Literature DB >> 24069329

Identification and characterization of a novel hemolysis-related gene in Streptococcus suis serotype 2.

Jun-xi Zheng1, Yue Li, Hui Zhang, Hong-jie Fan, Cheng-ping Lu.   

Abstract

Streptococcussuis serotype 2 (SS 2) is an important zoonotic pathogen that has caused two major infectious outbreaks of streptococcal toxic shock syndrome (STSS) in China. A novel gene located in the 89K pathogenicity island (PAI) encoding a putative hemolysin-III-related protein (Hhly3) has been previously characterized. In this study, the SS2 deletion mutant of the exogenous gene hhly3 was constructed by homologous recombination. This protein was found to exhibit cytolytic activity, and hemolytic activity of the hhly3 gene knockout mutant (Δhhly3) was significantly lower than that in the wild-type strain ZY05719. In addition, qRT-PCR revealed that Hhly3 played an important role in the expression of the secreted hemolysin SLY, which may be the key reason for the decreased hemolytic activity. Consequently, compared with the WT strain, the infection and pathogenicity of Δhhly3 was also decreased, as evidenced by in vitro bacterial growth in whole blood and by the in vivo zebrafish test, suggesting that hhly3 is a novel exogenous hemolysis-related gene in SS2 strains.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24069329      PMCID: PMC3775796          DOI: 10.1371/journal.pone.0074674

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

is a pathogen that is responsible for a variety of life-threatening infections in pigs and humans worldwide. Among the 33 known serotypes, serotype 2 (SS 2) is one of the most virulent and frequently isolated serotypes [1]. In particular, two major emerging human SS2 outbreaks in China (in 1998 and 2005), which mainly featured streptococcal toxic shock syndrome (STSS), indicated the emergence of new virulent streptococcal variants in China [2]. In our previous study, suppression subtractive hybridization (SSH) was employed to study the virulence factors of SS2 [3]. More than one-third of the hypothetical virulence fragments, including a specific fragment (SSU05_0925), were found to be associated with the candidate pathogenicity island (PAI) termed 89K [4]. This novel gene encoded a protein containing 8 N-terminal transmembrane domains. As the 328-432 aa transmembrane domains were relatively conserved in the integral membrane protein superfamily hemolysin-III (cl03831), this hypothetical protein was represented by the abbreviation Hhly3. Data published to date indicate that the prokaryotic members of the Hly-III family are expressed in many species and that they induce cytolysis of eukaryotic cells via three steps of pore formation [5]. Multiple sequence alignments revealed that Hhly3 showed considerable homology with TrbL/VirB6 plasmid conjugal transfer protein (pfam04610), which was one of the components of type IV secretion system (T4SS) [6]. In this study, an hhly3 deletion mutant of the Chinese virulent strain ZY05719 was constructed by homologous recombination to determine the role of this putative exogenous gene in hemolysis and other virulence-related functions of SS2.

Materials and Methods

Ethics

All animal experimental protocols were approved by approved by the Ethics Committee of Veterinary Institute Jiangsu Academy of Agricultural Sciences (No.SYXK 2010-0005) and performed accordingly. All efforts were made to minimize animals’ suffering.

Bacterial strains, plasmids, and growth conditions

The bacteria strains and plasmids used in the present study are listed in Table 1 and Table 2. SS2 strains (e.g. ZY05719) were grown in Todd-Hewitt broth (THB, Oxoid) liquid medium and plated on THB agar plates containing 5% (v/v) sheep blood. strains were grown in Luria broth (LB, Oxoid) and plated on LB agar plates. When required, antibiotics were added to the medium at the following concentrations: 100 µg/mL of spectinomycin (Sigma) for the SS2 mutant strain and 100 µg/mL of spectinomycin and 100 µg/mL of ampicillin (Sigma) for .
Table 1

Characteristics of the bacterial strains, plasmids, and primers used in this study.

