of Aurora-A is a causal factor of endocrine therapy-resistance and a valuable prognostic marker in ERα-positive breast cancer. Previous studies showed that at least 80% of tamoxifen resistant breast tumours retain ERα expression[11] and that phosphorylation of ERα by protein kinases is one of major mechanisms that cause the resistance. Serine-167, which is located in the N-terminal activation function 1 domain (AF-1) of ERα, has been shown to be phosphorylated by Akt, S6K1, pp90rsk as well as IKBKE and the phosphorylation of Ser167 leads to increase of ERα transactivation activity.[27-30] In a small study based on tamoxifen-treated breast cancer patients,[31] the p-ERα-Ser167 was correlated with increased tamoxifen sensitivity,[32] In contrast, other results have indicated that the phosphorylation of ERα-Ser167 is linked to reduce tamoxifen sensitivity.[27, 28] In this study, our data show that p-ERα-Ser167 is associated with poor prognosis (Figure S11b). Serine-305 is located in the hinge region of ERα and the phosphorylation of this residue by PKA and PAK1 has been shown to result in ERα transcriptional activation of its target genes.[33, 34] In addition, phosphorylation of Ser305 is correlated with tamoxifen resistance while it is not associated with DFS.[33-37] We showed that Aurora-A phosphorylates both Ser167 and Ser305 of ERα, which is significantly related with short DFS (Figures 5, 7e S11a and S11d) and significantly induces ERα transactivation activity and CCND1 expression (Figure 6). Mutation of Ser167 and Ser305 to alanine abrogated the effect of Aurora-A on ERα activity and CCND1 expression (Figure 6). Collectively, these data suggest that Aurora-A-induced ERα activation, tamoxifen resistance and disease recurrence could be largely through phosphorylation of Ser167 and Ser305 (Figure 8). Aurora-A is a centrosome kinase, however, it has been shown to also phosphorylate the molecules outside centrosome, including TRF1, RalA, p53, HDAC6 etc.[38-41] Our data showed that Aurora-A co-localized with ERα in both nucleus and centrosome (Figures 4f and S15b). We also observed the co-localization of p-ERα-Ser167 and p-ERα-Ser305 with Aurora-A in the centrosome (Figure S15a), implying that Aurora-A also phosphorylates ERα within the centrosome. The function of ERα in the centrosome is currently unknown. Further studies are required to characterize the role of ERα in Aurora-A-induced centrosome amplification. Finally, several small molecule inhibitors of Aurora kinases have been developed and are currently undergoing preclinical and early clinical testing. In particular, MLN8237 is a novel, orally bioavailable, second-generation selective inhibitor of Aurora-A. MLN8237 has exhibited efficacy against solid tumours and hematologic malignancies in preclinical models and are currently undergoing clinical evaluation in hematological and solid cancers.[42, 43] In this report, we showed that MLN8237 not only inhibited tamoxifen-resistance breast cancer cell survival and tumour growth but also co-operated with tamoxifen in cell culture and orthotopic breast cancer model (Figures 3 and S4). In addition, MLN8237 abrogated Aurora-A phosphorylation of ERα-Ser167 and -Ser305 (Figure S8). These data underscore the potential of MLN8237 as either an independent or concurrent agent in tamoxifen-resistant breast cancer and the pERα-Ser167/Ser305 as potential clinical biomarkers in Aurora-A inhibitor therapy.

MATERIALS AND METHODS

Reagents and Plasmids

Antibodies for Aurora-A and p-Aurora-A-T288 were purchased from Abcam and Cell Signaling, respectively. ERα and p-ERα-Ser167 antibodies were from Upstates and Santa Cruz. Antibody for p-ERα-Ser305 was purchased from Millipore. Anti-HA and -Flag antibodies were from Sigma. Recombinant ERα and Aurora-A proteins were from Stressgen and Cell Signaling, respectively. HA-tagged (pHM6) Aurora-A, GFP-tagged and Myc-tagged full-length and truncated ERα mutants as well as GST-ERα constructs were previously described.[18, 27] Mutations of ERα-Ser167/Ser305 to alanine (ERα-2A) were prepared with QuikChange Site-directed Mutagenesis kit (Stratagene) and were confirmed by sequencing analysis. Small interfering RNAs (siRNA) of Aurora-A were from Qiagen. Tamoxifen and Aurora-A inhibitor MLN8237 were obtained from Sigma and Selleckchem, respectively.

