BACKGROUND: Leaves are determinate organs; hence, precise control of cell proliferation and post-mitotic cell expansion is essential for their growth. A defect in cell proliferation often triggers enhanced post-mitotic cell expansion in leaves. This phenomenon is referred to as 'compensation'. Several lines of evidence from studies on compensation have shown that cell proliferation and post-mitotic cell expansion are coordinately regulated during leaf development. Therefore, compensation has attracted much attention to the mechanisms for leaf growth. However, our understanding of compensation at the subcellular level remains limited because studies of compensation have focused mainly on cellular-level phenotypes. Proper leaf growth requires quantitative control of subcellular components in association with cellular-level changes. To gain insight into the subcellular aspect of compensation, we investigated the well-known relationship between cell area and chloroplast number per cell in compensation-exhibiting lines, and asked whether chloroplast proliferation is modulated in response to the induction of compensation. RESULTS: We first established a convenient and reliable method for observation of chloroplasts in situ. Using this method, we analyzed Arabidopsis thaliana mutants fugu5 and angustifolia3 (an3), and a transgenic line KIP-RELATED PROTEIN2 overexpressor (KRP2 OE), which are known to exhibit typical features of compensation. We here showed that chloroplast number per cell increased in the subepidermal palisade tissue of these lines. We analyzed tetraploidized wild type, fugu5, an3 and KRP2 OE, and found that cell area itself, but not nuclear ploidy, is a key parameter that determines the activity of chloroplast proliferation. In particular, in the case of an3, we uncovered that promotion of chloroplast proliferation depends on the enhanced post-mitotic cell expansion. The expression levels of chloroplast proliferation-related genes are similar to or lower than that in the wild type during this process. CONCLUSIONS: This study demonstrates that chloroplast proliferation is promoted in compensation-exhibiting lines. This promotion of chloroplast proliferation takes place in response to cell-area increase in post-mitotic phase in an3. The expression of chloroplast proliferation-related genes were not promoted in compensation-exhibiting lines including an3, arguing that an as-yet-unknown mechanism is responsible for modulation of chloroplast proliferation in these lines.
BACKGROUND: Leaves are determinate organs; hence, precise control of cell proliferation and post-mitotic cell expansion is essential for their growth. A defect in cell proliferation often triggers enhanced post-mitotic cell expansion in leaves. This phenomenon is referred to as 'compensation'. Several lines of evidence from studies on compensation have shown that cell proliferation and post-mitotic cell expansion are coordinately regulated during leaf development. Therefore, compensation has attracted much attention to the mechanisms for leaf growth. However, our understanding of compensation at the subcellular level remains limited because studies of compensation have focused mainly on cellular-level phenotypes. Proper leaf growth requires quantitative control of subcellular components in association with cellular-level changes. To gain insight into the subcellular aspect of compensation, we investigated the well-known relationship between cell area and chloroplast number per cell in compensation-exhibiting lines, and asked whether chloroplast proliferation is modulated in response to the induction of compensation. RESULTS: We first established a convenient and reliable method for observation of chloroplasts in situ. Using this method, we analyzed Arabidopsis thaliana mutants fugu5 and angustifolia3 (an3), and a transgenic line KIP-RELATED PROTEIN2 overexpressor (KRP2 OE), which are known to exhibit typical features of compensation. We here showed that chloroplast number per cell increased in the subepidermal palisade tissue of these lines. We analyzed tetraploidized wild type, fugu5, an3 and KRP2 OE, and found that cell area itself, but not nuclear ploidy, is a key parameter that determines the activity of chloroplast proliferation. In particular, in the case of an3, we uncovered that promotion of chloroplast proliferation depends on the enhanced post-mitotic cell expansion. The expression levels of chloroplast proliferation-related genes are similar to or lower than that in the wild type during this process. CONCLUSIONS: This study demonstrates that chloroplast proliferation is promoted in compensation-exhibiting lines. This promotion of chloroplast proliferation takes place in response to cell-area increase in post-mitotic phase in an3. The expression of chloroplast proliferation-related genes were not promoted in compensation-exhibiting lines including an3, arguing that an as-yet-unknown mechanism is responsible for modulation of chloroplast proliferation in these lines.