Strain, Plasmid and primerRelevant characteristics a or sequence (5′- 3′)b Source or reference
Strains
ZY05719Virulent strain isolated from diseased pigs in Sichuan province in 2005Lab collection
Δhhly3Isogenic hhly3 mutant of strain ZY05719This study
hhly3Complemented strain of hhly3; Spc R This study
E. coli DH5αHost for cloning vectorInvitrogen
E. coli BL21 (DE3)For expressing the recombinant plasmidsInvitrogen
Plasmid
pSET4s S . suis thermosensitive suicide vector; Spc R Takamatsu (2001)
pSET4s: :hhly3 A recombinant vector with the background of pSET4s, designed to knockout hhly3; Spc R This study
pSET2 E. coli- S . suis shuttle vector; Spc R Takamatsu (2001)
pSET2: :hhly3 pSET2 containing the intact hhly3 gene and its upstream promoter; Spc R This study
Primer
CDS1 GTGAAACCATCAATAGTAAA Analyze distribution of the hhly3 geneThis study
CDS2 TCATGGTTTCTTACCGACTT
RH1CGGAATTC GTGACCTTTGCAGGAATCTA Truncated fragment of hhly3 This study
RH2CCCTCGAG ATGGTTTCTTACCGACTTTC
LA1 AA CTGCAG TTGTAATGGAATCAAC Upstream border of hhly3 This study
LA2 GC GTCGAC AGTTGAAAACTTTAGT
RA1 CG GGATCC ATTTACACCTCTTTTCGCA Downstream border of hhly3 This study
RA2 CC CCCGGG CTACCAGCAACAGCAATT
IN-F GTTGAAATACTAAATGCTGT Internal region of hhly3 This study
IN-R ACATTAAAAAAATCAATGAC
OUT-F CAGCTTGTGCTTCCGATAGTGG For combined PCR detectionThis study
OUT-R CTTTGGGATTCCTGTGGCTTTC
hhly3C-FCGGATCC TTCCGCTGTCCTGTTCATCT hhly3 gene and its upstream promoterThis study
hhly3C-RGCTGCAG CAATCAGAAGCGATTGCGTG
SLY1 TCATTCAGGTGCTTATGTTGCG Analyze the expression profiling of sly geneThis study
SLY2 GAAGATTGCGAGCATTTCCTGG

a Spc , spectinomycin resistance

b Underlined nucleotides denote enzyme restriction sites.

a Spc , spectinomycin resistance b Underlined nucleotides denote enzyme restriction sites. a Strains were isolated from diseased pigs. b Strains were isolated from healthy pigs. c Strains were isolated from diseased human.

Distribution of hhly3 in strains and localization of Hhly3

The isoelectric point (pI) and molecular weight (Mw) were predicted using DNAStar software. Primers were designed according to the open reading frame (ORF) to analyze the distribution of hhly3 in strains by PCR (Table 1). In a previous study, the shhly3 gene encoding the recombinant truncated protein Hhly3 was amplified using the primers RH1/RH2 (Table 1). The recombinant plasmid pET32a(+)::shhly3 was transformed into BL21 (DE3) for the expression of the recombinant protein rsHhly3. In addition, the immunogenicity of HisTrap-purified rsHhly3 was analyzed, and anti-rsHhly3 rabbit polyclonal antibody was prepared. In the previous study, Hhly3 was absent in the culture supernatant as well as in the cell wall of the wild-type (WT) strain ZY05719. In this study, the membrane-associated proteins of ZY05719 and its mutants were prepared according to the Triton X-114 extraction protocol [7]. The membrane-associated proteins were detected by Western blot analysis using rabbit polyclonal antibodies to rsHhly3 to determine the localization of Hhly3.