Cell Culture and Transfection

Human breast cancer cell lines (T47D, BT474, MDA-MB-468, MDA-MB-231 and MCF-7) were obtained from ATCC. MCF-7-TamR was generated by chronic low dose treatment with tamoxifen.[44] The cells were grown in RPMI-1640 or DMEM medium supplemented with 10% fetal bovine serum or in phenol red-free DMEM with charcoal stripped serum. Transfections were performed using Lipofectamine™ 2000 (Invitrogen) following the manufacturer’s instruction. Frozen and formalin-fixed paraffin embedded human primary breast cancer and normal breast tissues were obtained from the Tissue Procurement Facility at Moffitt Cancer Center under an approved IRB protocol.

Western Blot, Immunoprecipitation, Immunohistochemistry (IHC) and Immuno-fluorescence Staining

Western blot, immunoprecipitation, IHC and immunofluorescence were performed as previously described.[45] Briefly, cell lysates were prepared in a lysis buffer and then subjected to immunoprecipitation and/or immunoblots with antibodies indicated in the Figure Legend. For IHC, breast cancer sections were immunostained with anti-Aurora-A (1:200), -ERα (1:250) and -ERα-Ser167/Ser305 (1:200) antibodies. The expression of Aurora-A and ERα was evaluated and scored as previously described.[7] Immunofluorescence staining was carried out by fixing cells with 10% formalin/10% methanol for 20 min, and permeabilized in 1% NP-40 in phosphate-buffered saline. Cells were then blocked by 10% normal goat serum in phosphate-buffered saline, and incubated with primary antibodies against Aurora-A and ERα followed by secondary antibodies. The DNA was counterstained with 4′,6-diamidino-2-phenylindole.

Luciferase Reporter Assay

Cells were transiently transfected with EREα-Luc or CCND1-Luc, Aurora-A, wild-type or mutant ERα and β-galactosidase. The amount of DNA in each transfection was kept constant by the addition of empty pHM6 vector. After 48 hours of transfection, luciferase activity was measured using a luciferase assay reagents (Promega). Luciferase activities were normalized with respect to parallel β-galactosidase activities, to correct for differences in transfection efficiency. β-galactosidase assays were performed using the β-Galactosidase Enzyme Assay System (Promega). Mass spectrometry, GST Pull-down, in vitro Kinase Assay and in vivo [32P]Pi Cell Labeling Mass spectrometry was performed as previously described.[27] Glutathione-Sepharose beads coupled with recombinant GST-Aurora-A or GST, were incubated with recombinant ERα (Abcam) in a binding buffer (50 mM HEPES, pH 7.2, 150 mM NaCl, 1 mM MgCl2, 1% Triton-X-100) for 2 h at 4°C. After washing the beads three times with the binding buffer, proteins bound to the beads were analyzed by 10% SDS–PAGE followed by immunoblotting with ERα antibody. In vitro Aurora-A kinase assay was performed by incubation of recombinant Aurora-A and recombinant ERα, as a substrate, in an in vitro kinase buffer for 25 min and followed by SDS–PAGE.[18] For in vivo labeling, MDA-MB-231 cells were transfected with ERα and together with and without HA-Aurora-A. After serum starvation overnight, cells were labeled with [32P]Pi (0.5 mCi/ml) in phenol red-free MEM without phosphate for 4 hours. ERα was immunoprecipitated and separated in SDS-PAGE. The phospho-ERα was detected and quantified.