Leaf growth is driven by spatiotemporal control of cell proliferation and post-mitotic cell expansion. In the early developmental stage, cell proliferation actively occurs throughout leaf primordia. The proliferating region is maintained within a constant distance from the leaf base, then abruptly disappeared from distal to proximal regions of the leaf blade
[1-5]. After arrest of mitotic cycling, cells show post-mitotic expansion with an intense increase in vacuolar volume. During leaf development, a defect in cell proliferation often triggers enhanced post-mitotic cell expansion. This phenomenon is termed ‘compensation’
[6-8] and is widely observed in seed plants including Arabidopsis thaliana (hereafter Arabidopsis) and Oryza sativa[9-11]. Interestingly, our recent study of compensation revealed that the two driving forces of leaf growth —proliferation and post-mitotic expansion of cells— are coordinately regulated during development
[12]. Compensation is therefore considered to be a key phenomenon for understanding the control of leaf growth.Enhanced post-mitotic cell expansion could be detected by observing leaf cells from a paradermal view and measuring their area. Kinetics of the cell-area changes indicated that increase in cell area takes place in three distinct manner in compensation-exhibiting lines represented by angustifolia3 (an3) (enhanced rate of post-mitotic cell expansion), fugu5 (prolonged post-mitotic cell expansion) and a cyclin dependent kinase inhibitor gene KIP-RELATED PROTEIN2 overexpressor (KRP2 OE) (increase in cell area in both mitotic and post-mitotic phases)
[10,13]. The an3 is well characterized among compensation-exhibiting lines. The AN3 gene, also known as GRF-INTERACTING FACTOR1, encodes a transcriptional co-activator for leaf cell proliferation in Arabidopsis
[14-16]. In the an3 leaves, cell number is decreased by more than 70% but cell area is increased by 50% when compared with the WT
[10,15-17]. For induction of enhanced post-mitotic cell expansion, a decrease in cell proliferation below a threshold is required
[18]. This fact suggests that enhanced post-mitotic cell expansion in an3 is not a simple result of a defect in cell proliferation, but a result of an active motion for leaf growth in response to a defect in cell proliferation. This idea is supported by our recent analysis of chimeric leaves for AN3 expression: an3 mutant cells are considered to actively produce and transmit an inter-cellular signal for enhanced post-mitotic cell expansion
[12]. These studies have deepened our understanding of the mechanism of compensation, and hence leaf growth, at the cellular level.On the other hand, subcellular aspects in compensation-exhibiting lines including an3 have received less attention. Quantitative control of subcellular components is required for the proper functioning of leaf cells. Anatomical studies have revealed that the number of chloroplasts per cell is correlated with cell area
[19-21]. In this study, we investigated the number of chloroplasts per cell in compensation-exhibiting lines to address whether subcellular aspect is affected in response to the induction of compensation.Chloroplasts are derived from proplastids in meristematic cells, and multiply by division during leaf development. Two paralogous nucleus-encoded genes PLASTID DIVISION1 (PDV1) and PDV2 are involved in the chloroplast proliferation
[22-24]. The expression for PDV1 and PDV2 in Arabidopsis occurs in the shoot apical meristem and in young leaf primordia, and then decreases in parallel with cessation of chloroplast proliferation
[23,24]. Importantly, overexpression of PDV1 and/or PDV2 increases the number of chloroplasts, while a loss-of-function mutation in PDV1 and/or PDV2 has the opposite effect
[22-24]. Other components involved in chloroplast proliferation have been also identified such as self-assembling cytoskeletal GTPase genes Filamentous temperature sensitive Z1 (FtsZ1) and FtsZ2[25], a gene encoding J-domain containing protein ACCUMULATION AND REPLICATION OF CHLOROPLASTS 6 (ARC6)
[26], Min system-related genes [MinC, MinD, MinE and MULTIPLE CHLOROPLAST DIVISION SITE 1 (MCD1)]
[27,28]. Although involvement of these genes into chloroplast proliferation is apparent, it is known that overexpression or knockdown/knockout of them does not promote chloroplast proliferation
[25-31]. Therefore, the extent of chloroplast proliferation depends primarily on the expression levels of PDVs. It is worth investigating the expression level of PDVs in compensation-exhibiting lines to determine whether chloroplast proliferation is modulated in response to the induction of compensation.We here established a convenient method for counting chloroplasts in subepidermal palisade cells in situ. By use of this method, we investigate the relationship between cell area and chloroplast number per cell in compensation-exhibiting lines. Based on our results, we discuss the promotion of chloroplast proliferation in response to the enhanced post-mitotic cell expansion. In addition, we discuss whether the promotion of chloroplast proliferation occurs through an up-regulation of the expression levels of PDVs.