Deletion and functional complementation of hhly3

DNA fragments were PCR amplified from the chromosomal DNA of ZY05719 using two pairs of Hhly3-specific primers, LA1/LA2 and RA1/RA2 (Table 1). The fragments were directionally cloned into the temperature-sensitive - shuttle vector pSET4s [8] to generate the hhly3 knockout vector pSET4s::hhly3. Procedures for the selection of mutants by allelic exchange via double crossover have been described previously [9]. ZY05719 containing the pSET4s::hhly3 vector was grown at 28°C in the presence of spectinomycin before screening for the clones both vector-loss and exchanged the wild type allele hhly3 via a double cross-over homologous recombination at 37°C. The resulting Δhhly3 mutant strain was verified by PCR amplification using the primer pairs IN1/IN2 and OUT1/OUT2 (Figure 1A).
Figure 1

Construction and confirmation of the ZY05719Δhhly3 mutant strain.

(A) Construction strategy of hhly3 gene knockout mutant by allelic replacement.

(B) Localization analysis of Hhly3. Western blot analysis of membrane-associated proteins with anti-rHhly3 rabbit polyclonal antibodies.

(C) PCR confirmation of knockout mutant strain Δhhly3. The specific primer pair IN1/IN2 was used to detect the presence of the hhly3 gene in the SS2 genome. The flanking primer pair OUT1/OUT2 located outside LA and RA was designed to confirm double-crossover recombination in the mutant by combined PCR detection.

Construction and confirmation of the ZY05719Δhhly3 mutant strain.

(A) Construction strategy of hhly3 gene knockout mutant by allelic replacement. (B) Localization analysis of Hhly3. Western blot analysis of membrane-associated proteins with anti-rHhly3 rabbit polyclonal antibodies. (C) PCR confirmation of knockout mutant strain Δhhly3. The specific primer pair IN1/IN2 was used to detect the presence of the hhly3 gene in the SS2 genome. The flanking primer pair OUT1/OUT2 located outside LA and RA was designed to confirm double-crossover recombination in the mutant by combined PCR detection. For complementation assays, a DNA fragment containing the entire hhly3 gene and promoter sequence was cloned into the - shuttle vector pSET2 [10] to generate the hhly3-complementing plasmid pSET2::hhly3. The functional complement strain Δhhly3 (CΔhhly3) carrying this plasmid was obtained by selective growth in the presence of spectinomycin.

Hemolysin activity assay

SS2 strains were cultured on sheep blood agar plates incubated in a candle jar to create anoxic conditions. Hemolysin activity was tested as previously described [11]. Briefly, sterile culture supernatants or cell product following ultrasonication were prepared from bacterial cultures and centrifuged to separate the culture supernatant fluids and cell pellets. The sonicated cell pellets were suspended in cold phosphate-buffered saline (PBS; pH 7.0) to obtain bacterial protein. Serial twofold dilutions (150 µL) of the test samples were prepared in 96-well microplates. Approximately 150 µL of 1% sheep erythrocyte suspension was added to THB broth. After incubation for 2 h at 37°C, the microplates were centrifuged at 5,000g for 10 min, and 150 µL of the supernatant was transferred to a new plate for spectrophotometric measurements at 540 nm. Hemolysin units (HU) were defined as the reciprocal of the highest dilution of supernatant inducing at least 50% lysis of erythrocytes. The hemolytic activities of culture supernatant fluids during various growth phases were also observed.

SLY RNA manipulation and qRT-PCR

Total RNA was extracted from the bacterial culture at various growth phases by using the TRIZOL reagent [12]. cDNAs were created by reverse transcription with PrimeScript RT-PCR kit (Takara). The specific primers SLY1/SLY2 of the hemolysin gene sly are shown in Table 1. The relative change in the gene expression ratios of the selected genes was normalized to the expression of a single housekeeping gene (16S rRNA gene). Subsequently, the SYBR Premix Ex Taq kit (Takara Bio) was used for semi-quantitative RT-PCR assay, and the mRNA levels was analyzed by the comparative cycle threshold method (2 –ΔΔCT method) [13].