RT-PCR and Chromatin Immunoprecipitation (ChIP)

RT-PCR and ChIP assays were performed as previously described.[27] Primers are: ERα, 5′-GGTGCCACCTGTGGTCCACCTG-3′ (sense) and 5′-CTTCACTTGTGGCCCAGATAGG-3′ (antisense); GAPDH, 5′-CATGTTCGTCATGGGTGTGAACCA-3′ (sense) and 5′-AGTGATGGCATGGACTGTGGTCAT-3′ (antisense); CCND1, 5′-GAACAGAAGTGCGAGAAGGAG-3′ (sense), and 5′-AGGCGGTAGTAGGACAGGAAG-3′ (antisense). For ChIP assay, the primers for CCND1 were used as following: forward (−1039) AACAAAACCAATTAGGAACCTT, reverse (−770) ATTTCCTTCATCTTGTCCTTCT. The PCR products were analyzed by electrophoresis on a 1.5% agarose gel and visualized by ethidium bromide staining.

Colony Formation, Cell Viability, Apoptosis Assays and Synergy Analysis

Colony formation, MTT and apoptotic assays were performed as previously described.[28] Each experiment was repeated three times in triplicate. The results are expressed as the enrichment factor relative to the untreated controls. The synergistic effects of drug combinations were evaluated with Calcusyn software (Biosoft). This software uses the Chou-Talalay combination index method, which is based on the median–effect equation, itself a derivation from the mass-action law.[46] For this analysis, Drug1 was combined with Drug2 at a constant ratio determined by IC50 Drug1/IC50 Drug2. We entered the resulting proliferation data, along with the data obtained from single drug treatments, into Calcusyn to determine a combination index value (CI) for each combination point, which quantitatively defines additivity (CI = 1.0), synergy (CI < 1.0), and antagonism (CI > 1.0). The resulting values were used to construct a plot of CI values over a range of fractions affected (FaCI plot).

Orthotopic Breast Cancer Mouse Model

Experimental procedures involving animals were reviewed and approved by the Institutional Animal Care and Use committee. Animal care was in accord with institution guidelines. Cells (5 × 106) were injected into mammary fat pads of 6 weeks old female nude mice (Charles River, Wilmington, MA). Tumour growth was monitored twice weekly by caliper measurements (LxWxD). When the tumours reached the average size of 100 mm3, the mice were divided into four groups, each with seven mice and an even distribution of tumour sizes, and treated as follows. Tamoxifen (at a dose of 5 mg) and Aurora-A inhibitor MLN8237 (at a dose of 30 mg/kg in a final formulation in 10% 2-hydroxypropyl-β-cyclodextrin/1% sodium bicarbonate) were orally given alone and combination daily for 26 days. Control group was orally given 100 μL vehicle control daily.

Breast Cancer Datasets

To assess the relation of overexpression of Aurora-A with recurrence of ERα-positive breast cancer treated with endocrine therapy, 674 ERα-positive breast cancers that were treated with antiestrogen agents were analyzed in the KM Plotter database (http://www.kmplot.com; Table S5). We also collected 4 different datasets from (Table S1). For each data set, we performed survival analysis to test if the Aurora-A levels are associated with recurrence. Each dataset has been processed independently from the other to preserve the original differences among the various studies (e.g., patient cohort, microarray type, sample processing protocol, etc.). We downloaded ERα-positive breast cancer gene expression datasets with clinical information from Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/GEO/), or author’s individual web pages. Table S3 reports the complete list of datasets and their sources. The datasets included both Affymetrix and dual-channel cDNA microarray platforms. When CEL files were available, expression values were generated from intensity signals using the RMA algorithm; values have been background adjusted, normalized using quantile normalization, and expression measure calculated using median polish 7 summarization.