Results and discussion
Establishment of a method for counting chloroplasts in situ
We first established a concise method for counting chloroplasts in the subepidermal palisade cells in situ. A reason for focusing on subepidermal tissue is that cellular phenotypes therein are well characterized in compensation-exhibiting lines
[10,12,18]. To count chloroplasts, the first leaves from 21-day-old plants were immersed in 0.05% (v/v) Triton X-100 and 1% (v/v) glycerol under vacuum at room temperature, followed by observation. This method allowed us to clearly observe and count chloroplasts one by one by manually adjusting the focal plane up and down (Figure
1A-E and I). Cells below the subepidermal layer could also be observed (Figure
1F-H), ascertaining that this method is sufficient to obtain enough depth of focus to analyze the entire subepidermal layer in situ.
Figure 1
Observation of chloroplasts within subepidermal palisade cells. (A-H) Chloroplasts in subepidermal palisade cells observed using the method established here. Jigsaw-puzzle-shaped epidermal cells are seen in (A). Focal depth is gradually deepened from (A) to (H). Leaf samples are from 21-day-old plants. Arrowheads indicate focused chloroplasts. (I) Magnified view of the boxed region in (C). Focused chloroplasts are outlined in black. Bars = 50 μm (A-H) and 10 μm (I).
Observation of chloroplasts within subepidermal palisade cells. (A-H) Chloroplasts in subepidermal palisade cells observed using the method established here. Jigsaw-puzzle-shaped epidermal cells are seen in (A). Focal depth is gradually deepened from (A) to (H). Leaf samples are from 21-day-old plants. Arrowheads indicate focused chloroplasts. (I) Magnified view of the boxed region in (C). Focused chloroplasts are outlined in black. Bars = 50 μm (A-H) and 10 μm (I).
Chloroplast number per cell increased in the leaves of compensation-exhibiting lines
We next investigated the number of chloroplasts per cell in the subepidermal palisade tissue of 21-day-old compensation-exhibiting lines including fugu5, an3 and KRP2 OE. Chloroplast numbers per cell increased by 30%, 67% and 141% in fugu5-1, an3-4 and KRP2 OE lines, respectively, when compared with the WT (Figure
2A). These data were reproducible with small standard deviations, confirming the validity of our method for counting chloroplast numbers per cell. Furthermore, this result indicates that one of the subcellular processes (i.e., chloroplast proliferation) is modulated in association with the induction of compensation irrespective of the manner by which compensation occurs. In addition, we observed leaf cells from a paradermal view and measured their area using the same leaf samples, which are used also for chloroplast counting. We found that cell area increased by 37%, 65% and 157% in fugu5-1, an3-4 and KRP2 OE, respectively, when compared to the WT (Figure
2A). These increased ratios of cell area are similar to those of the number of chloroplasts per cell: the value of chloroplast number per cell/cell area is constant to a similar extent in compensation-exhibiting lines comparable to the level of WT (although the value is slightly but significantly decreased in KRP2 OE) (Figure
2B). These results suggest a tight relationship between final cell area and chloroplast number per cell in the subepidermal palisade tissue of compensation-exhibiting lines.