Survival in the presence of swine whole blood

Blood samples were collected from healthy pigs by venous puncture. Susceptibility assays were performed as previously described [14]. WT, Δhhly3, and CΔhhly3 were cultured to OD600 = 0.4–0.6, and the cells were pelleted and suspended in THB medium to obtain an OD600 of 0.1. The whole blood, pig serum, and SS2 cell mixture was incubated for 3 h at 37°C with occasional gentle shaking. Infected whole blood cultures were harvested at 0 and 3 h to determine bacterial growth using the plate count method. The first time point (0 h) was considered as the 100% viability control.

Animal infections

The use of zebrafish as an infection model for has been accepted by the World Organization for Animal Health (OIE) [15]. Zebrafish were assigned to six groups, with 15 zebrafish per group. As a matter of fact, the median lethal dose (LD50) should be ascertained to determine the differences in virulence between the WT and mutant strains. The SS2 strain was cultured to the logarithmic growth phase, then adjusted to 5 × 109 CFU/mL and serially diluted tenfold until the lowest concentration of 5 × 104 CFU/mL was reached. These three SS2 strains were injected intraperitoneally at a concentration of 0.01 mL into the zebrafish. The mortality of the zebrafish was recorded, and the LD50 value was calculated according to Karber [16].

Statistical analysis

All assays were performed in triplicate. Statistical analyses were carried out using the GraphPad Software package. Where appropriate, the data were analyzed using Student’s t test. The non-parametric Mann-Whitney U test was used for the analysis of the animal infection study. A P value of <0.05 was considered statistically significant and P < 0.01 was considered highly statistically significant.

Results

The hhly3 gene was located at 896463–898574 bp on the complementary strand of the ZY05719 genome, and it encoded a hypothetical protein with a predicted molecular mass of 78 kDa and a pI of 9.82. PCR analysis of hhly3 distribution revealed that this gene was present in most Chinese SS2 isolates, especially those isolated from the regions surrounding the two large outbreak areas, but the gene was not present in the avirulent strain T15 and in other European virulent isolates such as P1/7 (Table 2). This result was also consistent with the detection result of 89K PAI, suggesting that the hhly3 gene is an exogenous gene of SS2.
Table 2

Distribution of the hhly3-specific DNA fragments.

StrainSerotype or speciesSourcea hhly3 89K PAI
BA853SS2ATCCa --
700794SS2Canada, ATCCa --
P1/7SS2Netherlands, ATCCa --
T15SS2Netherlands, ATCCb --
JDZ05802-2SS2Jiangxia ++
191SS2Sichuanc ++
ZY05721SS2Sichuana ++
ZY05719SS2Sichuana ++
SS2-HSS2Jiangsua ++
HA9801SS2Jiangsua ++
59ASS2Shanghaia ++
159ESS2Shanghaia ++
97ASS2Zhejianga --
JR05730SS2Jiangsua ++
S50SS2Guangdonga --
88BSS2Guangdonga ++
227SS2Sichuanc ++
98012SS2Jiangsuc ++
XTSS2Hunana ++
HASS2Jiangsua ++
05464SS2Sichuana ++
SH28SS1Shanghaia --
SH13SS10Shanghaib --
DL15SS10Sichuanb --
NP4SS12Na --
AH091106SS11Anhuia --
26S1SS1/2 Canadaa --
SS9-2083SS9Shanghaib --
SH06SS9Na --
SH59SS9Shanghaia --
SH65SS7Guangdonga --
SH04805SS7Shanghaia --

a Strains were isolated from diseased pigs.

b Strains were isolated from healthy pigs.

c Strains were isolated from diseased human.

Moreover, Western blot analysis of Hhly3 showed that this protein was localized in the membrane of ZY05719 (Figure 1B). As it was absent both in the culture supernatant as well as in the cell wall and its multiple transmembrane domains, we inferred that it may be a membrane channel protein.

