| Literature DB >> 24137339 |
Tong Su1, Yifang Han, Yongwei Yu, Xiaojie Tan, Xiaopan Li, Jianguo Hou, Yan DU, Jian Shen, Guoping Wang, Liye Ma, Shuang Jiang, Hongwei Zhang, Guangwen Cao.
Abstract
Genome-wide association studies have been used to identify single nucleotide polymorphisms (SNPs) associated with renal cell carcinoma (RCC) in European individuals. The current study aimed to evaluate the correlation between significant SNPs identified in European individuals and the occurrence and postoperative prognosis of RCC in Chinese individuals. A total of 400 cases and 806 controls were involved in the current study. rs4765623, rs7105934, rs7579899 and rs1867785 were genotyped using qPCR, and the expression of cyclin D1 in renal tissue and RCCs was determined via western blotting and immunohistochemistry. The correlation between the SNPs/cyclin D1 expression and overall survival was evaluated using multivariate Cox regression analyses. Of the four SNPs, only rs7105934 was found to significantly correlate with RCC risk in Chinese individuals. The rs7105934 GA + AA genotype was correlated with a reduced risk of RCC with an odds ratio of 0.64 (95% confidence interval [CI], 0.43-0.96), following adjustment for age. This genotype was found to independently predict an improved postoperative prognosis in the multivariate analysis, with a hazard ratio (HR) of 0.12 (95% CI, 0.02-0.93). Expression of cyclin D1, a putative regulated protein of rs7105934, did not vary in adjacent renal tissue and tumors when compared with that of various rs7105934 genotypes. However, cyclin D1 expression in RCCs inversely correlated with advanced tumor stage, and moderate to high expression of cyclin D1 in RCCs independently predicted improved postoperative prognosis, with an HR of 0.13 (95% CI, 0.02-0.96). Observations of the present study indicate that the rs7105934 A allele is associated with reduced risk and improved postoperative prognosis of RCC; however, this effect is unlikely to be caused by cyclin D1 expression.Entities:
Keywords: cyclin D1; prognosis; renal cell carcinoma; risk; single nucleotide polymorphism
Year: 2013 PMID: 24137339 PMCID: PMC3789013 DOI: 10.3892/ol.2013.1422
Source DB: PubMed Journal: Oncol Lett ISSN: 1792-1074 Impact factor: 2.967
Primers and probes for genotyping the four single nucleotide polymorphisms.
| Variation | Primers 5′-3′ | Probes | |
|---|---|---|---|
| rs7105934 | G/A | GAGGAATGATGAACAAACTGTGGTA | FAM-CCAAAATGCATCGTGCTAAGAAGCC-TAMRA |
| CAGAACATCACATAAATGGAATCATACA | HEX-TCCAAAATGCATCATGCTAAGAAGCC-TAMRA | ||
| rs1867785 | A/G | GGACTTCTCTCTCCCTTCACCCT | FAM-AAATTAGCTTCGTTGACCTCAGCCAGC-TAMRA |
| TCCTGTGTTTCCAAGAGTTCTCAGA | HEX-ATTAGCTTCGTCGACCTCAGCCAGC-TAMRA | ||
| rs7579899 | A/G | ACACAGCCAAATCCAAGTCAGA | FAM-ACACCCTGTACAAAGCACTGCGACC-TAMRA |
| TGACCAAACACTAGGAAAGGAGAAG | HEX-ACACCCTGTACAGAGCACTGCGACC-TAMRA | ||
| rs4765623 | C/T | GGTCTCGCGCATGTGTCA | FAM- AGTACAGCCACCTCGGAGAGCCACT-TAMRA |
| CCAGATGCGTTCAGCAGTTC | HEX- AGTACAGCCACCTTGGAGAGCCACTG-TAMRA |
Demographic and clinicopathological characteristics of the study subjects.
| Characteristics | Cases, n (%) | Controls, n (%) | P-value |
|---|---|---|---|
| Age, years | |||
| ≤40 | 31 (7.8) | 36 (4.5) | 0.008 |
| 40–60 | 210 (52.5) | 380 (47.1) | |
| 60–80 | 147 (36.8) | 352 (43.7) | |
| >80 | 12 (3.0) | 38 (4.7) | |
| Gender | |||
| Male | 274 (68.5) | 548 (68.0) | 0.858 |
| Female | 126 (31.5) | 258 (32.0) | |
| Histology | |||
| Clear cell | 373 (93.3) | - | |
| Papillary | 12 (3.0) | - | |
| Chromophobe | 8 (2.0) | - | |
| Unclassified | 7 (1.8) | - | |
| AJCC (2002) stage | |||
| I | 324 (81.0) | - | |
| II | 33 (8.3) | - | |
| III | 43 (10.8) | - |
AJCC, American Joint Committee on Cancer.