Figure 2
Increased number of chloroplasts per cell in the leaves of compensation-exhibiting lines. (A) Cell area and chloroplast number per cell measured in subepidermal palisade cells of WT, fugu5-1, an3-4 and KRP2 OE leaves. Leaf samples are from 21-day-old plants. The means ± SD of WT, fugu5-1, an3-4 and KRP2 OE lines are indicated. (B) Ratio of chloroplast number per cell/cell area in WT, fugu5-1, an3-4 and KRP2 OE leaves. (C) Area of mitotic subepidermal palisade cells of WT, fugu5-1, an3-4 and KRP2 OE leaf primordia. Leaf primordia are from 5-day-old seedlings. Asterisk indicates significant difference at P < 0.01 compared with WT (Student’s t-test).
Increased number of chloroplasts per cell in the leaves of compensation-exhibiting lines. (A) Cell area and chloroplast number per cell measured in subepidermal palisade cells of WT, fugu5-1, an3-4 and KRP2 OE leaves. Leaf samples are from 21-day-old plants. The means ± SD of WT, fugu5-1, an3-4 and KRP2 OE lines are indicated. (B) Ratio of chloroplast number per cell/cell area in WT, fugu5-1, an3-4 and KRP2 OE leaves. (C) Area of mitotic subepidermal palisade cells of WT, fugu5-1, an3-4 and KRP2 OE leaf primordia. Leaf primordia are from 5-day-old seedlings. Asterisk indicates significant difference at P < 0.01 compared with WT (Student’s t-test).Chloroplast proliferation activity decreases with developmental progression in WT leaves
[24]. On the other hand, our data indicate that the number of chloroplasts per cell is correlated with final cell area in the mature leaves, which is determined through the post-mitotic cell expansion. Mitotic cell area in 5-day-old fugu5-1 and an3-4 lines is similar to that in the WT (Figure
2C)
[10], supporting our idea that chloroplast proliferation is modulated in response to the status of post-mitotic cell expansion in these mutants. We should carefully consider the contribution of post-mitotic cell expansion to promotion of chloroplast proliferation in KRP2 OE, because area of mitotic cells in this line is about two fold larger than that in WT (Figure
2C)
[10,13]. Therefore, chloroplast proliferation could be modulated also during mitotic phase of leaf cells. Establishment of method for precise enumeration of immature chloroplasts in mitotic cells would be helpful to further investigate this issue.
Relationship between final cell area, nuclear ploidy and chloroplast number per cell
Final cell area often parallels the level of endoreduplication
[32]. In addition, previous studies have shown that AtCDT1a, a component of the prereplication complex for DNA replication, is localized in both the nucleus and chloroplasts, and is involved in the regulation of endoreduplication and chloroplast division
[33,34]. These facts suggest that nuclear ploidy is directly linked to chloroplast proliferation through the endoreduplication process. However, we concluded that nuclear ploidy does not directly linked to the chloroplast proliferation in compensation-exhibiting lines because the nuclear ploidy in these lines is varied, namely increased in fugu5-1, relatively normal in an3-4 and decreased in KRP2 OE compared to the WT (Figure
3A)
[10,17,35].
Figure 3
Effect of nuclear ploidy on chloroplast proliferation in the leaves of compensation-exhibiting lines. (A and B) Nuclear ploidy in diploid (A) and tetraploid (B) WT, fugu5-1, an3-4 and KRP2 OE lines analyzed through flowcytometoric analysis. Leaf samples are from 21-day-old plants. (C) Cell area and chloroplast number per cell measured in subepidermal palisade cells of WT, fugu5-1, an3-4 and KRP2 OE (diploid and tetraploid) leaves. di, diploid; tetra, tetraploid. Leaf samples are from 21-day-old plants. The means ± SD of WT, fugu5-1, an3-4 and KRP2 OE lines are indicated. Arrows indicate the difference between adjacent bars.