Construction and characterization of an hhly3-defective mutant

An isogenic hhly3 mutant of the WT strain ZY05719 was constructed through homologous recombination. The double-crossover event was confirmed by multiple PCR (Figure 1C) and direct DNA sequencing (data not shown), verifying that an isogenic knockout mutant of hhly3 (namely Δhhly3) was successfully constructed without alteration of the remaining sequences.

Deletion of hhly3 decreases the hemolytic activity of

In order to study the hemolytic activity of Hhly3, the hhly3-complementing plasmid pSET2::hhly3 was transformed into BL21 (DE3), the commercially available competent strain. The hemolytic activity of the bacterial protein harvested by ultrasonication was measured. The bacterial protein of pSET2::hhly3 BL21 had significantly higher (P < 0.01) hemolytic activity than BL21 (pSET2; Figure 2A), suggesting that Hhly3 is a hemolytic protein.
Figure 2

Hemolytic activity analysis.

(A) Hemolytic activities of different strains. 1–3, Supernatants of WT, Δhhly3, and CΔhhly3 strains, respectively. 4–8, Pellets of WT, Δhhly3, CΔhhly3, BL21 (pSET2::hhly3), and BL21 (pSET2) strains, respectively.

(B) Titration of hemolytic activities of culture supernatants of different strains in the stationary phase.

(C) Hemolytic unit analysis of the supernatants of the SS2 strain at different phases of growth.

a, early logarithmic phase (OD600 < 0.3). b, mid-logarithmic phase (OD600 = 0.4–0.6). c, late logarithmic phase (OD600 = 0.6–0.8). d, late logarithmic phase (OD600 = 1.0–1.2). e, stationary phase (OD600 > 1.2).

(D) Expression profiles of sly at different stages of growth.

a, early logarithmic phase (OD600 < 0.3). b, mid-logarithmic phase (OD600 = 0.4–0.6). c, late logarithmic phase (OD600 = 0.6–0.8). d, late logarithmic phase (OD600 = 1.0–1.2). e, stationary phase (OD600 > 1.2).

Hemolytic activity analysis.

(A) Hemolytic activities of different strains. 1–3, Supernatants of WT, Δhhly3, and CΔhhly3 strains, respectively. 4–8, Pellets of WT, Δhhly3, CΔhhly3, BL21 (pSET2::hhly3), and BL21 (pSET2) strains, respectively. (B) Titration of hemolytic activities of culture supernatants of different strains in the stationary phase. (C) Hemolytic unit analysis of the supernatants of the SS2 strain at different phases of growth. a, early logarithmic phase (OD600 < 0.3). b, mid-logarithmic phase (OD600 = 0.4–0.6). c, late logarithmic phase (OD600 = 0.6–0.8). d, late logarithmic phase (OD600 = 1.0–1.2). e, stationary phase (OD600 > 1.2). (D) Expression profiles of sly at different stages of growth. a, early logarithmic phase (OD600 < 0.3). b, mid-logarithmic phase (OD600 = 0.4–0.6). c, late logarithmic phase (OD600 = 0.6–0.8). d, late logarithmic phase (OD600 = 1.0–1.2). e, stationary phase (OD600 > 1.2). In addition, we compared the hemolytic activities of the SS2 mutant strains. Different SS2 strains were inoculated on sheep blood agar plates and incubated in anoxic conditions, and the α-hemolytic zones created by the Δhhly3 strain were slightly smaller than those created by the WT strain. Consequently, the hemolytic activity of the supernatant and protein fraction of the Δhhly3 mutant was significantly lower (P < 0.01) than that in the hhly3 strain, and this activity was subsequently restored in CΔhhly3 (Figure 2A). In general, the hemolysis mainly occurred in the supernatant in the SS2 strain as the hemolytic activities of bacterial proteins were much poorer than those of the culture supernatant (Figure 2A). Furthermore, the effects of hhly3 inactivation on the hemolytic activities of bacterial proteins were also lower than in the supernatants (Figure 2A). Considering differences in the hemolytic activities during various growth phases, the late logarithmic phase to stationary phase was considered suitable for determining the hemolytic activity. In the stationary phase (OD600 = 1.0–1.3), the highest dilution of culture supernatants that induced at least 50% lysis of erythrocytes for the ZY05719, Δhhly3, and CΔhhly3 strains were 1:128, 1:32, and 1:128, respectively (Figure 2B). In terms of cell growth, the difference between the Δhhly3 mutant and the WT strain increased in significance till the stationary phase was reached (Figure 2C).