Correlation between the four SNPs and risk of RCC following adjustment for age and gender.
| Genotype | Cases, n (%) | Controls, n (%) | OR (95% CI) | P-value |
|---|---|---|---|---|
| rs7105934 | ||||
| GG | 364 (91.0) | 700 (86.8) | 1.00 (reference) | |
| GA | 35 (8.8) | 102 (12.7) | 0.65 (0.43–0.97) | 0.036 |
| AA | 1 (0.3) | 4 (0.5) | 0.47 (0.05–4.25) | 0.500 |
| GG | 364 (91.0) | 700 (86.8) | 1.00 (reference) | |
| GA + AA | 36 (9.0) | 106 (13.2) | 0.64 (0.43–0.96) | 0.029 |
| G allele | 763 (95.4) | 1502 (93.2) | 1.00 (reference) | |
| A allele | 37 (4.6) | 110 (6.8) | 0.65 (0.44–0.95) | 0.028 |
| rs1867785 | ||||
| AA | 288 (72.0) | 561 (69.6) | 1.00 (reference) | |
| AG | 105 (26.3) | 227 (28.2) | 0.90 (0.69–1.19) | 0.472 |
| GG | 7 (1.8) | 18 (2.2) | 0.76 (0.31–1.86) | 0.552 |
| AA | 288 (72.0) | 561 (69.6) | 1.00 (reference) | |
| AG + GG | 112 (28.0) | 245 (30.4) | 0.89 (0.69–1.17) | 0.411 |
| A allele | 681 (85.1) | 1349 (83.7) | 1.00 (reference) | |
| G allele | 119 (14.9) | 263 (16.3) | 0.90 (0.71–1.14) | 0.381 |
| rs7579899 | ||||
| AA | 287 (71.8) | 560 (69.5) | 1.00 (reference) | |
| AG | 106 (26.5) | 228 (28.3) | 0.91 (0.69–1.19) | 0.495 |
| GG | 7 (1.8) | 18 (2.2) | 0.76 (0.31–1.86) | 0.554 |
| AA | 287 (71.8) | 560 (69.5) | 1.00 (reference) | |
| AG + GG | 113 (28.3) | 246 (30.5) | 0.90 (0.69–1.17) | 0.432 |
| A allele | 680 (85.0) | 1348 (83.6) | 1.00 (reference) | |
| G allele | 120 (15.0) | 264 (16.4) | 0.90 (0.71–1.14) | 0.399 |
| rs4765623 | ||||
| CC | 136 (34.0) | 268 (33.3) | 1.00 (reference) | |
| CT | 188 (47.0) | 385 (47.8) | 0.97 (0.74–1.28) | 0.845 |
| TT | 76 (19.0) | 153 (19.0) | 0.97 (0.68–1.37) | 0.844 |
| CC | 136 (34.0) | 268 (33.3) | 1.00 (reference) | |
| CT + TT | 264 (66.0) | 538 (66.7) | 0.97 (0.75–1.25) | 0.822 |
| C allele | 460 (57.5) | 921 (57.1) | 1.00 (reference) | |
| T allele | 340 (42.5) | 691 (42.9) | 0.98 (0.83–1.17) | 0.826 |
P-values were compared with the corresponding reference. SNPs, single nucleotide polymorphisms; RCC, renal cell carcinoma; OR, odds ratio.
Figure 1.Correlation between rs7105934 or cyclin D1 protein expression in tumor tissues and overall survival of RCC patients following curative nephrectomy (Kaplan-Meier analysis and log-rank test). (A) rs7105934 and overall survival (n=194). (B) Cyclin D1 protein expression in tumor tissues and overall survival (n=90). −, negative (<5% positive cancer cells); +, weak (5–20% positive); ++, moderate (20–60% positive); +++, strong (>60% positive); RCC, renal cell carcinoma.
Factors independently associated with overall survival of RCC patients in stepwise multivariate Cox regression analysis.
| Cases evaluated, n | Cases of RCC mortality, n | HR (95% CI) | P-value | |
|---|---|---|---|---|
| rs7105934 | ||||
| GG | 172 | 25 | 1.00 (reference) | |
| GA + AA | 22 | 1 | 0.12 (0.016–0.93) | 0.042 |
| AJCC (2002) stage | ||||
| I | 147 | 7 | 1.00 (reference) | |
| II | 12 | 3 | 5.79 (1.47–22.82) | 0.012 |
| III | 35 | 16 | 15.72 (6.36–38.84) | <0.001 |
RCC, renal cell carcinoma; HR, hazard ratio; AJCC, American Joint Committee on Cancer.
Figure 2.Correlation between rs7105934 genotypes and the expression of cyclin D1 in adjacent renal and RCC tissues. (A) Western blotting to determine cyclin D1 expression in adjacent renal tissue. (B) Immunohistochemistry for the analysis of cyclin D1 expression in RCC tissue. Bar indicates 20 μm and brown indicates positive immunostaining. RCC, renal cell carcinoma.
Correlation between rs7105934 genotypes or AJCC stage and cyclin D1 expression in ccRCC specimens.
| Cyclin D1 expression
| P-value | rs | |||
|---|---|---|---|---|---|
| − | + | ++/+++ | |||
| rs7105934 | |||||
| GG | 24 | 25 | 27 | 0.844 | 0.021 |
| GA | 5 | 3 | 5 | ||
| AA | 0 | 0 | 1 | ||
| GG | 24 | 25 | 27 | 0.884 | 0.016 |
| GA + AA | 5 | 3 | 6 | ||
| AJCC (2002) stage | |||||
| I | 16 | 15 | 26 | 0.046 | −0.211 |
| II | 3 | 3 | 2 | ||
| III | 10 | 10 | 5 | ||
Spearman’s correlation coefficient. AJCC, American Joint Committee on Cancer; −, negative (<5% positive cancer cells); +, weak (5–20% positive); ++, moderate (20–60% positive); +++, strong (>60% positive); ccRCC, clear cell renal cell carcinoma.