Effect of nuclear ploidy on chloroplast proliferation in the leaves of compensation-exhibiting lines. (A and B) Nuclear ploidy in diploid (A) and tetraploid (B) WT, fugu5-1, an3-4 and KRP2 OE lines analyzed through flowcytometoric analysis. Leaf samples are from 21-day-old plants. (C) Cell area and chloroplast number per cell measured in subepidermal palisade cells of WT, fugu5-1, an3-4 and KRP2 OE (diploid and tetraploid) leaves. di, diploid; tetra, tetraploid. Leaf samples are from 21-day-old plants. The means ± SD of WT, fugu5-1, an3-4 and KRP2 OE lines are indicated. Arrows indicate the difference between adjacent bars.Nuclear ploidy is increased through not only endoreduplication but also polyploidization. To further investigate the effect of increased nuclear ploidy on chloroplast proliferation, we established tetraploidized WT, fugu5-1, an3-4 and KRP2 OE lines (Figure
3B) and analyzed their leaves 21 days after sowing. We found that chloroplast number per cell increased by 55%, 43%, 53% and 15% in tetraploid WT, fugu5-1, an3-4 and KRP2 OE, respectively, when compared with diploid counterparts (Figure
3C). These rates of increase are different from that expected (100%) if chloroplast number per cell was linearly correlated with nuclear ploidy. Rather, these rates of increase are similar to those of cell area: in tetraploid WT, fugu5-1, an3-4 and KRP2 OE, cell areas increased by 69%, 34% 42% and 14%, respectively, compared to their diploid counterparts (Figure
3C). Together, we conclude that nuclear ploidy does not directly affect chloroplast proliferation, and final cell area is the key parameter for chloroplast proliferation.
Enhanced post-mitotic cell expansion is required for promotion of chloroplast proliferation in an3
We previously identified extra-small sister1 (xs1) mutant that shows decreased final cell area in leaves
[17]. The xs1 mutation suppresses enhanced post-mitotic cell expansion in an3 genetic background
[17], but does not affect cell area in mitotic phase irrespective of WT or an3-4 genetic background (Figure
4A). We next investigate whether promotion of chloroplast proliferation depends on the cell-area increase in post-mitotic phase using xs1 an3-4 double mutant line. The number of chloroplasts per cell decreased in subepidermal palisade tissue of 21-day-old xs1 an3-4 when compared with an3-4 in association with the decrease in final cell area (Figure
4B). We therefore concluded that chloroplast proliferation is promoted in response to the enhanced post-mitotic cell expansion in an3-4.
Figure 4
Promotion of chloroplast proliferation in response to the enhanced post-mitotic cell expansion in . (A) Area of mitotic subepidermal palisade cells of WT, xs1, an3-4 and xs1 an3-4 leaf primordia. Leaf primordia samples are from 5-day-old plants. The means ± SD from eight individual leaf primordia are indicated. (B) Cell area and chloroplast number per cell measured in subepidermal palisade cells of WT, xs1, an3-4 and xs1 an3-4 leaves. Leaf samples are from 21-day-old plants. The means ± SD of WT, xs1, an3-4 and xs1 an3-4 lines are indicated. Asterisk indicates significant difference at P < 0.01 between the two genotypes (WT versus xs1; an3-4 versus xs1 an3-4) (Student’s t-test).
Promotion of chloroplast proliferation in response to the enhanced post-mitotic cell expansion in . (A) Area of mitotic subepidermal palisade cells of WT, xs1, an3-4 and xs1 an3-4 leaf primordia. Leaf primordia samples are from 5-day-old plants. The means ± SD from eight individual leaf primordia are indicated. (B) Cell area and chloroplast number per cell measured in subepidermal palisade cells of WT, xs1, an3-4 and xs1 an3-4 leaves. Leaf samples are from 21-day-old plants. The means ± SD of WT, xs1, an3-4 and xs1 an3-4 lines are indicated. Asterisk indicates significant difference at P < 0.01 between the two genotypes (WT versus xs1; an3-4 versus xs1 an3-4) (Student’s t-test).