Expression profiling of the sly gene

The expression profile of sly encoding the known secreted hemolysin was analyzed in SS2 strains in vitro by qRT-PCR. Equal amounts of total RNA were reverse-transcribed from different growth phases. The expression of sly exhibited the same variation as hemolytic activity of culture supernatants (Figure 2d). Compared with the WT strain, the mRNA levels of sly in the late logarithmic phase was significantly decreased by 76% in the Δhhly3 mutant (P < 0.05).

Decreased susceptibility in whole blood

As shown in Figure 3, Δhhly3 had a higher death rate in the whole pig blood in vitro than WT strain and the complementation strain CΔhhly3 (P < 0.01). After 3 h of incubation, the survival rates of ZY05719, Δhhly3, and CΔhhly3 were 30.4%, 46.8%, 39.7%, respectively, indicating that the resistance of the pathogen to phagocytosis and killing in whole blood decreased by hhly3 inactivation.
Figure 3

Survival of the WT, Δhhly3, and CΔhhly3 strains in pig whole blood.

The percentage survival rate of Δhhly3 was significantly lower than that in the WT strain and the complement strain CΔhhly3 (** P < 0.01).

Survival of the WT, Δhhly3, and CΔhhly3 strains in pig whole blood.

The percentage survival rate of Δhhly3 was significantly lower than that in the WT strain and the complement strain CΔhhly3 (** P < 0.01).

Virulence attenuation by hhly3 inactivation

The effect of the hhly3 gene in virulence was evaluated in the zebrafish model by intraperitoneal administration of various doses of ZY05719, Δhhly3, and CΔhhly3. The mortality of zebrafish was observed within 7 days after the challenge. As shown in Table 3, the LD50 was 2.39 × 105 1.30 × 106, and 4.23 × 105 CFU/zebrafish for the WT, Δhhly3, and CΔhhly3 strains, respectively (P < 0.05).
Table 3

Calculation of LD50 for the ZY05719 strain, mutants, and complemented strain in zebrafish.

Challenge dose (CFU)Zebrafish numbersDeath numbers a
ZY05719Δhhly3 hhly3
5×107 1515.0 ± 0.015.0 ± 0.015.0 ± 0.0
5×106 1514.0 ± 1.010.7 ±1.213.3 ± 0.6
5×105 159.3 ± 1.24.7 ±1.28.7 ± 0.6
5×104 153.3 ± 0.61.0 ± 1.01.7 ±0.6
5×103 150.7 ± 0.60.0 ± 0.00.0 ± 0.0
5×102 150.0 ± 0.00.0 ± 0.00.0 ± 0.0
Value of LD50 (×105)2.39 ± 0.2112.97 ± 1.10b 4.23 ± 0.71b

a Values are means ± Standard deviations (three samples per group)

b Significantly different (P < 0.05) from value for WT strain group as calculated by the non-parametric Mann-Whitney U test

a Values are means ± Standard deviations (three samples per group) b Significantly different (P < 0.05) from value for WT strain group as calculated by the non-parametric Mann-Whitney U test

