| Literature DB >> 24160257 |
Yousuke Higuchi, Junya Shimizu1, Michiyo Hatanaka, Etsuko Kitano, Hajime Kitamura, Hidetoshi Takada, Masataka Ishimura, Toshiro Hara, Osamu Ohara, Kenji Asagoe, Toshihide Kubo.
Abstract
C1q deficiency is a rare disease that is associated with a high probability of developing systemic lupus erythematosus. We report a 4-year-old Japanese girl who presented with fever, facial erythema, joint pain, and oral ulceration. Complement deficiencies were suspected because of her persistent hypocomplementemia and normal levels of the complement proteins C3 and C4. We identified a novel homozygous splicing mutation in the C1qB gene, c.187 + 1G > T, which is the first mutation to be confirmed in a Japanese individual. Because treatment with steroids and immunosuppressive drugs was not effective, we commenced use of fresh frozen plasma to provide C1q supplements. Currently, the patient remains almost asymptomatic, and we are attempting to control the drug dosage and administration intervals of fresh frozen plasma.Entities:
Year: 2013 PMID: 24160257 PMCID: PMC3874733 DOI: 10.1186/1546-0096-11-41
Source DB: PubMed Journal: Pediatr Rheumatol Online J ISSN: 1546-0096 Impact factor: 3.054
Figure 1Lupus erythematosus malar skin rash and rash on the hand and foot of our patient.
Laboratory findings on first visit of patient
| WBC | 6600/μl | 4500–15500 | CRP | 1.32 mg/dl | <0.1 |
| Seg | 5600/μl | 1500–8500 | ESR 60 min | 65 mm/60 min | 0–15 |
| Ly | 660/μl | 1200–8000 | | | |
| RBC | 379 × 104/μl | 390–490 | CH50 | <12.0 CH50/ml | 22–40 |
| Hb | 10.7 g/dl | 11.4–14.2 | C3 | 122 mg/dl | 71–159 |
| Ht | 30.5% | 34–40 | C4 | 45 mg/dl | 13–30 |
| Plt | 15.2 × 104/μl | 14.0–45.0 | RF | 31 IU/ml | <40 |
| AST | 31 IU/l | 18–63 | ANA(speckled) | 1:320 | <1:40 |
| ALT | 21 IU/l | 20–50 | Anti-dsDNA IGG | <10 IU/ml | <10 |
| LDH | 297 IU/l | 142–297 | Anti-Sm | 1:2 | <1:2 |
| Na | 141 mEq/l | 134–143 | Anti-RNP | 1:16 | <1:2 |
| K | 3.3 mEq/l | 3.4–4.9 | Anti-Ro | (-) | (-) |
| Cl | 104 mEq/l | 98–107 | Anti-La | (-) | (-) |
| Ca | 9.0 mg/dl | 8.8–10.3 | | | |
| TP | 6.3 g/dl | 5.6–7.7 | Urinalysis | | |
| Alb | 3.8 g/dl | 3.1–4.8 | U-protein | (-) | (-) |
| BUN | 6 mg/dl | 5–27 | U-glucose | (-) | (-) |
| Cre | 0.40 mg/dl | 0.30–0.90 | U-occult blood | (-) | (-) |
Analysis of complement system activity
| CH50 (U/ml) | 125 | 0 | 90–160 |
| (NHS %) | 100% | 0% | |
| ACH50 (U/ml) | 18.5 | 18.9 | |
| (NHS %) | 100% | 102% | 70–130% |
| C1 activity (U/ml) | 1450 | 100 | |
| (NHS %) | 100% | 7% | 70–130% |
| C2 activity (U/ml) | 400 | 360 | |
| (NHS %) | 100% | 90% | 70–130% |
| C4 activity (U/ml) | 2000 | 1600 | |
| (NHS %) | 100% | 80% | 70–130% |
NHS normal human serum, ACH50 alternative complement pathway activity.
Addition of purified human C1 subcomponent
| CH50 (U/ml) | 125 |
| (NHS %) | 100% |
| Patient serum + C1q (U/ml) | 140 |
| (NHS %) | 112% |
| Patient serum + C1r (U/ml) | 0 |
| (NHS %) | 0% |
| Patient serum + C1s (U/ml) | 0 |
| (NHS %) | 0% |
| Patient serum + activated C1s (U/ml) | 0 |
| (NHS %) | 0% |
NHS normal human serum.
List of primers used in this work
| C1QA-02-F | C1qA | 02 | F | TTGTGTGCATGGGACTCAAG | 56 | 60 |
| C1QA-02-R | C1qA | 02 | R | GGCCAAGTCAGGCCAAG | 58 | |
| C1QA-03a-F | C1qA | 03a | F | TCCCTGAGGACCAGTAGGC | 60 | 60 |
| C1QA-03a-R | C1qA | 03a | R | GGACAGGCAGATTTCCCAC | 58 | |
| C1QA-03b-F | C1qA | 03b | F | TCATCTTCGACACGGTCATC | 56 | 60 |
| C1QA-03b-R | C1qA | 03b | R | ATTTTACAGGCGGAGCATGG | 56 | |
| C1QB-02-F | C1qB | 02 | F | GGATGCAGATGGAGGGATAG | 58 | 60 |
| C1QB-02-R | C1qB | 02 | R | AGGCAACTGTGACTTGGGAG | 58 | |
| C1QB-03a-F | C1qB | 03a | F | GCAGGCCTCCTTCTTTTGG | 58 | 60 |
| C1QB-03a-R | C1qB | 03a | R | TCACGCACAGGTTCCCTC | 58 | |
| C1QB-03b-F | C1qB | 03b | F | CAGACCATCCGCTTCGAC | 58 | 60 |
| C1QB-03b-R | C1qB | 03b | R | GGGGTAGAGTGAGCGTTGC | 60 | |
| C1QC-02-F | C1qC | 02 | F | ATCCATGGTGAGGCTCCTG | 58 | 60 |
| C1QC-02-R | C1qC | 02 | R | CCCAGACAGACACTCTGATCC | 60 | |
| C1QC-03a-F | C1qC | 03a | F | GTTCCCTGGAAGACACCCTC | 60 | 60 |
| C1QC-03a-R | C1qC | 03a | R | TATGCGACGCGTGGTAGAC | 58 | |
| C1QC-03b-F | C1qC | 03b | F | AGCCTGATCAGATTCAACGC | 56 | 60 |
| C1QC-03b-R | C1qC | 03b | R | TGGCCAGTAAGGTGGGTCC | 60 |
F forward, R reverse, Tm temperature.
Figure 2Sequence analysis of the gene. A homozygous mutation was identified at the consensus splicing donor site in intron 2–3 caused by a G-to-T transversion (c.187 + 1G > T).
Figure 3Reverse transcriptase-polymerase chain reaction analysis of mRNA. A single band observed at 1458 bp was caused by a splicing error of intron 2–3. 1 kb+, 1,000 bp DNA-ladder marker; Pt., patient; C., normal control; NTC, no template control.
Figure 4Pedigree showing the heterozygosity of the patient’s parents and older brother, and the homozygosity of her younger brother, for c.187 + 1G > T.
Measurement of CH50 following transfusion of FFP in the patient
| CH50 (U/ml) | <12.0 | 25.5 | 24.6 | <12.0 |