Chloroplast proliferation is promoted in compensation-exhibiting lines without up-regulation of the expression of PDVs
It was previously believed that expression level of PDVs determines the rate of chloroplast proliferation because increased or decreased level of PDVs expression lead to an increase or decrease in chloroplast proliferation, respectively
[23,24]. The expression for PDVs decreases along with leaf development in the WT, whereas our data indicate that chloroplast proliferation is promoted in response to increase in cell area. This fact suggests that the control of chloroplast proliferation might be more flexible than previously thought in response to the change in final cell area. If that is the case, whether the expression level of PDVs is up-regulated in response to cell-area change in leaves of compensation-exhibiting lines is an important question.To address this, we asked whether promotion of chloroplast proliferation occurs through the up-regulation of PDVs expression in compensation-exhibiting lines. We investigated the expression level of PDVs in the above-ground parts of 7-day-old seedling and leaf primordia in 14-day-old plants. Increase rate of cell area in fugu5-1, an3-4 and KRP2 OE is already higher than that in WT 14 days after sowing
[10]. However, the expression level of PDVs in these compensation-exhibiting lines is similar to or lower than that in the WT (Figure
5A). This result indicates that the promotion of chloroplast proliferation in response to the increase in cell area in compensation-exhibiting lines does not depend on the up-regulation of PDVs expression. We further investigated the expression levels of other chloroplast proliferation-related genes in compensation-exhibiting lines, and found that their expression levels are also similar to or lower than that in WT (Figure
5B). This fact implies that promotion of chloroplast proliferation in compensation-exhibiting lines does not depend on the up-regulation of the expression of chloroplast proliferation-related genes.
Figure 5
Transcription levels of chloroplast proliferation-related genes in compensation-exhibiting lines. (A and B) Expression levels of PDV1 and PDV2(A), and other chloroplast proliferation-related genes (B) in WT, fugu5-1, an3-4 and KRP2 OE. Samples are from above-ground parts of 7-day-old seedlings and leaf primordia of 14-day-old seedlings. Transcription levels of chloroplast proliferation-related genes including PDV1 and PDV2 were normalized to that of ACTIN2. Data are means ± S.D. (n = 3, with triplicates in each sample). Asterisk indicates significant difference at P < 0.01 compared with WT (Student’s t-test).
Transcription levels of chloroplast proliferation-related genes in compensation-exhibiting lines. (A and B) Expression levels of PDV1 and PDV2(A), and other chloroplast proliferation-related genes (B) in WT, fugu5-1, an3-4 and KRP2 OE. Samples are from above-ground parts of 7-day-old seedlings and leaf primordia of 14-day-old seedlings. Transcription levels of chloroplast proliferation-related genes including PDV1 and PDV2 were normalized to that of ACTIN2. Data are means ± S.D. (n = 3, with triplicates in each sample). Asterisk indicates significant difference at P < 0.01 compared with WT (Student’s t-test).
Conclusions
In this study we reported a reliable method for chloroplast enumeration in situ and demonstrated that chloroplast number per cell increases in compensation-exhibiting lines. Nuclear ploidy is not directly involved in the control of chloroplast proliferation in compensation-exhibiting lines. Of particular note is the finding that chloroplast proliferation is modulated during leaf development in response to the status of post-mitotic cells. In this process, the expression of PDVs and other chloroplast proliferation-related genes were not up-regulated, arguing an as-yet-unknown mechanism for promotion of chloroplast proliferation in response to cell-area change. These findings highlight a novel aspect of compensation, and, therefore, provide important insight into the fundamental understanding of leaf growth.
Methods
Plant materials and growth conditions
The WT accession of Arabidopsis used in this study was Columbia-0. Tetraploidization of WT, fugu5-1, an3-4 and KRP2 OE lines were carried out as described previously
[36], followed by flowcytometory analysis to confirm their nuclear ploidy
[37]. Plants were grown on rock wool at 22°C under 16 h light/8 h dark, and watered daily with 0.5 g L-1 Hyponex solution. Light at approximately 50 μmol m-2 s-1 was provided by white fluorescent lamps.