Discussion

Hemolytic activity is a phenotypic marker used to distinguish between highly virulent and avirulent isolates. Thus far, bacterial hemolysin can be categorized into many types, including the cholesterol-binding cytolysin family and repeats in toxin (RTX) family. This study confirmed that Hhly3 possesses hemolytic activity. The hemolytic activity of the Δhhly3 mutant was significantly lower than that of the WT strain; however, it did not completely disappear. This study indicated that SS2 hemolysis was largely dependent on the cytolysis activity of secretory proteins, especially the dominant hemolysin SLY. The characteristics of SLY are clear: this secreted protein had higher expression and secretion levels as well as greater stability in the late logarithmic phase [17,18]. It is noteworthy that as an exotoxin, SLY should be exposed in time after the expression reducing the risk of toxicity to donor bacteria. Hhly3, which has been verified to be a hemolytic membrane channel protein, was considerable to have homology with a component in T4SS for protein secretion [19]. In this study, the low expression of SLY achieved by hhly3 inactivation was in compliance with the negative regulation to block the secretion of SLY. Therefore, we have reason to speculate that hhly3 inactivation may block of the secretory pathways of SLY, causing imbalance of expression and secretion. Therefore, the expression level of SLY was reduced to ensure the survival of bacteria, and the hemolytic activity of SS2 was greatly decreased. In addition, we found that the European virulent isolate P1/7, which lacked 89K PAI, showed considerably higher degree of hemolysis while carrying the pSET2::hhly3 plasmid, indicating that Hhly3 was one of the important factors of cytolysis. Furthermore, SLY-positive strains seem to additionally benefit from the toxic effects of this hemolysin for polymorphonuclear neutrophil (PMNs) and could better survive in blood [20]. The susceptibility of Δhhly3 in pig blood decreased mainly due to the lower expression of SLY, which might account partially for the virulence loss in Δhhly3 in zebrafish infection. However, Hhly3 might be also related to the secretion of some extracellular proteins relevant to colonization and immune escape, although additional studies are require to confirm this assumption. 89K PAI is a novel mosaic PAI candidate that is prevalent and unique in Chinese SS2 virulent strains. Since the discovery of this PAI, multiple virulence factors have been characterized [21,22]. This study showed that the putative exogenous gene, hhly3, was in 89K PAI and expressed successfully, strongly suggesting that this PAI is responsible for the great variation in the virulence of strain SS2, resulting in high casualties during the two outbreaks of STSS. During the infection of SS2, the WT strain carrying the hhly3 gene was more significant in infection. More importantly, this hemolytic protein played an important role in expression of the major hemolysis factor SLY, causing considerably greater damage to the host cell.
  21 in total

1.  Distribution of Streptococcus suis capsular types in 1999.

Authors:  R Higgins; M Gottschalk
Journal:  Can Vet J       Date:  2000-05       Impact factor: 1.008

2.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

3.  Agrobacterium tumefaciens VirB6 domains direct the ordered export of a DNA substrate through a type IV secretion System.

Authors:  Simon J Jakubowski; Vidhya Krishnamoorthy; Eric Cascales; Peter J Christie
Journal:  J Mol Biol       Date:  2004-08-20       Impact factor: 5.469

4.  Type IV secretion system core component VirB8 from Brucella binds to the globular domain of VirB5 and to a periplasmic domain of VirB6.

Authors:  Ana Maria Villamil Giraldo; Durga Sivanesan; Anna Carle; Athanasios Paschos; Mark A Smith; Maria Plesa; James Coulton; Christian Baron
Journal:  Biochemistry       Date:  2012-04-26       Impact factor: 3.162

5.  Thermosensitive suicide vectors for gene replacement in Streptococcus suis.

Authors:  D Takamatsu; M Osaki; T Sekizaki
Journal:  Plasmid       Date:  2001-09       Impact factor: 3.466

6.  Phagocytosis and killing of Streptococcus suis by porcine neutrophils.

Authors:  Geneviève Chabot-Roy; Philip Willson; Mariela Segura; Sonia Lacouture; Marcelo Gottschalk
Journal:  Microb Pathog       Date:  2006-05-22       Impact factor: 3.738