Statistic Analysis

Statistic significance of differences between groups was analyzed by unpaired Student’s t test. The correlation of Aurora-A with ERα phosphorylation was examined by Chi-square. Hazard ratios (HR) and 95% confidence intervals (95% CI) were estimated using the Cox proportional hazards model. Recurrence-free survival time was calculated as the time between diagnosis and any of the events: locoregional recurrence, distant metastasis, or breast cancer death. Recurrence-free survival time distributions were compared with the log-rank test and plots were drawn using the Kaplan-Meier technique. Multivariate analysis of recurrence rates and breast cancer mortality rates was done with Cox proportional hazard regression, a method also used for the interaction analysis of different factors. All analyses were performed using the SPSS 11.5 Statistical Software, and p ≤ 0.05 was considered to be statistically significant.
  45 in total

1.  Aurora-A site specificity: a study with synthetic peptide substrates.

Authors:  Stefano Ferrari; Oriano Marin; Mario A Pagano; Flavio Meggio; Daniel Hess; Mahmoud El-Shemerly; Agnieszka Krystyniak; Lorenzo A Pinna
Journal:  Biochem J       Date:  2005-08-15       Impact factor: 3.857

Review 2.  Estrogen receptor: current understanding of its activation and modulation.

Authors:  C K Osborne; R Schiff; S A Fuqua; J Shou
Journal:  Clin Cancer Res       Date:  2001-12       Impact factor: 12.531

3.  Phosphatidylinositol 3-kinase/AKT-mediated activation of estrogen receptor alpha: a new model for anti-estrogen resistance.

Authors:  R A Campbell; P Bhat-Nakshatri; N M Patel; D Constantinidou; S Ali; H Nakshatri
Journal:  J Biol Chem       Date:  2001-01-03       Impact factor: 5.157

Review 4.  Estrogen receptor interaction with estrogen response elements.

Authors:  C M Klinge
Journal:  Nucleic Acids Res       Date:  2001-07-15       Impact factor: 16.971

5.  P21-activated kinase-1 phosphorylates and transactivates estrogen receptor-alpha and promotes hyperplasia in mammary epithelium.

Authors:  Rui-An Wang; Abhijit Mazumdar; Ratna K Vadlamudi; Rakesh Kumar
Journal:  EMBO J       Date:  2002-10-15       Impact factor: 11.598

Review 6.  Antiestrogen resistance in breast cancer and the role of estrogen receptor signaling.

Authors:  Robert Clarke; Minetta C Liu; Kerrie B Bouker; Zhiping Gu; Richard Y Lee; Yuelin Zhu; Todd C Skaar; Bianca Gomez; Kerry O'Brien; Yue Wang; Leena A Hilakivi-Clarke
Journal:  Oncogene       Date:  2003-10-20       Impact factor: 9.867

7.  AURORA-A amplification overrides the mitotic spindle assembly checkpoint, inducing resistance to Taxol.

Authors:  Shubha Anand; Sue Penrhyn-Lowe; Ashok R Venkitaraman
Journal:  Cancer Cell       Date:  2003-01       Impact factor: 31.743

Review 8.  Targeting Aurora-2 kinase in cancer.

Authors:  Steven L Warner; David J Bearss; Haiyong Han; Daniel D Von Hoff
Journal:  Mol Cancer Ther       Date:  2003-06       Impact factor: 6.261

9.  Aurora-A kinase regulates telomerase activity through c-Myc in human ovarian and breast epithelial cells.

Authors:  Hua Yang; Chien Chen Ou; Richard I Feldman; Santo V Nicosia; Patricia A Kruk; Jin Q Cheng
Journal:  Cancer Res       Date:  2004-01-15       Impact factor: 12.701

Review 10.  Molecular mechanisms, physiological consequences and pharmacological implications of estrogen receptor action.

Authors:  Tomas Barkhem; Stefan Nilsson; Jan-Ake Gustafsson
Journal:  Am J Pharmacogenomics       Date:  2004
View more
  16 in total

1.  A kinase inhibitor screen identifies Mcl-1 and Aurora kinase A as novel treatment targets in antiestrogen-resistant breast cancer cells.