Chloroplast enumeration
The first leaves from 21-day-old plants are infiltrated with 0.05% (v/v) Triton X-100 and 1% (v/v) glycerol, and then counted the number of chloroplasts (n = 160 cells from 8 leaves for each line). Detailed method is described in the Results and Discussion section.
Measurement of cell area in leaves
After enumeration of chloroplast number per cell, the same leaf samples are subjected to analyze the cell area (n = 160 cells from 8 leaves for each line). Subepidermal palisade cells were observed under a light microscope (DMRX/E; Leica Microsystems). The leaf primordia was fixed in a formalin-acetic acid-alcohol (FAA) and cleared in a chloral hydrate solution (chloral hydrate, 200 g; glycerol 20 g; H2O, 50 ml) to measure the area of mitotic cells in the first leaves dissected from 5-day-old plants.
Quantification of transcripts of chloroplast proliferation-related genes by qRT-PCR
Total RNA was extracted from above-ground parts of 7-day-old seedlings and primordia of the first leaves in 14-day-old plants using RNeasy Plant mini kit (QIAGEN) according to the manufacturer’s instructions. First-strand cDNA was synthesized from the extracted RNA using ReverTra Ace qPCR RT Master Mix with gDNA remover kit (TOYOBO). The PCR products were monitored by use of StepOnePlus real-time PCR system (Applied Biosystems) using Thunderbird SYBR qPCR mix (TOYOBO). Primers used were as follows: 5′ - CTTAACGCAATTCGAACCGC - 3′ and 5′ - TCCTGCTCTGTTCAAGCCG - 3′ for PDV1, 5′ - GCTGAACGGCTTTTGCGTAT - 3′ and 5′ - AATCAATCTCAGAGAGAGCCAGTTG - 3′ for PDV2, and 5′ - TCGGTGGTTCCATTCTTGCT - 3′ and 5′ - GCTTTTTAAGCCTTTGATCTTGAGAG - 3′ for ACTIN2, or as described elsewhere
[38]. The expression levels of chloroplast proliferation-related genes were normalized by that of ACTIN2 gene as an internal standard and expressed relative to the WT level (WT = 1). The specificity of PCR amplification was examined by monitoring the melting curves. Data were obtained from three independent biological replicates with triplicates in each sample, and were analyzed statistically.
Authors’ contributions
KK and HT designed the research; GH helped design the research; KK performed the main parts of experiments; GH established xs1 an3-4 double mutant line; NI and HT carried out tetraploidization of Arabidopsis lines; KK, GH, NI, MYH and HT wrote the paper. All authors read and approved the final manuscript.
Authors: L De Veylder; T Beeckman; G T Beemster; L Krols; F Terras; I Landrieu; E van der Schueren; S Maes; M Naudts; D Inzé Journal: Plant Cell Date: 2001-07 Impact factor: 11.277
Authors: Megan Andriankaja; Stijn Dhondt; Stefanie De Bodt; Hannes Vanhaeren; Frederik Coppens; Liesbeth De Milde; Per Mühlenbock; Aleksandra Skirycz; Nathalie Gonzalez; Gerrit T S Beemster; Dirk Inzé Journal: Dev Cell Date: 2012-01-05 Impact factor: 12.270
Authors: Aurine Verkest; Carmem-Lara de O Manes; Steven Vercruysse; Sara Maes; Els Van Der Schueren; Tom Beeckman; Pascal Genschik; Martin Kuiper; Dirk Inzé; Lieven De Veylder Journal: Plant Cell Date: 2005-04-29 Impact factor: 11.277
Authors: Robert M Larkin; Giovanni Stefano; Michael E Ruckle; Andrea K Stavoe; Christopher A Sinkler; Federica Brandizzi; Carolyn M Malmstrom; Katherine W Osteryoung Journal: Proc Natl Acad Sci U S A Date: 2016-02-09 Impact factor: 11.205