7.  Characterization and virulence of hemolysin III from Vibrio vulnificus.

Authors:  Yu-Chung Chen; Ming-Chung Chang; Yin-Ching Chuang; Chii-Ling Jeang
Journal:  Curr Microbiol       Date:  2004-09       Impact factor: 2.188

8.  Recovery of total microbial RNA from lactic acid fermented foods with a high starch content.

Authors:  F Ampe; N ben Omar; J P Guyot
Journal:  Lett Appl Microbiol       Date:  1998-11       Impact factor: 2.858

9.  A glimpse of streptococcal toxic shock syndrome from comparative genomics of S. suis 2 Chinese isolates.

Authors:  Chen Chen; Jiaqi Tang; Wei Dong; Changjun Wang; Youjun Feng; Jing Wang; Feng Zheng; Xiuzhen Pan; Di Liu; Ming Li; Yajun Song; Xinxing Zhu; Haibo Sun; Tao Feng; Zhaobiao Guo; Aiping Ju; Junchao Ge; Yaqing Dong; Wen Sun; Yongqiang Jiang; Jun Wang; Jinghua Yan; Huanming Yang; Xiaoning Wang; George F Gao; Ruifu Yang; Jian Wang; Jun Yu
Journal:  PLoS One       Date:  2007-03-21       Impact factor: 3.240

10.  Streptococcal toxic shock syndrome caused by Streptococcus suis serotype 2.

Authors:  Jiaqi Tang; Changjun Wang; Youjun Feng; Weizhong Yang; Huaidong Song; Zhihai Chen; Hongjie Yu; Xiuzhen Pan; Xiaojun Zhou; Huaru Wang; Bo Wu; Haili Wang; Huamei Zhao; Ying Lin; Jianhua Yue; Zhenqiang Wu; Xiaowei He; Feng Gao; Abdul Hamid Khan; Jian Wang; Guo-Ping Zhao; Yu Wang; Xiaoning Wang; Zhu Chen; George F Gao
Journal:  PLoS Med       Date:  2006-04-11       Impact factor: 11.069

View more
  4 in total

1.  Streptococcus suis in invasive human infections in Poland: clonality and determinants of virulence and antimicrobial resistance.

Authors:  A Bojarska; E Molska; K Janas; A Skoczyńska; E Stefaniuk; W Hryniewicz; E Sadowy
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2016-03-15       Impact factor: 3.267

2.  An NLRP3 inflammasome-triggered cytokine storm contributes to Streptococcal toxic shock-like syndrome (STSLS).

Authors:  Lan Lin; Lei Xu; Weihua Lv; Li Han; Yaozu Xiang; Lei Fu; Meilin Jin; Rui Zhou; Huanchun Chen; Anding Zhang
Journal:  PLoS Pathog       Date:  2019-06-06       Impact factor: 6.823

3.  Ribosomal Protein SA-Positive Neutrophil Elicits Stronger Phagocytosis and Neutrophil Extracellular Trap Formation and Subdues Pro-Inflammatory Cytokine Secretion Against Streptococcus suis Serotype 2 Infection.

Authors:  Qiang Sun; Na Li; Li Jia; Wenfei Guo; Hexiang Jiang; Baijun Liu; Chuntong Bao; Mengmeng Liu; Jing Huang; Liancheng Lei
Journal:  Front Immunol       Date:  2021-02-02       Impact factor: 7.561

4.  Identification of Streptococcus suis putative zoonotic virulence factors: A systematic review and genomic meta-analysis.

Authors:  Thomas J Roodsant; Boas C L Van Der Putten; Sara M Tamminga; Constance Schultsz; Kees C H Van Der Ark
Journal:  Virulence       Date:  2021-12       Impact factor: 5.882

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.