Authors:  S Thrane; A M Pedersen; M B H Thomsen; T Kirkegaard; B B Rasmussen; A K Duun-Henriksen; A V Lænkholm; M Bak; A E Lykkesfeldt; C W Yde
Journal:  Oncogene       Date:  2014-11-03       Impact factor: 9.867

Review 2.  Mechanisms of resistance to estrogen receptor modulators in ER+/HER2- advanced breast cancer.

Authors:  Jin Zhang; Qianying Wang; Qing Wang; Jiangran Cao; Jiafu Sun; Zhengmao Zhu
Journal:  Cell Mol Life Sci       Date:  2019-08-30       Impact factor: 9.261

3.  Combination of Eribulin and Aurora A Inhibitor MLN8237 Prevents Metastatic Colonization and Induces Cytotoxic Autophagy in Breast Cancer.

Authors:  Varvara K Kozyreva; Anna A Kiseleva; Ryan J Ice; Brandon C Jones; Yuriy V Loskutov; Fatimah Matalkah; Matthew B Smolkin; Kristina Marinak; Ryan H Livengood; Mohamad A Salkeni; Sijin Wen; Hannah W Hazard; Ginger P Layne; Callee M Walsh; Pamela S Cantrell; Greg W Kilby; Sricharan Mahavadi; Neal Shah; Elena N Pugacheva
Journal:  Mol Cancer Ther       Date:  2016-05-27       Impact factor: 6.261

4.  Aurora A and Mcl-1: new potential treatment targets in antiestrogen-resistant breast cancer.

Authors:  Christina W Yde
Journal:  Mol Cell Oncol       Date:  2021-12-17

5.  Aurora-A-mediated phosphorylation of LKB1 compromises LKB1/AMPK signaling axis to facilitate NSCLC growth and migration.

Authors:  X Zheng; J Chi; J Zhi; H Zhang; D Yue; J Zhao; D Li; Y Li; M Gao; J Guo
Journal:  Oncogene       Date:  2017-10-02       Impact factor: 9.867

6.  OTUD6A Is an Aurora Kinase A-Specific Deubiquitinase.

Authors:  Hyo Jin Kim; Jongchan Kim
Journal:  Int J Mol Sci       Date:  2021-02-16       Impact factor: 5.923

7.  New cell culture model for aromatase inhibitor-resistant breast cancer shows sensitivity to fulvestrant treatment and cross-resistance between letrozole and exemestane.

Authors:  Stine Hole; Astrid M Pedersen; Susanne K Hansen; Johan Lundqvist; Christina W Yde; Anne E Lykkesfeldt
Journal:  Int J Oncol       Date:  2015-01-26       Impact factor: 5.650

8.  Aurora kinase B is important for antiestrogen resistant cell growth and a potential biomarker for tamoxifen resistant breast cancer.

Authors:  Sarah L Larsen; Christina W Yde; Anne-Vibeke Laenkholm; Birgitte B Rasmussen; Anne Katrine Duun-Henriksen; Martin Bak; Anne E Lykkesfeldt; Tove Kirkegaard
Journal:  BMC Cancer       Date:  2015-04-08       Impact factor: 4.430

9.  Aurora A is a prognostic marker for breast cancer arising in BRCA2 mutation carriers.

Authors:  Margret Aradottir; Sigridur T Reynisdottir; Olafur A Stefansson; Jon G Jonasson; Asgerdur Sverrisdottir; Laufey Tryggvadottir; Jorunn E Eyfjord; Sigridur K Bodvarsdottir
Journal:  J Pathol Clin Res       Date:  2014-11-07

10.  HIF2α contributes to antiestrogen resistance via positive bilateral crosstalk with EGFR in breast cancer cells.

Authors:  Muhammad Wasi Alam; Camilla Ulrika Persson; Susann Reinbothe; Julhash U Kazi; Lars Rönnstrand; Caroline Wigerup; Henrik Jorn Ditzel; Anne E Lykkesfeldt; Sven Påhlman; Annika Jögi
Journal:  Oncotarget       Date:  2016-03-08
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.